Previous Article | Next Article ![]()
J Bacteriol, May 1998, p. 2644-2651, Vol. 180, No. 10
Department of
Microbiology1 and
Department of
Biochemistry,2 University of Illinois,
Urbana, Illinois 61801
Received 20 November 1997/Accepted 13 March 1998
Many gram-negative bacteria synthesize N-acyl
homoserine lactone autoinducer molecules as quorum-sensing signals
which act as cell density-dependent regulators of gene expression. We
have investigated the in vivo source of the acyl chain and homoserine lactone components of the autoinducer synthesized by the LuxI homolog, TraI. In Escherichia coli, synthesis of
N-(3-oxooctanoyl)homoserine lactone by TraI was unaffected
in a fadD mutant blocked in In recent years, it has become
evident that a large number of gram-negative bacteria regulate various
physiological processes in a cell density-dependent manner by
synthesizing N-acyl homoserine lactones (N-acyl
HSLs), referred to as autoinducers (AIs). These quorum-sensing
molecules are thought to freely diffuse across the cell membrane
accumulating in the growth medium and in the cell (at an equivalent
concentration), as the cell density increases (31). When the
intracellular AI concentration becomes high enough, the AI acts as a
gene regulator by complexing with its cognate transcriptional regulator
protein (reviewed in references 20 and
43). The list of processes regulated in this way
includes luminescence in Vibrio fischeri (15) and
Vibrio harveyi (9), Ti plasmid conjugal transfer
in Agrobacterium tumefaciens (63), swarming in
Serratia liquefaciens (17), synthesis of
poly-3-hydroxybutyrate in V. harveyi (53), and
the expression of virulence determinants in a variety of plant and
animal pathogens (reviewed in references 20 and
43). The model system for understanding
N-acyl HSL-regulated processes is the induction of
luminescence in V. fischeri. In this system, expression of
the lux operon is induced in response to the transcriptional
activator LuxR binding to its cognate Lux box DNA sequence when
complexed with an N-acyl HSL AI
[N-(3-oxohexanoyl)HSL] synthesized by the enzyme LuxI
(20).
With the exception of the AinS enzyme of V. fischeri
(22) and the LuxLM system of V. harveyi
(4), all identified N-acyl HSL AI synthases are
LuxI homologs. Expression of luxI and homologous genes from
a variety of species has been shown to be necessary and sufficient to
direct the synthesis of the N-acyl HSL AI(s) in the parent
organisms or in Escherichia coli (LuxI
[18], LasI [41], TraI
[30], EsaI [6], YenI
[56], etc.). This implies that the substrates for
N-acyl HSL synthesis by the LuxI family of enzymes are
intermediates of metabolic pathways common to (at least) gram-negative
bacteria.
To date, while in vitro studies have suggested that the substrates for
AI synthesis are S-adenosylmethionine (AdoMet) and acyl-acyl
carrier proteins (acyl-ACPs), these results have yet to be fully
confirmed in vivo. Eberhard et al. (16) found that crude
extracts of V. fischeri provided with AdoMet and
N-(3-oxohexanoyl) coenzyme A (CoA) were able to generate
N-(3-oxohexanoyl)HSL, the primary AI made by this species
(15). No evidence of AI synthesis was found when
N-(3-oxohexanoyl)-CoA was replaced by malonyl-CoA, acetyl-CoA, citrate, and NADPH. These findings suggested that the acyl chains of N-acyl HSLs are obtained as the CoA
intermediates of the fatty acid Subsequently, using purified recombinant LuxI and TraI (homolog from
A. tumefaciens) we (46) and others
(38), respectively, have shown that N-acyl HSL
AIs are synthesized in vitro from AdoMet and their corresponding
acyl-ACPs, rather than from CoAs. This implies that in vivo the acyl
chains of N-acyl HSLs synthesized by LuxI-type synthases are
derived from intermediates in the fatty acid biosynthesis pathway,
rather than from While it could be argued that the above-mentioned in vitro studies
provide sufficient evidence that the acyl chains in AIs are derived
from acyl-ACPs, it should be noted that the Vmax
values of the purified LuxI and TraI enzymes used in these studies were very low (approximately 1 mol of AI synthesized/mol of enzyme/min). This may be due to either the inherently low activity of these enzymes
(38), a reduction in activity resulting from the presence of
the N-terminal purification tags (46), or inherent
instability, resulting in a large proportion of the affinity-purified
enzymes being inactive (46). Alternatively, the low
Vmax raises the possibility that other reactions
may occur in vivo.
