Previous Article | Next Article 
J Bacteriol, January 1998, p. 90-95, Vol. 180, No. 1
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Role of the Cold-Box Region in the 5' Untranslated
Region of the cspA mRNA in Its Transient Expression
at Low Temperature in Escherichia coli
Li
Fang,
Yan
Hou, and
Masayori
Inouye*
Department of Biochemistry, Robert Wood
Johnson Medical School, Piscataway, New Jersey 08854
Received 25 July 1997/Accepted 31 October 1997
 |
ABSTRACT |
Upon temperature downshift, a group of proteins called cold shock
proteins, such as CspA, CspB, and CsdA, are transiently induced in
Escherichia coli. However, when the 5' untranslated region
(5' UTR) of cspA mRNA is overproduced at low temperature, the expression of cold shock genes is prolonged or derepressed. It has
been proposed that this effect is due to highly conserved 11-base
sequences designated the "cold box" existing in the 5' UTRs of
cspA, cspB, and csdA. Here, we
demonstrate that the overproduction of the 5' UTR of not only
cspA but also cspB and csdA mRNAs
causes derepression of all three genes at the same time. Conversely, when the cold-box region was deleted from the cspA 5' UTR
its derepression function was abolished. The amount of mRNA from the chromosomal cspA gene was much higher in cells
overproducing the wild-type 5' UTR by means of a plasmid than it was in
cells overproducing the cold-box-deleted 5' UTR. The stability of the
chromosomal cspA mRNA in cells overproducing the wild-type
5' UTR was almost identical to that in cells overproducing the
cold-box-deleted 5' UTR. Therefore, the derepression of
cspA caused by overproduction of 5' UTR at the end of the
acclimation phase occurs at the level of transcription but not by mRNA
stabilization, indicating that the cold-box region plays a negative
role in cspA transcription in cold shock-adapted cells. The
role of the cold-box region was further confirmed with a
cspA mutant strain containing a cold-box-deleted cspA gene integrated into the chromosome, which showed a
high level of constitutive production of CspA but not CspB during
exponential growth at low temperature.
 |
INTRODUCTION |
When an exponentially growing
culture of Escherichia coli is shifted from 37 to 15°C,
there is usually a growth lag period, termed the acclimation phase,
before the cells resume growth. A number of cold shock proteins are
transiently induced during this phase (13). In addition to
CspA, a major cold shock protein in E. coli (7),
CspB (16), CspG (19), CsdA (14), and RbfA (15) have been shown to be cold inducible. CspA
consists of 70 amino acid residues (7), and its
three-dimensional structure, which is composed of five antiparallel
strands forming a
-barrel structure, has been determined by both
X-ray crystallography (23) and nuclear magnetic resonance
(20). Two RNA-binding motifs have been identified on
2
and
3 strands. CspA has been shown to function as an RNA chaperone
at low temperature (10).
It has been demonstrated that parallel to the cold shock induction of
CspA protein, the cspA transcript was highly induced upon
temperature downshift, suggesting that cspA induction at low
temperature may be regulated at the level of transcription (24). However, recently it has been found that the
cspA transcript was substantially stabilized upon
temperature downshift, and this stabilization plays a major role in the
cold shock induction of cspA (2, 4, 6). Three
base substitutions near the Shine-Dalgarno sequence caused a 150-fold
enhancement of cspA mRNA stability, resulting in
constitutive expression of cspA at 37°C, indicating that
the cspA promoter is also active at high temperature
(4). To what extent the cspA induction at low
temperature is regulated at the level of transcription remains to be
elucidated. In addition to regulation at the levels of transcription
and mRNA stability, cspA expression at low temperature is
also controlled at the level of translation, with the downstream box in
the cspA coding sequence (18).
Also, it has been shown that overproduction of the 143-base sequence
from base +1 to base +143 of the 159-base 5' untranslated region (5'
UTR) of the cspA mRNA upon cold shock resulted in prolonged synthesis of not only CspA but also CspB and CsdA (9). All the mRNAs for these proteins contain unusually long 5' UTRs (159, 161, and 226 bases for cspA, cspB, and
csdA, respectively), and within each of these 5' UTRs there
is a highly conserved 11-base motif called the "cold box," which
has been proposed to be a repressor binding site. In this report we
demonstrate that overproduction of the 5' UTRs of both cspB
and csdA mRNAs can also cause the prolonged synthesis of
CspA, CspB, and CsdA or simultaneous derepression of cspA,
cspB, and csdA expression at the end of the
acclimation phase. Deletion of the cold-box region abolished the
derepression function of the 5' UTR of cspA mRNA.
Furthermore, the amount and stability of mRNA from the chromosomal
cspA gene were examined by primer extension experiments to
demonstrate that the derepression occurs at the level of transcription.
The results provide further evidence to support the proposal that a
putative repressor binds to the cold-box regions in the mRNAs for cold
shock genes, which in turn blocks or attenuates the transcription of
these genes (6).
 |
MATERIALS AND METHODS |
Strains and culture media.
E. coli CL83 [recA
ara (lac-proAB) rpsL(=strA)
80
lacZ M15] (17) was used for all experiments and
was grown in M9-Casamino Acid medium as described previously
(8). For pulse-labeling experiments, an amino acid mixture
lacking methionine was used. The final concentration of each amino acid
was 50 µg/ml.
Plasmid construction.
p6mTEK and p2JTEK were constructed as
previously described (9).
