Previous Article | Next Article ![]()
J Bacteriol, January 1998, p. 143-151, Vol. 180, No. 1
Lilly Research Laboratories, A Division of
Eli Lilly and Company, Indianapolis, Indiana 46285
Received 30 July 1997/Accepted 20 October 1997
The daptomycin biosynthetic gene cluster of Streptomyces
roseosporus was analyzed by Tn5099 mutagenesis,
molecular cloning, partial DNA sequencing, and insertional mutagenesis
with cloned segments of DNA. The daptomycin biosynthetic gene cluster
spans at least 50 kb and is located about 400 to 500 kb from one end of
the ~7,100-kb linear chromosome. We identified two peptide synthetase
coding regions interrupted by a 10- to 20-kb region that may encode
other functions in lipopeptide biosynthesis.
Streptomyces roseosporus
NRRL 11379 produces A21978C, a complex of acidic lipopeptide
antibiotics (9). The cyclic depsi-peptide portion contains
13 amino acids linked by an ester bond between the carboxyl group of
kynurenine (Kyn) and the hydroxyl group of Thr. The A21978C factors
contain C10, C11, or C12 fatty
acids attached to the terminal amino group of Trp (9). The
fatty acid side chains are readily removed by incubation with
Actinoplanes utahensis (6), and the cyclic
peptide can be reacylated at the N terminus of Trp to produce fatty
acyl, aroyl, and extended peptide derivatives (8). The
n-decanoyl analog of A21978C, daptomycin or LY146032, is a
potent antibiotic active against gram-positive bacteria, including
methicillin-resistant Staphylococcus aureus,
methicillin-resistant Staphylococcus epidermidis,
vancomycin-resistant enterococci, and penicillin-resistant
Streptococcus pneumoniae (4). Daptomycin has a
novel mechanism of action, the inhibition of lipoteichoic acid
biosynthesis (4, 7).
Many linear and cyclic peptides are produced by actinomycetes, bacilli,
and fungi (14, 15, 35). The peptide assembly is generally
nonribosomal and requires very large multifunctional peptide
synthetases containing one or more subunits (15, 29, 30,
33-35). Each peptide synthetase enzyme or subunit is composed of
domains or modules dedicated to the processing of individual amino
acids. Domains contain sites for binding amino acids and ATP and enzyme
activities for amino acid adenylate formation, thioester formation,
transthiolation to phosphopantetheine, transpeptidation, and sometimes
other activities (15, 30, 33). The structural organization
and DNA sequence of the genes encoding several different peptide
synthetases have been determined (21, 33). The linear sequence of DNA modules encoding the functional domains in the peptide
synthetases generally corresponds to the linear sequence of amino acids
in the peptide. The average coding region for an individual module is
about 3.2 kb. Since the individual modules encode similar functions,
they contain regions of partial homology displayed as highly conserved
motifs (1, 21, 30, 33, 35).
We are interested in understanding the structural organization and
regulation of the daptomycin biosynthetic genes in S. roseosporus. Since daptomycin contains 13 amino acids, its coding
region should contain 13 segments containing conserved peptide
synthetase motifs, spanning about 42 kb or more. We have developed
methods to introduce DNA into S. roseosporus and have
identified mutants blocked in daptomycin production by
Tn5099 transposition mutagenesis (20). We report
here the localization of the daptomycin biosynthetic gene cluster by
Tn5099 transposition mutagenesis, cloning, insertional mutagenesis, physical mapping, and partial DNA sequence analysis. The
daptomycin biosynthetic genes map to a region about 400 to 500 kb from
one end of the linear chromosome of S. roseosporus.
Bacterial strains, plasmids, and transposons.
The bacterial
strains and plasmids used in this study are listed in Table
1.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Molecular Cloning and Physical Mapping of the
Daptomycin Gene Cluster from Streptomyces
roseosporus

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
TABLE 1.
Bacterial strains and plasmids
Media and growth conditions. The streptomycete strains were grown in TS broth and fragmented into individual colony-forming units by ultrasonic vibration as described previously (3). Fermentation and high-pressure liquid chromatography (HPLC) analysis of daptomycin production were carried out as described previously (20).
