This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramos-González, M. I.
Right arrow Articles by Espinosa-Urgel, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramos-González, M. I.
Right arrow Articles by Espinosa-Urgel, M.

 Previous Article  |  Next Article 

Journal of Bacteriology, January 2006, p. 37-44, Vol. 188, No. 1
0021-9193/06/$08.00+0     doi:10.1128/JB.188.1.37-44.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Characterization of the Pseudomonas putida Mobile Genetic Element ISPpu10: an Occupant of Repetitive Extragenic Palindromic Sequences

María Isabel Ramos-González,* María Jesús Campos, Juan Luis Ramos, and Manuel Espinosa-Urgel

Department of Plant Biochemistry and Molecular and Cellular Biology, Estación Experimental del Zaidín, CSIC, Profesor Albareda 1, Granada 18008, Spain

Received 18 August 2005/ Accepted 14 October 2005

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.


* Corresponding author. Mailing address: Department of Plant Biochemistry and Molecular and Cellular Biology, Estación Experimental del Zaidín, CSIC, Profesor Albareda 1, Granada 18008, Spain. Phone: (34) 958-181600. Fax: (34) 958-129600. E-mail: maribel.ramos{at}eez.csic.es.


Journal of Bacteriology, January 2006, p. 37-44, Vol. 188, No. 1
0021-9193/06/$08.00+0     doi:10.1128/JB.188.1.37-44.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Vu-Thien, H., Corbineau, G., Hormigos, K., Fauroux, B., Corvol, H., Clement, A., Vergnaud, G., Pourcel, C. (2007). Multiple-Locus Variable-Number Tandem-Repeat Analysis for Longitudinal Survey of Sources of Pseudomonas aeruginosa Infection in Cystic Fibrosis Patients. J. Clin. Microbiol. 45: 3175-3183 [Abstract] [Full Text]  
  • Prosseda, G., Latella, M. C., Casalino, M., Nicoletti, M., Michienzi, S., Colonna, B. (2006). Plasticity of the Pjunc Promoter of ISEc11, a New Insertion Sequence of the IS1111 Family. J. Bacteriol. 188: 4681-4689 [Abstract] [Full Text]