The plasmid plmcsdA was constructed as follows. Primer 6724 (5'
TTGGTACCTCCTGGGCCAGGACC 3') and primer 6725 (5'
TCGAATTCGTAGTACGTGTGCCT 3') were used for PCR with a plasmid DNA
containing wild-type csdA as the template. The PCR product
was then digested with EcoRI and KpnI and ligated
into p6mT digested with EcoRI and KpnI. The resulting plasmid, plmcsdA, contained the 5' UTR of the csdA
mRNA under the cspA promoter, followed by the
cspA transcription terminator sequence.
The plasmid p

24T was constructed by two-step PCR. For the first PCR,
PCRI was produced with primer 3552 (5' GACAGGATTAAAAATCGATG
3')
and primer 6727 (5' CCTTACTACACTGCTCGTTGATGTGTGCATTA 3')
and
PCRII was produced with primer 6726 (5' AGCAGTGTAGTAAGG
3') and
primer 3550 (5' TAATTAAGTGTGCCTTTCGG 3').
pJJG02 was used as the
template in both PCRs. The second PCR was
carried out with primers
3552 and 3550, using PCRI and PCRII as the
templates. The final
PCR product was then ligated into the
SmaI site of pUC9. The
cspA transcription
terminator sequence was PCR amplified with primers
6290 (5'
CGGAATTCAGCCTGTAATCTCT 3') and 4860 (5'
CTGTCGACTTACTTACGGCGTTGC
3'). The PCR product was then digested
with
EcoRI and ligated
into the plasmid described above,
which was digested with
EcoRI
and
SspI. This
plasmid contained the 5' UTR of
cspA mRNA from
base +1 to
base +143, with a 22-base deletion from base +3 to
base +24 under the
cspA promoter. The DNA sequence of all the
PCR products was
confirmed by DNA sequencing (
21).
The plasmid pKY701
cspA(

CB) was constructed as follows.
For the first PCR, PCRI was produced with primer 3552 and primer 6727
(see above) and PCRII was produced with primer 6726 and primer
4860 (see above), using pJJG02 as the template for both PCRs.
The second PCR
was carried out with primers 3552 and 4860, using
PCRI and PCRII as the
templates. The final PCR product was then
ligated into the
EcoRV site of a TA vector (Invitrogen Corp.).
After the DNA
sequence was confirmed, the 776-bp
HindIII-
SmaI
fragment from the plasmid
containing the cold-box-deleted
cspA gene
[
cspA(

CB)] was inserted into pKY701 digested with
HindIII-
SmaI.
pKY701 (
26) is a
plasmid which contains a temperature-sensitive
replication origin
[
ori(Ts)] as well as the
lpp-28 gene as the
plasmid integration site. The resulting plasmid was designated
pKY701
cspA(

CB).
Pulse-labeling experiments.
The pulse-labeling experiments
were carried out as described previously (8). Proteins were
analyzed by sodium dodecyl sulfate (SDS)-17.5% polyacrylamide gel
electrophoresis (8). Two-dimensional gel electrophoresis was
carried out as previously described (12).
Primer extension experiments.
E. coli CL83 harboring
different plasmids was grown to mid-log phase at 37°C and then
shifted to 15°C for 3 h. Total RNA was extracted by the
hot-phenol method (22). Primer extension experiments were
carried out with avian myeloblastosis virus reverse transcriptase (Boehringer) according to the method of Gafny et al. (5).
The following two primers were used: primer 3551 (5'
TTTAGAGCCATCGTCAGGAG 3'), complementary to the sequence from base
+243 to base +224, and primer 4592 (5' GTGCACTACGAGGGGTATCA 3'),
complementary to the sequence from base +82 to base +63.
mRNA stability.
E. coli CL83 harboring different
plasmids was grown to mid-log phase at 37°C and then shifted to
15°C. After 3 h of incubation at 15°C, rifampin was added to a
final concentration of 200 µg/ml. At 0, 5, 10, 20, and 30 min after
the addition of rifampin, 1.5 ml of the culture was taken for RNA
extraction by the hot-phenol method (22). Primer extension
experiments were carried out with primer 3551.
Chromosomal integration of cold-box-deleted cspA.
Plasmid pKY701cspA(
CB), which contains a
temperature-sensitive replication origin [ori(Ts)], was
introduced into strain WB002, a
cspA strain
(4), and plated out at 42°C. From a colony formed at
42°C a single colony was reisolated at 42°C. Using the chromosomal DNA from this isolate, we confirmed the integration of the plasmid into
the WB002 chromosome by PCR. The resulting strain was designated WB003.
 |
RESULTS |
Effects of overproduction of 5' UTRs of cspA,
cspB, and csdA mRNAs.
First, we attempted
to test the effect of overproduction of the 5' UTR of the
cspB mRNA as well as that of the csdA mRNA on the
expression of cold shock genes at the end of the acclimation phase. In
order to overproduce the 5' UTR of the cspB mRNA, pB-LacZ, in which the cspB gene was fused with the lacZ
gene in frame at the 13th codon (3), was used. Note that the
plasmid was a derivative of pBR322, whose copy number is considered to
be approximately 30 to 50 per cell, and that this copy number was
adequate to exert the derepression effect on cold shock genes
(9). As a positive control, pA-LacZ, in which the
cspA gene was fused with the lacZ gene in frame
at the 13th codon (3), was used. E. coli CL83 cells transformed with these plasmids were used for pulse-labeling experiments as shown in Fig. 1. Cells
were labeled for 15 min at 15°C 0, 1, and 3 h after cold shock.