DNA techniques and plasmid constructions. DNA cloning procedures were carried out generally as described previously (24). Restriction endonucleases and other enzymes were used according to the recommendations of the manufacturers. Pulsed-field gel electrophoresis (PFGE) analysis of S. roseosporus DNA was carried out as described previously (20, 26) with a CHEF Mapper system (Bio-Rad Laboratories). Southern blot hybridizations were carried out as described previously (26) with Genius system (Boehringer Mannheim Biochemicals) nonradioactive labeling probes. The DNA sequence was determined with a Taq Dye Deoxy terminator cycle sequencing kit and a model 373A DNA sequencing system (Applied Biosystems). PCR amplification was performed with a Perkin-Elmer Gene Amp 9600 apparatus and standard conditions.
Plasmids were constructed with Escherichia coli XL1-Blue MRF', DH10B, or DH5
as follows. DNA from S. roseosporus
MM91 was cleaved with MluI, separated by gel
electrophoresis, and probed with Tn5099. An 11.5-kb fragment
that hybridized to Tn5099 was size selected, ligated with
MluI-cleaved pRHB146, and introduced into E. coli
XL1-Blue MRF', yielding pRHB152. DNA from S. roseosporus MM93 was cleaved with BglII, separated by gel
electrophoresis, and probed with Tn5099. A 10.4-kb fragment
that hybridized to Tn5099 was size selected, ligated with
BglII-cleaved pRHB146, and introduced into E. coli XL1-Blue MRF' by transformation to hygromycin resistance
(Hmr), yielding pRHB153. DNA from S. roseosporus
MM95 was cleaved with ApaI, separated by gel
electrophoresis, and probed with Tn5099. An 11.4-kb fragment
that hybridized to Tn5099 was size selected, ligated with
ApaI-cleaved pRHB146, and introduced into E. coli DH5
by transformation to Hmr, yielding pRHB157. DNA from
S. roseosporus MM94 was cleaved with MluI,
separated by gel electrophoresis, and probed with Tn5099. A
9.4-kb fragment that hybridized to Tn5099 was size selected, ligated with MluI-cleaved pRHB146, and introduced into
E. coli by transformation to Hmr, yielding
pRHB155. DNA from S. roseosporus MM92 was cleaved with MluI, separated by gel electrophoresis, and probed with
Tn5099. A 9.4-kb fragment that hybridized to
Tn5099 was size selected, ligated with
MluI-cleaved pRHB146, and introduced into E. coli by transformation to Hmr, yielding pRHB154. S. roseosporus inserts in pRHB153 and pRHB157 were purified and used
as probes to identify cosmids containing daptomycin biosynthetic genes.
Fragments of cosmids with large S. roseosporus DNA inserts
(12) were subcloned in pOJ260 in E. coli for
insertion mutagenesis as follows. Plasmid pRHB160 was cleaved with
EcoRV, and a 14-kb fragment was ligated with EcoRV-cleaved pOJ260, yielding pRHB166. Plasmid pRHB159 was
cleaved with EcoRI, and a 5.2-kb fragment was ligated with
EcoRI-cleaved pOJ260, yielding pRHB168. Plasmid pRHB161 was
cleaved with EcoRI, and a 2.3-kb fragment was ligated with
EcoRI-cleaved pOJ260, yielding pRHB169. Plasmid pRHB162 was
cleaved with EcoRI and ligated with EcoRI-cleaved
pOJ260, yielding pRHB170. Plasmid pRHB160 was cleaved with
EcoRI, and a 7.0-kb fragment was ligated with
EcoRI-cleaved pOJ260, yielding pRHB172. Plasmid pRHB161 was
cleaved with KpnI and ScaI, and a 4.5-kb
KpnI-ScaI fragment was ligated with pOJ260 cleaved with KpnI plus DraI, yielding pRHB173.