Regarding the source of the HSL ring in AIs, in vitro studies with
crude extracts of V. fischeri (16) or purified
LuxI (46) or TraI (38) have all found that AI
synthesis is dependent on the presence of AdoMet, rather than any of
the intermediates of the threonine-methionine biosynthesis pathway that
are structurally related to HSL. Furthermore, using amino acid-starved
E. coli mutants blocked at various steps in the
threonine-methionine biosynthesis pathway and carrying the
luxI gene on a multicopy plasmid, Hanzelka and Greenberg
(26) found that methionine or AdoMet is required for AI
synthesis by LuxI. They also found that cycloleucine, a compound known
to inhibit the methionine adenosyltransferase reaction (12,
34), produced a significant reduction in AI synthesis, leading to
the conclusion that the HSL ring of AI was probably derived from
AdoMet. However, there appear to be other effects of cycloleucine on
E. coli metabolism, since the branched-chain amino acids
valine and isoleucine and also leucine have been found to overcome
growth inhibition of E. coli by cycloleucine (3).
In this study, we investigated the role of the fatty acid synthesis and
degradation pathways in supplying acyl chains for AI synthesis in vivo.
We used specific inhibitors of fatty acid biosynthesis and E. coli mutants blocked in the Materials and general methods.
Common antibiotics,
cerulenin, nalidixic acid, S-adenosylhomocysteine, AdoMet,
and isopropyl-
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
In Vivo Evidence that S-Adenosylmethionine and Fatty
Acid Synthesis Intermediates Are the Substrates for the LuxI Family
of Autoinducer Synthases
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-oxidative fatty acid
degradation. Also, conditions known to induce the fad regulon did not increase autoinducer synthesis. In contrast, cerulenin and diazoborine, specific inhibitors of fatty acid synthesis, both
blocked autoinducer synthesis even in a strain dependent on
-oxidative fatty acid degradation for growth. These data provide the
first in vivo evidence that the acyl chains in autoinducers synthesized
by LuxI-family synthases are derived from acyl-acyl carrier protein
substrates rather than acyl coenzyme A substrates. Also, we
show that decreased levels of intracellular
S-adenosylmethionine caused by expression of bacteriophage
T3 S-adenosylmethionine hydrolase result in a marked
reduction in autoinducer synthesis, thus providing direct in vivo
evidence that the homoserine lactone ring of LuxI-family autoinducers
is derived from S-adenosylmethionine.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-oxidation pathway.
-oxidation. Consistent with this possibility,
Moré et al. (38) found that a dialyzed E. coli extract supplied with His-tagged TraI regained the ability to
synthesize the Agrobacterium AI (AAI) lost as a result of
dialysis when the extract was supplied with malonyl-CoA and NADPH or
NADH and had reduced AI synthesis activity (50%) when treated with the
fatty acid synthesis inhibitor cerulenin. The findings of Eberhard et
al. (16) would then be assumed to be due to an enzymatic activity in the V. fischeri extract which converted the
added acyl-CoA into an acyl-ACP. This type of acyl transfer reaction is
known to occur in E. coli and is catalyzed by the enzyme
3-ketoacyl-ACP synthase I (1). In fact, these workers
offered this as a possible explanation of their results. However, it is
unclear why the V. fischeri extracts (16),
unlike the E. coli extracts (38), were unable to
produce detectable AI when provided with AdoMet, malonyl-CoA, and
NADPH.