Cells transformed with the vector pRS414 were used as another control
for the pulse-labeling experiments. CspA expression reached the maximum
level 1 h after cold shock (Fig. 1A, lane 2) and dropped to a new
basal level 3 h after cold shock (Fig. 1A, lane 3) in the cells
carrying the vector pRS414 alone. In contrast to the control cells, in
cells carrying pA-LacZ, high levels of production of CspA, CspB, and CspG (all of which migrated at the same position [see below]), as
well as CsdA (at 70 kDa), were still maintained at 3 h (Fig. 1A,
lane 6), confirming the previous results of Jiang et al.
(9). With the cells carrying pB-LacZ, the same expression
patterns of CspA, CspB, CspG, and CsdA were observed (Fig. 1A, lanes 7, 8, and 9), as with the cells carrying pA-LacZ (Fig. 1A, lanes 4, 5, and
6). Since CspA, CspB, and CspG migrate at the same position in
SDS-polyacrylamide gel electrophoresis, the samples with pA-LacZ and
pB-LacZ were also analyzed by two-dimensional gel electrophoresis. All
three proteins, CspA, CspB, and CspG, were still produced 3 h
after temperature downshift for both cells with pA-LacZ (Fig. 1B) and
cells with pB-LacZ (Fig. 1C), indicating that not only cspA
but also cspB and cspG were derepressed when the
5' UTR of cspA or cspB was overproduced. These
results demonstrate that overproduction of the 5' UTR of not only the
cspA mRNA but also the cspB mRNA causes the
prolonged expression or derepression of cspA,
cspB, cspG, and csdA at the end of the
acclimation phase. In these experiments, it is interesting to point out
that as cold shock gene expression at 3 h after cold shock is
derepressed, the synthesis of other cellular proteins is not fully
recovered to the level of control cells (compare Fig. 1A, lanes 6 and 9 for cells carrying pA-LacZ and pB-LacZ, respectively, with lane 3 for
the control cells), suggesting that overproduction of not only the
cspA 5' UTR, as shown previously (9), but also
the cspB 5' UTR causes a negative effect on the expression
of non-cold shock genes.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Effects of overproduction of the 5' UTRs of
cspA and cspB mRNAs. Pulse-labeling experiments
were carried out as described in Materials and Methods. (A) Cultures of
cells harboring different plasmids (pRS414, pA-LacZ, and pB-LacZ) were
shifted from 37 to 15°C at mid-log phase (80 Klett units). The time
point (CS time, time after cold shock) of pulse-labeling is shown above
each lane. The same amount of the culture (0.15 ml) was analyzed at
each time point by SDS-17.5% polyacrylamide gel electrophoresis. The
labeling times at 37 and 15°C were 5 and 15 min, respectively. The
positions of CspA, CsdA, and -galactosidase ( -gal) are indicated
by arrows. Lanes 1 to 3, CL83 cells harboring the vector only; lanes 4 to 6, CL83 cells harboring pA-LacZ; lanes 7 to 9, CL83 cells harboring
pB-LacZ. Molecular mass (in kilodaltons) is shown on the left. (B)
Cells with pA-LacZ 3 h after cold shock (panel A, lane 6) were
analyzed by two-dimensional gel electrophoresis. Only a portion of the
autoradiogram is shown. Positions of CspA, CspB, and CspG are indicated
by arrows. (C) Cells with pB-LacZ 3 h after cold shock (panel A,
lane 9) were analyzed as described for panel B.
|
|
Next we examined the effect of overproduction of the 5' UTR of the
csdA mRNA on the expression of cold shock genes at low
temperature. For this purpose, the 226-bp DNA sequence corresponding
to
the 5' UTR of
csdA (from base +1 to base +226, with the
transcription
start site defined as +1) (
25) was placed
under the control
of the
cspA promoter. At the 3' end, the
cspA transcription terminator
sequence was also added to
secure transcription termination. The
resulting plasmid, designated
plmcsdA, was introduced into CL83
cells, and pulse-labeling experiments
were then carried out with
the transformed cells. As shown in Fig.
2, overproduction of the
5' UTR of
csdA mRNA also caused derepression of
cspA (and
cspB and
cspG) as well as
csdA. A high
level of production of CspA
and CsdA (Fig.
2, lane 3) was observed
3 h after cold shock with
concomitant reduction of the synthesis
of non-cold shock proteins,
as observed with pA-LacZ and pB-LacZ,
indicating that overproduction
of the 5' UTR of
csdA mRNA is
capable of causing the same effect
as overproduction of those of
cspA and
cspB mRNAs.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of overproduction of the 5' UTR of
csdA mRNA. Cultures of cells harboring the indicated
plasmids were shifted from 37 to 15°C at mid-log phase (80 Klett
units) and incubated at 15°C for 3 h. Cells were then labeled
with [35S]methionine for 15 min as described in Materials
and Methods. The same amount of the culture (0.15 ml) was used for each
labeling experiment and analyzed by SDS-17.5% polyacrylamide gel
electrophoresis. Lane 1, CL83 cells harboring the vector pUC19; lane 2, CL83 cells harboring pUC19-600 for overproduction of the 5' UTR of
cspA mRNA; lane 3, CL83 cells harboring plmcsdA for
overproduction of the 5' UTR of csdA mRNA. Positions of CspA
and CsdA are indicated by arrows. Molecular mass markers (in
kilodaltons) are shown on the left.
|
|
The level of derepression of
cspA and
csdA 3 h after cold shock was much higher in cells carrying plmcsdA (Fig.