Plasmid pRHB161 was cleaved with ScaI, and a 10-kb fragment
was ligated with EcoRV-cleaved pOJ260, yielding pRHB174. DNA
from strain MM132 containing pRHB168 inserted into the chromosome was
digested with KpnI and self-ligated. Transformants were
selected for Amr, yielding pRHB613. DNA from strain MM135
containing pRHB172 inserted into the chromosome was digested with
KpnI and self-ligated. Transformants were selected for
Amr, yielding pRHB614. A 2.7-kb
KpnI-EcoRI fragment from pRHB614 was ligated to
pBluescript II KS
digested with KpnI and
EcoRI, yielding pRHB599. A 2.5-kb EcoRI fragment
from pRHB614 was ligated with pBluescript II KS
digested
with EcoRI, yielding pRHB602. A 0.5-kb EcoRI
fragment from pRHB614 was ligated to pBluescriptII KS
digested with EcoRI, yielding pRHB603. A 0.6-kb
SacI fragment from pRHB613 was ligated to pBluescriptII
KS
digested with SacI, yielding pRHB680. A
362-bp fragment containing an internal segment of S. roseosporus
masC was PCR amplified with primers PR182
(5'GGTGCGGCCCTTTGATGAAT3') and PR183
(5'CCACGACTGGCTGACCGAGA3') and ligated with pCRII to yield
pRHB678. A 0.36-kb EcoRI fragment from pRHB678 was ligated
to EcoRI-digested pKC1139 to yield pRHB588. All plasmid
constructions were confirmed by restriction analysis.
Transposition, transformation, electroporation, and conjugation. Transposition of Tn5099 (11) in S. roseosporus and conjugation of plasmid DNA from E. coli S17-1 to S. roseosporus were carried out as described previously (20). Plasmid DNA was introduced into E. coli strains by transformation (24) or electroporation (28).
Nucleotide sequence and data analysis. Derived amino acid sequences were analyzed with the Genetics Computer Group software package (version 8) (10). Amino acid sequence homology searches were performed by use of the BLAST server at the National Center for Biotechnology Information (Bethesda, Md.) and nonredundant protein sequence databases (2). Protein sequence databases PIR (release 35.0) and Swiss-Prot (release 24.0) were searched by use of the EMBL FASTA file server facility with default parameter values.
Nucleotide sequence accession numbers. The nucleotide sequences for cpsA and cpsB have been assigned GenBank accession no. AF021262 and AF021263, respectively.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Physical mapping of Tn5099 insertions. In a previous study (20), we identified five mutants that were induced by Tn5099 insertions and that produced little or no daptomycin. Since Tn5099 contains DraI and AseI (AsnI) sites, the DraI and AsnI fragments containing the transposon are split into two new fragments upon restriction endonuclease cleavage, and the distances of the DraI and AsnI sites from the ends of the fragments can be determined. Tn5099 insertions in S. roseosporus MM91 and MM92 mapped to the DraI-E fragment and to the AsnI-B fragment (Fig. 1). MM91 had a deletion of about 900 kb of DNA, including AsnI fragments I, J, K, O, P, and Q, and contained a new 50-kb fragment (O'), suggesting that the lack of daptomycin production in MM91 may have been due to deletion rather than to transposition. This suggestion is consistent with the results of the gene disruption experiment described below. MM92 was not completely blocked in daptomycin biosynthesis (20), so the insertion in this strain may have had a pleiotropic effect on daptomycin production.