-oxidation pathway to demonstrate
that, in vivo, the acyl chain of N-(3-oxooctanoyl)HSL synthesized by TraI is supplied entirely by the fatty acid biosynthesis pathway. In addition, we provide further in vivo evidence that the HSL
ring is derived from AdoMet by showing that decreases in the AdoMet
pool caused by expression of the bacteriophage T3 AdoMet hydrolase gene
(which specifically degrades AdoMet [23]) resulted in
a significant reduction in the synthesis of
N-(3-oxooctanoyl)HSL by TraI.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-D-thiogalactopyranoside (IPTG) were
obtained from Sigma. Ammonium hydroxide, formic acid, ethyl ether, and
various other miscellaneous chemicals were obtained from Fisher. Bacto
Tryptone, yeast extract, and agar were obtained from Difco. Ethyl
acetate was obtained from Mallinckrodt Chemical, trichloroacetic acid
was obtained from Aldrich,
S-[methyl-3H]adenosyl-L-methionine
was obtained from DuPont, and diazoborine was a kind gift from
Friederike Turnowsky, University of Graz, Graz, Austria, while
N-[3-oxooctanoyl]HSL was a kind gift of S. K. Farrand, Department of Microbiology, University of Illinois. Oligonucleotides used were T3SAM5P, 5'
AACATGAGGCATATGCTCATGATTTTCACTAAAG 3', and T3SAM3P, 5'
CATCGTGCGGATCCTTGAGTTTAAC 3'.
Bacterial strains, plasmids, media, and culture conditions. The main bacterial strains and plasmids used in this study are listed in Table 1. Strain constructions with P1vir transductional crosses were carried out by conventional methods (14). The E. coli strains were grown at the specified temperature in either rich broth (RB; 1% Bacto Tryptone, 0.1% yeast extract, 0.5% NaCl), supplemented with 0.1% oleate where required, or minimal salts medium E (14) supplemented for the various auxotrophies as specified in the work of Davis et al. (14). The A. tumefaciens bioassay reporter strain NT1(pDC141E33) was grown in AB minimal mannitol liquid medium (5) supplemented with kanamycin (100 µg/ml) and carbenicillin (100 µg/ml) at 30°C. For maintenance of plasmids, the media for E. coli strains were supplemented with ampicillin (100 µg/ml), chloramphenicol (20 µg/ml), and spectinomycin (100 µg/ml).
|
Plasmid constructions. A dilute stock of bacteriophage T3 (gift of Ian J. Molineux, University of Texas, Austin) was used as a template for PCR amplification of the T3 AdoMet hydrolase gene with the 5' T3SAM5P and 3' T3SAM3P primers. The T3SAM5P primer introduced a 5' BspHI site overlapping the initiating ATG, and T3SAM3P introduced a BamHI site downstream of the TAA termination codon. The 503-bp BspHI/BamHI-digested PCR fragment containing the entire coding sequence was cloned into the NcoI and BamHI sites of pET16b (Novagen) behind the T7 promoter (pETT3S). pT3SLE8 was obtained by cloning the entire T7 promoter-terminator-T3 AdoMet hydrolase region of pETT3S as a 1.1-kb BspHI fragment into the BspHI site within the tetracycline resistance gene of pLysE (51). The control plasmid pPCBLE1 was similarly obtained from pLysE by using the corresponding 1.6-kb BspHI fragment of a pET16b derivative plasmid (pc104), containing a 980-bp insert encoding the C-terminal 104-amino-acid biotin domain of the yeast PYC1 gene (58) in the NcoI and BamHI sites in place of the T3 AdoMet hydrolase gene.
AI extraction from growth media.
Samples used to determine
the level of AI present in the growth medium were prepared by
extraction of cell-free medium with an equal volume of ethyl acetate.
The ethyl acetate was then evaporated under nitrogen, and the residue
was dissolved in 0.1 volume of Milli-Q water and stored at
20 or
80°C.
Quantitation of the AI concentration in the growth medium.
Duplicate or triplicate 1-µl aliquots of the samples were spotted at
sites spaced across the entire area of a 20-by-20-cm silica gel
reversed-phase thin-layer chromatography (TLC) plate (UNIPLATE;
Analtech) such that the TLC plate was used as a sample adsorption
surface matrix rather than as a chromatography plate. A bioassay was
then performed by overlaying the TLC plate with molten agar containing
5-bromo-4-chloro-3-indolyl-
-D-galactoside and the
A. tumefaciens indicator strain NT1(pDC141E33) as previously described (47). A dilution series of five or six AAI
standards from 20 to 0.078 pg were also spotted onto each plate. These
standards were used to construct a standard curve by plotting the
measured diameter of the blue spots against the log10 of
the AAI concentration, and the AAI concentrations in the samples were
calculated from the average diameters of the sample spots.