2)
than in
cells carrying pA-LacZ and pB-LacZ (Fig.
1), while the
synthesis
of non-cold shock proteins was more severely inhibited
(compare
Fig.
2, lane 3 to Fig.
1A, lanes 6 and 9). This is likely due
to the fact that the vector used for plmcsdA was pUC9, while pA-LacZ
and pB-LacZ were pBR322 derivatives.
Effects of the deletion of the cold-box region.
The
derepression of cold shock genes caused by overproduction of the 5'
UTRs of cspA, cspB, and csdA mRNAs at
the end of the acclimation phase is considered to be due to a highly
conserved sequence consisting of 11 bases (the cold box)
(9). The cold-box consensus sequence is UGACGUACAGA,
and there is only one base mismatch between cspA and
csdA and two base mismatches between cspA and
cspB in this region. The cold box is considered to be responsible for the derepression effect of the 5' UTRs of
cspA, cspB, and csdA mRNAs. We next
tested the effects of overproduction of mRNAs with and without the
cold-box region on the expression of cold shock genes. For this
purpose, p
24T was constructed, which overproduces a 5' UTR of the
cspA mRNA encompassing the region from base +1 to base +143
but containing a deletion of the cold-box region from base +3 to base
+24. CL83 cells were transformed with the plasmid, and pulse-labeling
experiments were carried out. Cells were labeled for 15 min 3 h
after cold shock. Experiments were also carried out with cells
transformed with p6mTEK, which overproduces only the first 6-base
sequence of the cspA mRNA, and p2JTEK, which overproduces
the first 25-base sequence of the cspA mRNA, including the
cold box. As shown in Fig. 3, lanes 1 and
3, both p6mTEK and p
24T lost the derepression function while p2JTEK
was still capable of derepressing cold shock gene expression (Fig. 3,
lane 2), indicating that the cold-box region is responsible for the
derepression effect.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of deletion of the cold-box region.
Pulse-labeling experiments were carried out as described in Materials
and Methods. Cells harboring p6mTEK, p2JTEK, and p 24T were shifted
from 37 to 15°C at mid-log phase (80 Klett units) and then labeled
with [35S]methionine for 15 min 3 h after cold
shock. The plasmids were used to overproduce cspA mRNA as
follows: p6mTEK from bases +1 to +6, p2JTEK from bases +1 to +25, and
p 24T from bases +1 to +143 with a deletion of the cold-box region
from +3 to +24. Protein expression patterns were analyzed by
SDS-17.5% polyacrylamide gel electrophoresis. Lane 1, CL83 cells
harboring p6mTEK; lane 2, CL83 cells harboring p2JTEK; lane 3, CL83
cells harboring p 24T. The positions of CspA and CsdA are indicated
by arrows. Molecular mass markers (in kilodaltons) are shown on the
left.
|
|
Derepression is caused at the level of transcription.
cspA expression is normally repressed to a new basal level
after 3 h of incubation at 15°C, while overproduction of the 5' UTR of cspA mRNA results in failure of the repression of
cspA, causing a high level of CspA production 3 h after
cold shock (9). In order to elucidate whether this high
level of cspA expression is caused at the level of
transcription or of mRNA stabilization, we next attempted to determine
the amount of cspA mRNA in cells 3 h after cold shock.
For this purpose, CL83 cells were transformed with p
24T and
pUC19-600 (9), which contains the 5' UTR from base +1 to
base +143 of cspA mRNA under the control of the
cspA promoter. Total RNA was extracted from the cells after
3 h of incubation at 15°C and used for primer extension
experiments with the following two primers. The first primer (4592) was
complementary to the sequence from base +82 to base +63 of
cspA mRNA, which is capable of detecting the transcripts
from both the plasmid and the chromosome. The second primer (3551) was
complementary to the sequence from base +243 to base +224,
corresponding to a region in the coding sequence of cspA.
Thus, this primer detects transcripts only from the chromosomal
cspA gene. As shown in Fig. 4,
lane 4, primer 4592 detected a large amount of transcript from p
24T
while the amount of transcript from the chromosomal cspA gene detected by primer 3551 (Fig. 4, lane 3) was very small, corresponding to the low production of CspA in the cells harboring p
24T after 3 h at 15°C (Fig. 3, lane 3). In contrast, the
amount of transcript from the chromosomal cspA gene in the
cells harboring pUC19-600 (Fig. 4, lane 1), as detected by primer 3551, was much greater than that in the cells harboring p
24T (Fig. 4, lane
3). Note that a large amount of the transcript from pUC19-600 was also
produced, as detected by primer 4592 (Fig. 4, lane 2). This amount was
comparable to the amount of cspA transcript from p
24T (Fig. 4, compare lane 2 to lane 4; the difference in mobility is due to
the 22-base deletion [from base +3 to base +24] of the cspA mRNA in the transcript from p
24T). This result was
again consistent with the high production of CspA in the cells
harboring pUC19-600 3 h after cold shock (Fig. 2, lane 2).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of cspA transcripts in cells
overproducing the 5' UTR of cspA mRNA (from bases +1 to
+143) with and without the cold-box region from bases +3 to +24. Total
RNA was isolated from CL83 cells carrying pUC19-600 (control; lanes 1 and 2) and p 24T (cold-box deletion; lanes 3 and 4) after 3 h of
incubation at 15°C. Primer extension experiments were carried out as
described in Materials and Methods. Two primers were used in order to
detect the cspA transcript from the chromosomal
cspA gene (primer 3551; lanes 1 and 3) and the transcripts
from both plasmids and the chromosome (primer 4592; lanes 2 and 4). The
products of primer extension were separated by 7 M urea-6% acrylamide
gel electrophoresis. The positions of the products of the different
primers are indicated by arrows. CS: 3 hr, 3 h after cold shock.