|
|
Insertional mutagenesis and chromosome probing with DNA flanking Tn5099 insertions. To determine if the Tn5099 insertions in strains MM91 through MM95 were directly associated with the loss of daptomycin production, we cloned DNA flanking the insertions into pRHB146, a plasmid capable of conjugation from E. coli S17-1 to S. roseosporus but lacking replication functions for streptomycetes (Table 1). Thus, transconjugants can be formed only by insertion of plasmid DNA into the chromosome. DNA from each of the strains was cleaved with several different restriction endonucleases, and Southern hybridizations with a Tn5099 probe were carried out to identify fragments containing Tn5099 plus flanking DNA for subsequent insertional mutagenesis studies. Internal recombinational insertions into the peptide synthetase coding region(s) should disrupt daptomycin biosynthesis. Plasmids pRHB152, pRHB153, pRHB154, pRHB155, and pRHB157, containing S. roseosporus DNA flanking the Tn5099 insertions in strains MM91, MM92, MM93, MM94, and MM95, respectively, were introduced into S. roseosporus A21978.6 or A21978.65, and Hmr transconjugants were obtained. The transconjugants were grown under fermentation conditions, and daptomycin production was determined by HPLC analysis. Table 2 shows that recombinants containing plasmids pRHB152 and pRHB155 produced essentially control yields of daptomycin. Thus, the Tn5099 insertions in strains MM91 and MM94 probably did not cause the disruption of daptomycin biosynthesis by insertion into the peptide synthetase coding region. Recombinants containing plasmid pRHB154 produced a reduced amount of daptomycin (~50% that in the control), so the original Tn5099 insertion in MM92 was also not likely to be in a daptomycin peptide synthetase gene. However, recombinants harboring plasmid pRHB153 or pRHB157 produced no daptomycin. This result suggests that the Tn5099 insertions in strains MM93 and MM95 might be located in the peptide synthetase coding region.
|
Sequence sampling of DNA flanking Tn5099 insertions in
strains MM93 and MM95.
Since the insertions in MM93 and MM95
appeared to disrupt daptomycin biosynthesis and since the DNA flanking
the insertion in MM93 contained a sequence reiterated over a relatively
small region of the chromosome, we attempted to gain additional
information on the sites of insertion by DNA sequence sampling. DNA
from plasmid pRHB153 was cloned into pIF275 containing mini-
(36), and several random deletion clones were sequenced and
analyzed for open reading frames. The corresponding amino acid
sequences were compared to other sequences by BLAST analysis
(2). Plasmid pRHB153 contained an open reading frame that
encoded a predicted polypeptide that showed high sequence similarity to
motif C. The sequence SGSTGQPKG differed from the consensus motif C
sequence, SGTTGXPKG (33), in only one position, Ser for Thr.
This sequence has been proposed to participate in ATP and AMP binding
and is observed in virtually all peptide synthetase modules.
Cosmid cloning and physical mapping of daptomycin biosynthetic genes. Cosmids from a library of S. roseosporus DNA cloned in pKC1471 were combined in pools of 12 and screened by hybridization to a 2.1-kb SphI fragment isolated from pRHB153 and to a 5.2-kb DraI-KpnI fragment isolated from pRHB157. Individual cosmids from the hybridizing pools were identified by hybridization to the same probes.
Several methods were used to physically map the cosmids that hybridized to peptide synthetase sequences. These included comparison of restriction endonuclease cleavage patterns, hybridization of partial digests of cosmids to the pCK1471 vector sequences flanking the cosmid inserts, restriction endonuclease cleavage patterns of hybridization to the 5.2-kb DraI-KpnI peptide synthetase probe isolated from pRHB157, and chromosomal orientation of the two Tn5099 insertions in strains MM93 and MM95. These approaches were used to align cosmids pRHB159, pRHB161, and pRHB162 to each other and to one end of the S. roseosporus chromosome (Fig. 2). Attempts to link pRHB160 to the other three cosmids by finding a linking cosmid from the S. roseosporus library were unsuccessful. In an attempt to link pRHB160 to pRHB159, DNA adjacent to pRHB160 and pRHB159 was obtained by a recombinational cloning strategy with strains MM135 and