Preparation of cell extracts for intracellular AdoMet
determinations.
Cell extracts were prepared essentially as
described by Satishchandran et al. (45). Cells were
harvested by centrifugation from 5 to 15 ml of the appropriate culture
of known optical density, immediately resuspended in 200 µl, lysed by
the addition of trichloroacetic acid to 10%, and stored at
80°C.
Immediately prior to high-performance liquid chromatography analysis,
the samples were thawed, 20 µl of [3H-methyl]-AdoMet
(approximately 1,600 cpm) was added as an internal standard, and the
trichloroacetic acid was removed by three extractions with an equal
volume of water-saturated ether.
Determination of the intracellular AdoMet concentration. Intracellular AdoMet levels were determined by a modification of the method of Satishchandran et al. (45). Isocratic ion-exchange high-performance liquid chromatography was performed with UV detection at 254 nm with a Waters analytical 4.6-by-250-mm Sherisorb 5S SCX column attached to a Beckman System Gold 125 solvent system, a 168 UV detector, and a 171 radioisotope detector. The elution buffer was prepared as a fourfold-concentrated solution containing 33.5 ml of concentrated NH4OH per liter, adjusted to pH 4.0 with formic acid. With a flow rate of 1.5 ml/min, AdoMet eluted as a well-resolved peak at 9.1 min, easily distinguished from S-adenosylhomocysteine and 5'-methylthioadenosine, which eluted at 3.5 and 5.3 min, respectively. AdoMet concentrations were calculated from the integrated peak areas of duplicate samples, by using a standard curve constructed with duplicate standards of S-adenosylhomocysteine at seven different concentrations such that the standards contained amounts ranging from 0.3125 to 20 nmol.
| |
RESULTS |
|---|
|
|
|---|
Mutants defective in fatty acid degradation are not blocked in AAI synthesis. The fatty acid degradation pathway in E. coli is dependent upon the conversion of the fatty acids into acyl-CoA thioesters by the action of the fadD gene product. Consequently, fadD mutants are blocked in fatty acid degradation (32, 40). Therefore, if the acyl chains of N-acyl HSL AI molecules were derived in vivo from acyl-CoAs, an E. coli fadD strain containing the IPTG-inducible traI gene on pSEP1 should be unable to synthesize AIs.
To investigate this prediction, a fadD null mutation (fadD88 zea::Tn10) was transduced into an otherwise wild-type strain (JM83) carrying a plasmid with the traI gene under lac control (pSEP1) and a lacIq plasmid (pMS421) to ensure repression of the lac promoter in the absence of IPTG. The amount of AAI present in the medium after various periods of induction with IPTG was determined for this strain (JMD6-TI) and compared with that for the parental strain carrying the same plasmids (JM83-TI) (Fig. 1). There was no significant difference in the amounts of AAI present in the medium from the fadD mutant strain and in that from the wild-type parental strain, indicating that AI synthesis does not require
-oxidation. We have
also found that addition of oleic acid (Fig. 1) or disruption of the
fadR gene (data not shown), both of which result in
induction of the
-oxidation pathway (32, 48, 49, 60),
failed to increase AI synthesis.
|
AI synthesis is blocked by specific inhibitors of fatty acid
synthesis.
We have tested two specific inhibitors of fatty acid
synthesis, diazoborine and cerulenin, for their effects on AAI
synthesis (Fig. 2). In the presence of
either diazoborine or cerulenin, there was no detectable AAI present in
the cultures after either 1 or 3 h of TraI expression. Diazoborine
inhibits fatty acid synthesis (25) by blocking the active
site of the FabI enzyme (the NADH-dependent enoyl-ACP reductase)
(7, 57), whereas cerulenin is a specific and irreversible
inhibitor of the
-ketoacyl-ACP synthases I and II (fabB
and fabF gene products, respectively) (13, 59).
