This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horiuchi, T.
Right arrow Articles by Komano, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horiuchi, T.
Right arrow Articles by Komano, T.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2002, p. 6803-6810, Vol. 184, No. 24
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.24.6803-6810.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

Takayuki Horiuchi,1,2 Takuya Akiyama,1 Sumiko Inouye,2 and Teruya Komano1*

Department of Biology, Tokyo Metropolitan University, Minamiohsawa, Hachioji, Tokyo 192-0397, Japan,1 Department of Biochemistry, Robert Wood Johnson Medical School, Piscataway, New Jersey 088542

Received 13 May 2002/ Accepted 13 September 2002

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.


* Corresponding author. Mailing address: Department of Biology, Tokyo Metropolitan University, Minamiohsawa, Hachioji, Tokyo 192-0397, Japan. Phone: 81-426-77-2568. Fax: 81-426-77-2559. E-mail: komano-teruya{at}c.metro-u.ac.jp.


Journal of Bacteriology, December 2002, p. 6803-6810, Vol. 184, No. 24
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.24.6803-6810.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Yoder-Himes, D. R., Kroos, L. (2006). Regulation of the Myxococcus xanthus C-Signal-Dependent {Omega}4400 Promoter by the Essential Developmental Protein FruA.. J. Bacteriol. 188: 5167-5176 [Abstract] [Full Text]  
  • Viswanathan, K., Viswanathan, P., Kroos, L. (2006). Mutational Analysis of the Myxococcus xanthus {Omega}4406 Promoter Region Reveals an Upstream Negative Regulatory Element That Mediates C-Signal Dependence. J. Bacteriol. 188: 515-524 [Abstract] [Full Text]  
  • Ueki, T., Inouye, S. (2005). Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus. J. Bacteriol. 187: 8504-8506 [Abstract] [Full Text]  
  • Akiyama, T., Inouye, S., Komano, T. (2003). Novel Developmental Genes, fruCD, of Myxococcus xanthus: Involvement of a Cell Division Protein in Multicellular Development. J. Bacteriol. 185: 3317-3324 [Abstract] [Full Text]