|
|
The above results demonstrate that the amount of
cspA mRNA
from the chromosomal
cspA gene increased in the cells
overproducing
the intact 5' UTR of
cspA mRNA 3 h after
cold shock. Therefore,
we next examined whether this was caused at the
level of transcription
or by stabilization of the
cspA mRNA.
For this purpose,
E. coli CL83 cells harboring pUC19-600 and
p

24T were tested for the stability
of the mRNA from the chromosomal
cspA gene. Cells grown to mid-log
phase at 37°C were
shifted to 15°C for 3 h. Total RNA was extracted
at different
time points (0, 5, 10, 20, and 30 min) after the
addition of rifampin
(200 µg/ml). CL83 cells were used as a control.
Primer extension
experiments were carried out with primer 3551.
The amount of
cspA mRNA was quantitated by phosphorimager analysis
and
plotted as shown in Fig.
5. The half-life
of the chromosomal
cspA mRNA from CL83 cells was calculated
to be 5.6 min, while
the half-lives of the chromosomal
cspA
mRNAs from cells carrying
pUC19-600 and p

24T were 14.9 and 15.2 min,
respectively, indicating
that the cold-box deletion did not affect
chromosomal
cspA mRNA
stability. The overproduced 5' UTR
from both pUC19-600 and p

24T
apparently protected the chromosomal
cspA mRNA from degradation,
stabilizing it approximately
threefold. Derepression of the chromosomal
cspA caused by
overproduction of the 5' UTR of the
cspA mRNA thus
occurs at
the level of transcription and not at the level of mRNA
stability.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Stability of chromosomal cspA transcript in
cells overproducing cspA 5' UTR. CL83 cells harboring
pUC19-600 for the 5' UTR of the wild-type cspA gene and
p 24T for the cold-box-deleted 5' UTR of cspA were grown
to mid-log phase and then shifted to 15°C for 3 h. Rifampin (200 µg/ml) was added to the culture, and RNA was extracted at 0, 5, 10, 20, and 30 min after the addition of rifampin. Primer extension was
carried out, and the densities of products were analyzed by a
phosphorimager and plotted. The amounts of transcripts at the 0 time
point were taken as 100.
|
|
Effects of the deletion of the cold box from the chromosomal
cspA gene.
The results described above indicate that
the cold-box region is required for the repression of cspA
at the level of transcription after the acclimation phase. Since these
experiments were carried out with multicopy plasmids, we next tested
the cspA expression of cells containing a single copy of the
cspA gene with a 22-base deletion at the cold-box region on
the chromosome. For this purpose, the cspA gene with a
deletion from base +3 to base +24 in the 5' UTR was inserted at the
lpp-28 gene of strain WB002(
cspA). The
resulting strain, WB003(
CB), produced very little, if any, CspA at
37°C, as shown in Fig. 6A. CspA
production was highly induced at 30 min after temperature downshift
from 37 to 15°C (Fig. 6B). In the parent cells (JC7623), CspA
production was significantly reduced at 7 h and was reduced to a
very low basal level at 32 h after temperature downshift. In
contrast, a high level of CspA production in WB003 cells was maintained
not only at 7 but also at 32 h after cold shock (Fig. 6B),
demonstrating that the cold-box region from base +3 to base +24 has a
negative effect on cspA expression at low temperature.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 6.
Constitutive high expression of cspA at
15°C resulted from the deletion of the cold-box region from the
chromosomal cspA gene. Strain WB003 ( CB), containing the
cspA gene with a 22-base deletion from bases +3 to +24 in
the 5' UTR, and its parent strain (wild type), JC7623, were used for
labeling cellular proteins. Labeling was carried out at 0.5, 7, and
32 h after a temperature downshift from 37 to 15°C, as
previously described (8), and labeled proteins were analyzed
by two-dimensional gel electrophoresis. The entire gel is shown only
for strain WB003 at 37°C (A). Cell cultures were diluted before they
reached the stationary phase, and only the lower parts are shown for
0.5-, 7-, and 32-h time points at 15°C. The positions of CspA are
indicated by arrowheads.
|
|
 |
DISCUSSION |
Similar to heat shock response, E. coli cells respond
to temperature downshift by inducing a specific group of genes, called cold shock genes. Cell growth normally ceases during the first 2 h
after temperature downshift from 37 to 15°C, and this period is
called the acclimation phase. Interestingly, the synthesis of most
cellular proteins is blocked during this phase, except for that of cold
shock proteins. Clearly, there is a mechanism for the cold shock
proteins to bypass the blockage of general protein synthesis during the
acclimation phase. Some of the cold shock proteins synthesized during
this phase are ribosome associated and are considered to convert
nonfunctional ribosomes to functional ribosomes at low temperature
(11, 15).