In contrast, when strain JM83-TI was treated with an inhibitor of metabolic processes other than fatty acid synthesis (nalidixic acid, a
DNA gyrase inhibitor [21, 52]) as a control, after 3 h of induction with IPTG high concentrations of AAI (>500
pg/ml) were detected in the growth medium. However, this AAI
concentration was less than that detected in the untreated culture. The
cause of this lower AAI synthesis is not known, but one possibility is
that it may be an indirect consequence of a reduced ATP pool, resulting
from the constant active efflux of nalidixic acid by the AcrAB efflux
pump (39).
|
-oxidation pathway for
growth to produce acetyl-CoA from oleic acid, the cells must have
contained acyl-CoAs. Hence, this result shows that, even when acyl-CoAs
were present in vivo, inhibition of fatty acid synthesis rendered the
cells unable to synthesize N-acyl HSLs.
|
Reduction in the intracellular AdoMet pool size by T3 AdoMet hydrolase expression results in decreased AI synthesis. The approach we used to investigate the effect of the AdoMet pool size on AI synthesis was to assay AAI synthesis in strains expressing TraI from the pSEP1 plasmid in the presence of an enzyme that specifically degrades AdoMet (T3 AdoMet hydrolase [EC 3.3.1.2] [23]). We tested two different AdoMet expression constructs in the course of this work.
The T7 expression plasmid pETT3S was found to be toxic to strain BL21(DE3) even in the presence of a LacI-overexpressing plasmid (pMS421 [24]), presumably due to the background expression being sufficient to severely reduce intracellular AdoMet pools. The toxicity was not relieved by the introduction of the pLysS plasmid (which reduces T7 polymerase activity by expressing T7 lyzozyme [51]) but was significantly reduced by the presence of the pLysE plasmid (which provides a higher level of T7 lyzozyme expression [51]). To enable the T7 promoter-T3 AdoMet hydrolase and T7 lysozyme (pLysE) functions to be stably maintained in the presence of pSEP1 and pMS421 (to shut down the expression of TraI from the lac promoter of pSEP1), we constructed a composite plasmid (pT3SLE8) combining both functions on the pLysE plasmid by cloning the entire T7 promoter-T3 AdoMet hydrolase region of pETT3S as a 1.1-kb BspHI fragment into the BspHI site in the tetracycline resistance gene of pLysE. As a negative control for the effects resulting from expression of the T3 AdoMet hydrolase gene from the T7 promoter, a plasmid analogous to pT3SLE8 (pPCBLE1) was constructed to express a protein of similar size unrelated to AdoMet metabolism (the yeast PYC1 C-terminal 104-amino-acid biotin domain peptide [58]). When pT3SLE8 was transformed into strain C41(DE3) [a mutant of BL21(DE3) selected for its ability to maintain and express toxic proteins (36)], the resultant strain (C41T3-TI) grew a little slower than the parental strain but did not exhibit the plasmid instability of pETT3S in BL21(DE3). The control plasmid pPCBLE1 did not noticeably slow the growth of strain C41. To determine the effect of these plasmids on AAI production, pSEP1, pMS421, and pT3SLE8 (strain C41T3-TI) or pPCBLE1 (strain C41PC-TI) were cotransformed into C41(DE3). IPTG was added to induce the expression of TraI from the lac promoter of pSEP1 and T7 polymerase expression and, thus, either T3 AdoMet hydrolase expression (strain C41T3-TI) or YPC1 biotin domain expression (strain C41PC-TI). The intracellular AdoMet and extracellular AAI concentrations were then determined at various time points before and after IPTG addition so as to determine the effect of changes in the AdoMet pools on AAI synthesis (Fig. 4). As strain C41PC-TI has a shorter doubling time than C41T3-TI, this strain was induced at a lower optical density than C41T3-TI cultures a and b so that any increased accumulation of AAI observed in this culture relative to that in the C41T3-TI cultures could not be attributed to its higher optical density.
|
|
15 liters (61), after 1 h of T3
AdoMet hydrolase expression the intracellular AdoMet concentrations in
strain C41T3-TI a and b were calculated to be 76 and 50 µM,
respectively. Similarly, in strain LEPT3-TI after 2 h of T3
AdoMet hydrolase expression the intracellular AdoMet
concentration was calculated to be 9.1 µM. These concentrations are
consistent with AdoMet being limiting for AAI synthesis if we assume
that the Km of native TraI for AdoMet in vivo is
approximately 48 µM, the figure determined for His-tagged TraI in
vitro (38).
