This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Osuna, R Articles by Bender, R A Search for Related Content PubMed PubMed Citation Articles by Osuna, R Articles by Bender, R A

 Previous Article  |  Next Article 

J Bacteriol. 1994 September; 176(17): 5525-5529

research-article

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Department of Biology, University of Michigan, Ann Arbor 48109-1048.

ABSTRACT

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.

This article has been cited by other articles:

• Rosario, C. J., Bender, R. A. (2005). Importance of Tetramer Formation by the Nitrogen Assimilation Control Protein for Strong Repression of Glutamate Dehydrogenase Formation in Klebsiella pneumoniae. J. Bacteriol. 187: 8291-8299 [Abstract] [Full Text]  
• Fujimoto, D. F., Brunskill, E. W., Bayles, K. W. (2000). Analysis of Genetic Elements Controlling Staphylococcus aureus lrgAB Expression: Potential Role of DNA Topology in SarA Regulation. J. Bacteriol. 182: 4822-4828 [Abstract] [Full Text]