The synthesis of the cold shock proteins during the acclimation phase
is transient. At the end of the acclimation phase, cells regain the
ability to grow, and cold shock protein synthesis is reduced to a new
basal level (7). Unlike the heat shock response, no specific
transcription factors for cold shock gene induction, such as sigma
factors, have been identified. Instead, mRNA stability has been shown
to play a major role in the induction of cspA (2, 4,
6). We have also unambiguously demonstrated that although the
cspA gene is constitutively transcribed at 37°C,
cspA mRNA is designed to be extremely unstable at 37°C
(4). Upon cold shock, cspA mRNA is immediately
stabilized to be ready for protein synthesis, which is consistent with
the fact that CspA is instantly produced after temperature downshift
(7). Thus, cspA induction at low temperature does
not require its own specific transcription factor. The cspA
promoter is very effective at low temperature (4), and as
the transcription of cspA continues at low temperature, the
amount of cspA mRNA increases, resulting in higher
production of CspA. However, in the middle of the acclimation phase,
both CspA protein and cspA mRNA production reach their
highest levels. After that point, the production gradually drops and is
reduced to a low base level at the end of the acclimation phase. It
seems evident that there is a mechanism for the repression of
cspA during the latter half of the acclimation phase.
Here we demonstrate that overexpression of not only the 5' UTR of
cspA mRNA (9), but also the 5' UTR of
cspB, and csdA mRNAs, causes the derepression of
all of the cold shock genes. Highly conserved regions consisting of 11 bases were identified within the 5' UTRs of cspA,
cspB, and csdA and designated the cold box
(9).
We demonstrated that the deletion of the 22-base cold-box region from
the cspA 5' UTR abolished the derepression effect of the 5'
UTR while the overproduction of an mRNA containing the cold-box region
was capable of derepression of cspA (Fig. 3). The
derepression of the chromosomal cspA gene was detected not only at the level of CspA production but also at the level of mRNA
(Fig. 4). Since the stability of the chromosomal mRNA did not change
whether the overproduced 5' UTR contained the cold-box region or not,
the derepression caused by the 5' UTR containing the cold box occurs at
the level of transcription. Since the overproduction of the
cspA cold-box region causes the derepression of not only cspA but also cspB, cspG, and
csdA, all of which contain the cold box, it is reasonable to
speculate that the cold-box region functions as the binding site of a
repressor, as proposed previously (9). The binding of the
repressor to the cold box on mRNAs is likely to block transcription.
The proposed function of the cold box is further confirmed by the fact
that deletion of the cold-box region from cspA on the chromosome also caused derepression of cspA expression,
resulting in high constitutive expression of cspA in cells
exponentially growing at 15°C. As expected, the effect of the
deletion works only in cis, without affecting other cold
shock genes, such as cspB and cspG (Fig. 6B). It
should be noted that in addition to cspA regulation at the
level of transcription, reduction of cspA expression after
the acclimation phase is partially caused by mRNA destabilization, as
shown previously (6). The half-lives of cspA
mRNAs in CL83 cells changed from 17 min at 30 min after cold shock to
7.5 min at 1.5 h (data not shown) and 5.6 min at 3 h after
cold shock (Fig. 5). What is responsible for the stability changes of
cspA mRNA after cold shock and how ribonucleases, such as
RNase E, RNase K, RNase II, RNase III, and PNPase (1) are involved in the regulation of cold shock gene expression remain to be
determined.
 |
ACKNOWLEDGMENTS |
We thank Kunitoshi Yamanaka and Weonhye Bae for their critical
reading of the manuscript.
The present work was supported by a grant from the National Institutes
of Health (GM19043).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Robert Wood Johnson Medical School, Piscataway, NJ 08854. Phone: (732) 235-4115. Fax: (732) 235-4559. E-mail:
inouye{at}rwja.umdnj.edu.
 |
REFERENCES |
| 1.
|
Belasco, J. G.
1993.
mRNA degradation in prokaryotic cells: an overview, p. 3-11. In
J. G. Belasco, and G. Brewermann (ed.), Control of mRNA stability.
Academic Press, New York, N.Y.
|
| 2.
|
Brandi, A.,
P. Pietroni,
C. O. Gualerzi, and C. L. Pon.
1996.
Post-transcriptional regulation of CspA expression in Escherichia coli.
Mol. Microbiol.
19:231-240[Medline].
|
| 3.
|
Etchegaray, J. P.,
P. G. Jones, and M. Inouye.
1996.
Differential thermoregulation of two highly homologous cold-shock genes, cspA and cspB of Escherichia coli.
Genes Cells
1:171-178.
[Abstract] |
| 4.
|
Fang, L.,
W. Jiang,
W. Bae, and M. Inouye.
1997.
Promoter independent cold-shock induction of cspA and its derepression at 37°C by mRNA stabilization.
Mol. Microbiol.
19:241-248.
|
| 5.
|
Gafny, R.,
H. C. Hyman,
S. Razin, and G. Glaser.
1988.
Promoter of Mycoplasma capricolum ribosomal RNA operons: identical activities but different regulation in homologous and heterologous cells.
Nucleic Acids Res.
16:61-76[Abstract/Free Full Text].
|
| 6.
|
Goldenberg, D.,
I. Azar, and A. B. Oppenhelm.
1996.
Differential mRNA stability of the cspA gene in the cold shock response of Escherichia coli.
Mol. Microbiol.