Mutations in the threonine-methionine pathway that block homoserine synthesis do not decrease AI synthesis. As homoserine is present in the cell as an intermediate of the threonine-methionine biosynthesis pathway, we investigated the possibility that either homoserine, homoserine phosphate, or O-succinyl homoserine from this pathway is the source of the HSL ring for N-acyl HSL synthesis in vivo. We assayed the AAI production in rich medium for mutant E. coli strains lacking activity in either aspartate kinase (strain GT164 [55]), aspartate semialdehyde dehydrogenase (strain CGSC 5081 [27] and strain G6MD3), homoserine dehydrogenase (strain CGSC 5075 [54]), homoserine kinase (strain CGSC 5076 [54]), or homoserine succinyltransferase (strains AB1932 and CGSC 6481). The bioassays indicated that there were no significant differences between the amounts of AAI produced by these strains upon IPTG induction of TraI expression and those produced by strains not blocked in this pathway (data not shown).
| |
DISCUSSION |
|---|
|
|
|---|
All the known AIs produced by gram-negative bacteria as density-dependent gene regulators can be classified structurally as N-acyl HSLs. As the name suggests, these molecules have two structural components, an HSL ring and an acyl group. In this study, we have investigated the source of these two components in vivo.
The most likely metabolic pathways which could supply the various acyl
groups found in N-acyl HSL AIs are the fatty acid synthesis pathway and/or the
-oxidative fatty acid degradation pathway. In
E. coli, fatty acid synthesis can be considered to be
essentially a housekeeping function, although the fabA gene
and thus synthesis of unsaturated fatty acids are subject to repression
in the presence of long-chain fatty acids (28). In contrast,
the
-oxidative fatty acid degradation (fad) pathway is
expressed only in the presence of long-chain (>C12) fatty
acids in the medium (8, 32, 40).
To determine whether the
-oxidation pathway contributes to
N-acyl HSL synthesis, we investigated the effect of a
fadD null mutation on AAI synthesis by the A. tumefaciens TraI enzyme in E. coli. Long-chain fatty
acids are transported into E. coli by the combined actions
of the fadL and fadD gene products. FadD catalyzes the conversion of the incoming fatty acids to their CoA
thioesters, thus activating the acids for the other enzymes of the
-oxidation pathway (32). Furthermore, both in vitro and
in vivo evidence have shown that FadD is the only E. coli acyl-CoA synthase (8, 32, 33, 40). Consequently,
fadD mutants are unable to generate the necessary CoA
thioesters required for
-oxidation and are thus totally blocked in
fatty acid degradation. We found that the amount of AAI synthesized by
E. coli was not affected by the fadD mutation
(Fig. 1). From these data, we conclude that the acyl chains of AAI are
not supplied by the
-oxidative fatty acid degradation pathway in
vivo. In contrast, inhibition of fatty acid synthesis by either
diazoborine or cerulenin (7, 25, 57) even in a strain
dependent on
-oxidation for growth blocked synthesis of AAI. This
agrees with the partial inhibition of AAI synthesis by cerulenin
observed in vitro by Moré et al. (38). Furthermore,
this cessation of AAI synthesis that we observed was due to the
inhibition of fatty acid synthesis per se rather than to some other
process affected by the inhibition of cell growth, as evident from the
AAI synthesis observed during growth inhibition by nalidixic acid.
These data provide the first in vivo evidence indicating that the acyl
group in N-acyl HSL AIs produced by the LuxI-type family of
enzymes is derived from acyl-ACP thioesters generated in the course of
fatty acid synthesis rather than from CoA thioesters generated by
-oxidation. This conclusion agrees with our previous in vitro
findings with a purified maltose binding protein-LuxI fusion
protein (46) and with those of Moré et al.