MM133, which contained insertions of pRHB172 and pRHB168 into the chromosome (sections 2 and 3 in Fig. 2A), respectively. Since pRHB172 and pRHB168 each contain a KpnI site adjacent to the S. roseosporus DNA insert in the multiple cloning site, cleavage of DNA from MM135 and MM133 with KpnI should give fragments containing the complete plasmid pKC1471, the original S. roseosporus DNA insert, plus additional contiguous S. roseosporus DNA up to the next KpnI site in the chromosome. Therefore, depending on the orientation of the original inserts in pRHB172 and pRHB168, cleavage of DNA from strains MM135 and M133 and self-ligation should give plasmids either extending the linkage or containing segments internal to cosmids pRHB160 and pRHB159 (Fig. 2A). In both cases, the plasmids excised from the chromosome extended the linkage to an apparent linking KpnI site (Fig. 2A). Plasmid pRHB614 extended cosmid pRHB160 to the right about 5.8 kb, whereas plasmid pRHB613 extended cosmid pRHB159 about 9.0 kb to the left. We cannot rule out the possibility that a small KpnI fragment is located between the S. roseosporus DNAs cloned in pRHB614 and pRHB613. End sequence analysis of pRHB599, pRHB602, and pRHB603, which contained fragments derived from pRHB614, identified segments of DNA containing peptide synthetase genes. Thus, it is likely that most or all of the S. roseosporus DNA in pRHB614 encodes peptide synthetase (Fig. 2).Functional mapping of the daptomycin biosynthetic gene cluster in S. roseosporus. The physical map and DNA hybridization data of the four cosmids digested with various restriction enzymes and probed with the 5.2-kb DraI-KpnI fragment from pRHB157 were used to select fragments to be subcloned for gene disruption analysis. Restriction fragments (sections 1 to 7 in Fig. 2A) were cloned into pOJ260 and introduced into S. roseosporus A21978.6 by conjugation from E. coli S17-1. Transconjugants expressing Amr were tested for antibiotic production. A summary of the antibiotic production is shown in Fig. 2A. The gene disruption analysis indicated that sections 2, 4, and 5 probably contain insertions within the peptide synthetase coding regions. Sections 1, 6, and 7 may be outside the peptide synthetase coding regions. Interestingly, DNA inserted in section 3, which is internal to two apparent peptide synthetase coding regions, did not disrupt daptomycin biosynthesis. As shown below, this region of DNA encodes other functions.
DNA sequence analysis of two regions of the cyclic peptide gene cluster. A 7.9-kb EcoRI fragment containing module cspB (segment 2 in Fig. 2A) and a 5.3-kb ApaI fragment containing a Tn5099 insertion in cpsA in strain MM95 (Fig. 2) were subcloned and sequenced. Figure 3A shows the deduced amino acid sequences of CpsA and CpsB compared to those of other peptide synthetase domains. A high degree of homology was observed between CpsA and CpsB and other peptide synthetase domains, particularly within conserved core motifs B to G (or 1 to 5), associated with ATP binding and aminoacyl adenylation, and motif J (or section 6), associated with covalent linkage of 4'-phosphopantetheine to Ser (15, 29, 33).
|
| |
ACKNOWLEDGMENTS |
|---|
We thank S. Kuhstoss for plasmid pKC1471, L. Boeck, M. Favret, and J. Mynderse for fermentation and HPLC analysis, I. Jenkins for assistance with DNA sequencing, and J. Wiley for typing the manuscript.
We thank Lilly Research Laboratories for supporting the work. T. Hosted was a Lilly postdoctoral fellow.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: DowElanco, 9330 Zionsville Rd., Indianapolis, IN 46268. Phone: (317) 337-3128. Fax: (317) 337-3252. E-mail: rbaltz{at}dowelanco.com.
Present address: Schering-Plough Research Institute, Kenilworth, NJ
07033.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Aharonowitz, Y.,
J. Bergmeyer,
J. M. Cantoral,
G. Cohen,
A. L. Demain,
U. Fink,
J. Kinghorn,
H. Kleinkauf,
A. MacCabe,
H. Palissa,
E. Pfeifer,
T. Schwecke,
H. Van Liempt,
H. von Döhren,
S. Wolfe, and J. Zhang.
1992.
-(L- -Aminoadipyl)-L-cysteinyl-D-valine synthetase, the multienzyme integrating the four primary reactions in -lactam biosynthesis, as a model peptide synthetase.
Bio/Technology
11:807-810.
|
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment research tool. J. Mol. Biol. 215:403-410[Medline]. |
| 3. |
Baltz, R. H.