19:241-248[Medline].
|
| 7.
|
Goldstein, J.,
N. S. Pollitt, and M. Inouye.
1990.
Major cold shock protein of Escherichia coli.
Proc. Natl. Acad. Sci. USA
87:283-287[Abstract/Free Full Text].
|
| 8.
|
Jiang, W.,
P. Jones, and M. Inouye.
1993.
Chloramphenicol induces the transcription of the major cold shock gene of Escherichia coli, cspA.
J. Bacteriol.
175:5824-5828[Abstract/Free Full Text].
|
| 9.
|
Jiang, W.,
L. Fang, and M. Inouye.
1996.
The role of the 5'-end untranslated region of the mRNA for CspA, the major cold-shock protein of Escherichia coli, in cold-shock adaptation.
J. Bacteriol.
178:4919-4925[Abstract/Free Full Text].
|
| 10.
|
Jiang, W.,
Y. Hou, and M. Inouye.
1997.
CspA, the major cold-shock protein of Escherichia coli, is an RNA chaperone.
J. Biol. Chem.
272:196-202[Abstract/Free Full Text].
|
| 11.
|
Jiang, W.,
L. Fang, and M. Inouye.
1996.
Complete growth inhibition of Escherichia coli by ribosome trapping with truncated cspA mRNA at low temperature.
Genes Cells
1:965-976.
[Abstract] |
| 12.
|
Jones, P. G.,
R. A. VanBogelen, and F. C. Neidhardt.
1987.
Induction of proteins in response to low temperature in Escherichia coli.
J. Bacteriol.
169:2092-2095[Abstract/Free Full Text].
|
| 13.
|
Jones, P. G., and M. Inouye.
1994.
The cold-shock response a hot topic.
Mol. Microbiol.
11:811-818[Medline].
|
| 14.
|
Jones, P. G.,
M. Mitta,
Y. Kim,
W. Jiang, and M. Inouye.
1996.
Cold shock induces a new major ribosomal-associate protein which unwinds double-stranded RNA in Escherichia coli.
Proc. Natl. Acad. Sci. USA
93:76-80[Abstract/Free Full Text].
|
| 15.
|
Jones, P. G., and M. Inouye.
1996.
RbfA, a 30S-ribosomal binding factor, is a cold-shock protein whose absence triggers the cold-shock response.
Mol. Microbiol.
21:1209-1218.
|
| 16.
|
Lee, S. J.,
A. Xie,
W. Jiang,
J. P. Etchegaray,
P. G. Jones, and M. Inouye.
1994.
Family of the major cold-shock protein, CspA (CS7.4) of Escherichia coli, whose members show a high sequence similarity with the eukaryotic Y-box binding proteins.
Mol. Microbiol.
11:833-839[Medline].
|
| 17.
|
Lerner, C. G., and M. Inouye.
1990.
Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability.
Nucleic Acids Res.
18:4631[Free Full Text].
|
| 18.
|
Mitta, M.,
L. Fang, and M. Inouye.
1997.
Deletion analysis of cspA of Escherichia coli: requirement of the AT-rich UP element for cspA transcription, and the downstream box in the coding region for its cold-shock adaptation.
Mol. Microbiol.
26:321-335[Medline].
|
| 19.
|
Nakashima, K.,
K. Kanamarnu,
T. Mizuno, and K. Horikoshi.
1996.
A novel member of the cspA family of genes that is induced by cold shock in Escherichia coli.
J. Bacteriol.
178:2994-2997[Abstract/Free Full Text].
|
| 20.
|
Newkirk, K.,
W. Feng,
W. Jiang,
R. Tejero,
S. D. Emerson,
M. Inouye, and G. Montelione.
1994.
Solution NMR structure of the major cold-shock protein (CspA) from Escherichia coli: identification of a binding epitope for single-stranded DNA.
Proc. Natl. Acad. Sci. USA
91:5114-5118[Abstract/Free Full Text].
|
| 21.
|
Sanger, F.,
S. Nicklen, and A. R. Coulsen.
1977.
DNA sequencing with chain-termination inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 22.
|
Sarmientos, P.,
J. E. Sylvester,
S. Contente, and M. Cashel.
1983.
Differential stringent control of the tandem E. coli ribosomal RNA promoters from the rrnA operon expressed in vivo in multicopy plasmids.
Cell
32:1337-1346[Medline].
|
| 23.
|
Schindelin, H.,
W. Jiang,
M. Inouye, and U. Heinemann.
1994.
Crystal structure of the major cold-shock protein of Escherichia coli.
Proc. Natl. Acad. Sci. USA
91:5119-5123[Abstract/Free Full Text].
|
| 24.
|
Tanabe, H.,
J. Goldstein,
M. Yang, and M. Inouye.
1992.
Identification of the promoter region of the Escherichia coli major cold shock gene, cspA.
J. Bacteriol.
174:3867-3873[Abstract/Free Full Text].
|
| 25.
|
Toone, W. M.,
K. E. Rudd, and J. D. Friesen.
1991.
deaD, a new Escherichia coli gene encoding a presumed ATP-dependent RNA helicase, can suppress a mutation in rpsB, the gene encoding ribosomal protein S2.
J. Bacteriol.
173:3291-3302[Abstract/Free Full Text].
|
| 26.
|
Yamaguchi, K., and M. Inouye.
1988.
Lipoprotein-28, an inner membrane protein of Escherichia coli encoded by nlpA, is not essential for growth.