(38) with His-tagged TraI. Both of these enzymes were able
to synthesize their N-acyl HSL products in the presence of
the appropriate acyl-ACP, but not if the acyl-ACP was replaced by the
corresponding acyl-CoA.
Cao and Meighen had previously shown that cerulenin caused an
inhibition of AI [N-(
-hydroxybutanoyl)HSL] synthesis in
V. harveyi (10). They also found that the
-hydroxy group of this AI was in the D (now called R)
conformation and that stimulation of AI synthesis occurred mainly with
the addition of the 3R-isomer of butyric acid to the medium,
consistent with the acyl group coming from fatty acid synthesis.
However, these conclusions may not be relevant to the mechanism of AI
synthesis by the LuxI family of enzymes for the following reasons.
First, although there are two AI synthesis-detection systems in
V. harveyi, neither synthase shows any discernible sequence
homology to LuxI, and V. fischeri luxI and luxR
hybridization probes failed to detect any luxI or luxR homologs in this species (4, 37). Also,
transposon mutagenesis suggested that two genes (luxL and
luxM) are required for the synthesis of
N-(3-hydroxybutanyl)HSL in V. harveyi, although
polar effects of luxL on luxM were not ruled out
(4). Finally, the (3R)-hydroxybutanoyl acyl group
of the V. harveyi AI is the monomer unit of
poly-[(3R)-hydroxybutyrate] (PHB), and this species of bacterium has recently been found to carry out AI-dependent PHB synthesis (53). Hence, this acyl group may well be supplied by the pool of (3R)-hydroxylbutanoyl-CoA, the precursor for
PHB synthesis in prokaryotes, obtained from the condensation of two molecules of acetyl-CoA followed by stereospecific reduction of the
keto group (50), rather than by fatty acid synthesis per se.
Our finding that E. coli strains with mutations in the threonine-methionine biosynthesis pathway blocked in the synthesis of either homoserine, homoserine phosphate, or O-succinyl homoserine remain able to synthesize AAI (data not shown) agrees with the finding of Hanzelka and Greenberg (26) that only mutants blocked in the synthesis of methionine, rather than of homoserine or HSL, are unable to synthesize AI when expressing LuxI. These results also agree with our previous in vitro findings with a purified maltose binding protein-LuxI fusion protein (46) and with those of Moré et al. (38) with His-tagged TraI. Both of these enzymes synthesized the N-acyl HSL product in the presence of AdoMet, but not if AdoMet was replaced by homoserine or HSL.
If AdoMet is indeed the substrate that supplies the HSL ring for N-acyl HSL synthesis in in vivo alterations in the cells, AdoMet levels should affect the synthesis of N-acyl HSL AIs. We investigated this prediction by assaying AAI synthesis in the presence of an enzyme that specifically degrades AdoMet, thus lowering the intracellular AdoMet pool size. This approach has been used successfully before to study AdoMet-requiring processes in E. coli (12, 29) and is more specific than the use of methionine analogs (cycloleucine and ethionine) to inhibit AdoMet synthesis, as these analogs are incorporated in proteins in the place of methionine and/or provoke general amino acid starvation (2, 42). Furthermore, the fact that branched-chain amino acids protect against cycloleucine-induced growth inhibition indicates that cycloleucine has other effects on E. coli metabolism (3).
Using the T3 AdoMet hydrolase expression approach, we found that E. coli cells with a reduced AdoMet pool size have a greatly reduced capacity to synthesize AAI (Fig. 5), confirming the in vitro studies. The finding that small changes in intracellular AdoMet levels produced proportionally larger changes in AAI synthesis by TraI is consistent with our measurements of the intracellular AdoMet concentrations and the Km of TraI for this substrate, which is reported to be 48 µM (38). Therefore, it seems likely that AI synthesis is limited by the intracellular AdoMet concentration in E. coli. It would be of interest to test if AdoMet limits AI synthesis in the native organisms.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to S. K. Farrand for supplying us with N-[3-oxooctanoyl]HSL to use as a standard, for the plasmid pSEP1, and the A. tumefaciens indicator strain NT1(pDC141E33) and to Friederike Turnowsky, University of Graz, Graz, Austria, for kindly supplying us with diazoborine.