1978.
Genetic recombination in Streptomyces fradiae by protoplast fusion and cell regeneration.
J. Gen. Microbiol.
107:93-102 |
| 4. | Baltz, R. H. 1997. Lipopeptide antibiotics produced by Streptomyces roseosporus and Streptomyces fradiae, p. 415. In W. R. Strohl (ed.), Biotechnology of industrial antibiotics, 2nd ed. Marcel Dekker, Inc., New York, N.Y. |
| 5. | Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, and B. E. Schoner. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49[Medline]. |
| 6. | Boeck, L., D. S. Fukuda, B. J. Abbott, and M. Debono. 1988. Deacylation of A21978C, an acidic lipopeptide antibiotic complex, by Actinoplanes utahensis. J. Antibiot. 41:1085-1092[Medline]. |
| 7. | Canepari, P., and M. Boaretti. 1996. Lipoteichoic acid as a target for antimicrobial action. Microb. Drug Resist. 2:85-89. [Medline] |
| 8. | Debono, M., B. J. Abbott, R. M. Malloy, D. S. Fukuda, A. H. Hunt, V. M. Daupert, F. T. Counter, J. L. Ott, C. B. Carrell, L. C. Howard, L. D. Boeck, and R. L. Hamill. 1988. Enzymatic and chemical modifications of lipopeptide antibiotic A21978C: the synthesis and evaluation of daptomycin (LY146032). J. Antibiot. 41:1093-1105[Medline]. |
| 9. | Debono, M., M. Barnhart, C. B. Carrell, J. A. Hoffman, J. L. Occolowitz, B. J. Abbott, D. S. Fukuda, and R. L. Hamill. 1987. A21978C, a complex of new acidic peptide antibiotics: isolation, chemistry, and mass spectral structure elucidation. J. Antibiot. 40:761-777[Medline]. |
| 10. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 11. |
Hahn, D. R.,
P. J. Solenberg, and R. H. Baltz.
1991.
Tn5099, a xylE promoter probe transposon for Streptomyces spp.
J. Bacteriol.
173:5573-5577 |
| 12. |
Hosted, T. J., and R. H. Baltz.
1997.
Use of rpsL for dominance selection and gene replacement in Streptomyces roseosporus.
J. Bacteriol.
179:180-186 |
| 13. | Hosted, T. J., and R. H. Baltz. Unpublished data. |
| 14. |
Kleinkauf, H., and H. von Döhren.
1990.
Bioactive peptides recent advances and trends, p. 1-31. In
H. Kleinkauf, and H. von Dohren (ed.), Biochemistry of peptide antibiotics.
Walter de Gruyter & Co., New York, N.Y.
|
| 15. | Kleinkauf, H., and H. von Döhren. 1996. A ribosomal system of peptide biosynthesis. Eur. J. Biochem. 236:335-351[Medline]. |
| 16. | Kuhstoss, S. Unpublished data. |
| 17. | Leblond, P., G. Fischer, F.-X. Francon, F. Berger, M. Guerineau, and B. Decaris. 1996. The unstable region of Streptomyces ambofaciens includes 210 kb terminal inverted repeats flanking the extremities of the linear chromosomal DNA. Mol. Microbiol. 19:261-271[Medline]. |
| 18. |
Leblond, P.,
M. Redenbach, and J. Cullum.
1993.
Physical map of the Streptomyces lividans 66 genome and comparison with that of the related strain Streptomyces coelicolor A3(2).
J. Bacteriol.
175:3422-3429 |
| 19. | Lin, Y.-S., H. M. Kieser, D. A. Hopwood, and C. W. Chen. 1993. The chromosomal DNA of Streptomyces lividans 66 is linear. Mol. Microbiol. 10:923-933[Medline]. |
| 20. |
McHenney, M. A., and R. H. Baltz.
1996.
Gene transfer and transposition mutagenesis in Streptomyces roseosporus: mapping of insertions that influence daptomycin or pigment production.