J. Bacteriol.
170:3747-3749[Abstract/Free Full Text].
|
J Bacteriol, January 1998, p. 90-95, Vol. 180, No. 1
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Singh, A. K., Pindi, P. K., Dube, S., Sundareswaran, V. R., Shivaji, S.
(2009). Importance of trmE for Growth of the Psychrophile Pseudomonas syringae at Low Temperatures. Appl. Environ. Microbiol.
75: 4419-4426
[Abstract]
[Full Text]
-
Zeeb, M., Max, K. E.A., Weininger, U., Low, C., Sticht, H., Balbach, J.
(2006). Recognition of T-rich single-stranded DNA by the cold shock protein Bs-CspB in solution. Nucleic Acids Res
34: 4561-4571
[Abstract]
[Full Text]
-
Bresolin, G., Neuhaus, K., Scherer, S., Fuchs, T. M.
(2006). Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth.. J. Bacteriol.
188: 2945-2958
[Abstract]
[Full Text]
-
Derzelle, S., Hallet, B., Ferain, T., Delcour, J., Hols, P.
(2002). Cold Shock Induction of the cspL Gene in Lactobacillus plantarum Involves Transcriptional Regulation. J. Bacteriol.
184: 5518-5523
[Abstract]
[Full Text]
-
Xia, B., Ke, H., Jiang, W., Inouye, M.
(2002). The Cold Box Stem-loop Proximal to the 5'-End of the Escherichia coli cspA Gene Stabilizes Its mRNA at Low Temperature. J. Biol. Chem.
277: 6005-6011
[Abstract]
[Full Text]
-
Janiyani, K. L., Ray, M. K.
(2002). Cloning, Sequencing, and Expression of the Cold-Inducible hutU Gene from the Antarctic Psychrotrophic Bacterium Pseudomonas syringae. Appl. Environ. Microbiol.
68: 1-10
[Abstract]
[Full Text]
-
Kim, B. H., Bang, I. S., Lee, S. Y., Hong, S. K., Bang, S. H., Lee, I. S., Park, Y. K.
(2001). Expression of cspH, Encoding the Cold Shock Protein in Salmonella enterica Serovar Typhimurium UK-1. J. Bacteriol.
183: 5580-5588
[Abstract]
[Full Text]
-
Yamanaka, K., Inouye, M.
(2001). Selective mRNA Degradation by Polynucleotide Phosphorylase in Cold Shock Adaptation in Escherichia coli. J. Bacteriol.
183: 2808-2816
[Abstract]
[Full Text]
-
Derzelle, S., Hallet, B., Francis, K. P., Ferain, T., Delcour, J., Hols, P.
(2000). Changes in cspL, cspP, and cspC mRNA Abundance as a Function of Cold Shock and Growth Phase in Lactobacillus plantarum. J. Bacteriol.
182: 5105-5113
[Abstract]
[Full Text]
-
Chamot, D., Owttrim, G. W.
(2000). Regulation of Cold Shock-Induced RNA Helicase Gene Expression in the Cyanobacterium Anabaena sp. Strain PCC 7120. J. Bacteriol.
182: 1251-1256
[Abstract]
[Full Text]
-
Lortie, L.-A., Pelletier, M., Vadeboncoeur, C., Frenette, M.
(2000). The gene encoding IIABLMan in Streptococcus salivarius is part of a tetracistronic operon encoding a phosphoenolpyruvate:mannose/glucose phosphotransferase system. Microbiology
146: 677-685
[Abstract]
[Full Text]
-
O'Connell, K. P., Thomashow, M. F.
(2000). Transcriptional Organization and Regulation of a Polycistronic Cold Shock Operon in Sinorhizobium meliloti RM1021 Encoding Homologs of the Escherichia coli Major Cold Shock Gene cspA and Ribosomal Protein Gene rpsU. Appl. Environ. Microbiol.
66: 392-400
[Abstract]
[Full Text]
-
Lopez, M. M., Yutani, K., Makhatadze, G. I.
(1999). Interactions of the Major Cold Shock Protein of Bacillus subtilis CspB with Single-stranded DNA Templates of Different Base Composition. J. Biol. Chem.
274: 33601-33608
[Abstract]
[Full Text]
-
Sahara, T., Suzuki, M., Tsuruha, J.-I., Takada, Y., Fukunaga, N.
(1999). cis-Acting Elements Responsible for Low-Temperature-Inducible Expression of the Gene Coding for the Thermolabile Isocitrate Dehydrogenase Isozyme of a Psychrophilic Bacterium, Vibrio sp. Strain ABE-1. J. Bacteriol.
181: 2602-2611
[Abstract]
[Full Text]
-
Wang, N., Yamanaka, K., Inouye, M.
(1999). CspI, the Ninth Member of the CspA Family of Escherichia coli, Is Induced upon Cold Shock. J. Bacteriol.
181: 1603-1609
[Abstract]
[Full Text]
-
Berlyn, M. K. B.
(1998). Linkage Map of Escherichia coli K-12, Edition 10: The Traditional Map. Microbiol. Mol. Biol. Rev.
62: 814-984
[Abstract]
[Full Text]
-
Uhlmann-Schiffler, H., Rossler, O. G., Stahl, H.
(2002). The mRNA of DEAD Box Protein p72 Is Alternatively Translated into an 82-kDa RNA Helicase. J. Biol. Chem.
277: 1066-1075
[Abstract]
[Full Text]