Microbiology
142:2363-2373 |
| 21. | Pavela-Vrancic, M., H. Van Liempt, E. Pfeifer, W. Freist, and H. von Döhren. 1994. Nucleotide binding by multienzyme peptide synthetases. Eur. J. Biochem. 220:535-542[Medline]. |
| 22. | Redenbach, M., F. Flett, W. Piendl, I. Glocker, U. Rauland, O. Wafzig, R. Kliem, P. Leblond, and J. Cullum. 1993. The Streptomyces lividans 66 chromosome contains 1 MB deletogenic region flanked by amplifiable regions. Mol. Gen. Genet. 241:255-262[Medline]. |
| 23. | Redenbach, M., H. M. Kieser, D. Denapaite, A. Eichner, J. Cullum, H. Kinashi, and D. A. Hopwood. 1996. A set of ordered cosmids and a detailed genetic and physical map for the 8 mb Streptomyces coelicolor A3(2) chromosome. Mol. Microbiol. 21:77-96[Medline]. |
| 24. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. . Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 25. | Simon, R., U. Preifer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784-791. |
| 26. |
Solenberg, P. J., and R. H. Baltz.
1991.
Transposition of Tn5096 and other IS493 derivatives in Streptomyces griseofuscus.
J. Bacteriol.
173:1096-1104 |
| 27. | Solenberg, P. J., and R. H. Baltz. 1994. Hypertransposing derivatives of streptomycete insertion sequence IS493. Gene 147:47-54[Medline]. |
| 28. | Speyer, J. F. 1990. A simple and effective electroporation apparatus. BioTechniques 8:28-30. [Medline] |
| 29. | Stachelhaus, T., A. Huser, and M. A. Marahiel. 1996. Biochemical characterization of peptidyl carrier protein (PCP), the thiolation domain of multifunctional peptide synthetases. Chem. Biol. 3:913-921. [Medline] |
| 30. | Stachelhaus, T., and M. A. Marahiel. 1995. Modular structure of genes encoding multifunctional peptide synthetases required for non-ribosomal peptide synthesis. FEMS Microbiol. Lett. 125:3-14[Medline]. |
| 31. | Stachelhaus, T., A. Schneider, and M. A. Marahiel. 1995. Rational design of peptide antibiotics by targeted replacement of bacterial and fungal domains. Nature 269:69-72. |
| 32. | Stachelhaus, T., H. Schneider, and M. A. Marahiel. 1996. Engineered biosynthesis of peptide antibiotics. Biochem. Pharmacol. 52:177-186[Medline]. |
| 33. | Stein, T., and J. Vater. 1996. Amino acid activation and polymerization at modular multienzymes in nonribosomal peptide biosynthesis. Amino Acids 10:210-227. |
| 34. |
Stein, T.,
J. V. Vater,
A. Kruft,
B. Otto,
P. Wittman-Liebold,
M. Franke,
M. Panico,
R. McDowell, and H. R. Morris.
1996.
The multiple carrier model of nonribosomal peptide biosynthesis at modular multienzymatic templates.
J. Biol. Chem.
271:15428-15435 |
| 35. | Von Döhren, H., E. Pfeifer, H. van Liempt, Y.-O. Lee, M. Pavela-Vrancic, and T. Schwecke. 1993. The nonribosomal system: what we learn from the genes encoding protein templates, p. 159-167. In R. H. Baltz, G. D. Hegeman, and P. L. Skatrud (ed.), Industrial microorganisms: basic and applied molecular genetics. American Society for Microbiology, Washington, D.C. |
| 36. |
Wang, G.,
X. Xu,
J.-M. Chen,
D. E. Berg, and C. M. Berg.
1994.
Inversions and deletions generated by a mini-![]() (Tn1000) transposon.
J. Bacteriol.
176:1332-1338 |
| 37. | Wessels, P., H. von Döhren, and H. Kleinkauf. 1996. Biosynthesis of acyl peptidolactones of the daptomycin type. A comparative analysis of peptide synthetases forming A21978C and A54145. Eur. J. Biochem. 242:665-673[Medline]. |
| 38. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»