This work was supported by National Institutes of Health grant AI15650.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, University of Illinois, Urbana, IL 61801. Phone: (217) 333-7919. Fax: (217) 244-6697. E-mail: j-cronan{at}uiuc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alberts, A. W.,
R. M. Bell, and P. R. Vagelos.
1972.
Acyl carrier protein. XV. Studies of -ketoacyl-acyl carrier protein synthetase.
J. Biol. Chem.
247:3190-3198 |
| 2. |
Alix, J.-H.
1982.
Molecular aspects of the in vivo and in vitro effects of ethionine, an analog of methionine.
Microbiol. Rev.
46:281-295 |
| 3. | Baker, H., O. Frank, B. DeAngelis, and E. Baker. 1991. Branched-chain amino acids overcome cycloleucine growth inhibition in B12 and non-B12-requiring microorganisms. Int. J. Vitam. Nutr. Res. 61:319-324[Medline]. |
| 4. | Bassler, B. L., M. Wright, R. E. Showalter, and M. E. Silverman. 1993. Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence. Mol. Microbiol. 9:773-786[Medline]. |
| 5. |
Beck von Bodman, S.,
G. T. Hayman, and S. K. Farrand.
1992.
Opine catabolism and conjugal transfer of the nopaline Ti plasmid pTiC58 are coordinately regulated by a single repressor.
Proc. Natl. Acad. Sci. USA
89:643-647 |
| 6. |
Beck von Bodman, S. B., and S. K. Farrand.
1995.
Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N-acylhomoserine lactone autoinducer.
J. Bacteriol.
177:5000-5008 |
| 7. |
Bergler, H.,
P. Wallner,
A. Ebeling,
B. Leitinger,
S. Fuchsbichler,
H. Aschauer,
G. Kollenz,
G. Hogenauer, and F. Turnowsky.
1994.
Protein EnvM is the NADH-dependent enoyl-ACP reductase (FabI) of Escherichia coli.
J. Biol. Chem.
269:5493-5496 |
| 8. | Black, P. N., and C. C. DiRusso. 1994. Molecular and biochemical analysis of fatty acid transport, metabolism, and gene regulation in Escherichia coli. Biochim. Biophys. Acta 1210:123-145[Medline]. |
| 9. |
Cao, J., and E. A. Meighen.
1989.
Purification and structural identification of an autoinducer for the luminescence system of Vibrio harveyi.
J. Biol. Chem.
264:21670-21676 |
| 10. |
Cao, J. G., and E. A. Meighen.
1993.
Biosynthesis and stereochemistry of the autoinducer controlling luminescence in Vibrio harveyi.
J. Bacteriol.
175:3856-3862 |
| 11. |
Chang, Y.-Y., and J. E. J. Cronan.
1982.
Mapping nonselectable genes of Escherichia coli by using transposon Tn10: location of a gene affecting pyruvate oxidase.
J. Bacteriol.
151:1279-1289 |
| 12. |
Cronan, J. E., Jr.,
R. Reed,
F. R. Taylor, and M. B. Jackson.
1979.
Properties and biosynthesis of cyclopropane fatty acids in Escherichia coli.
J. Bacteriol.
138:118-121 |
| 13. | D'Agnolo, G., I. S. Rosenfeld, J. Awaya, S. Omura, and P. R. Vagelos. 1973. Inhibition of fatty acid synthesis by the antibiotic cerulenin. Specific inactivation of beta-ketoacyl-acyl carrier protein synthetase. Biochim. Biophys. Acta 326:155-166[Medline]. |
| 14. | Davis, R. W., D. Botstein, and J. R. Roth. 1980. In Advanced bacterial genetics: a manual for genetic engineering. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 15. | Eberhard, A., A. L. Burlingame, C. Eberhard, G. L. Kenyon, K. H. Nealson, and N. J. Oppenheimer. 1981. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry 20:2444-2449[Medline]. |
| 16. | Eberhard, A., T. Longin, C. A. Widrig, and S. J. Stranick. 1991. Synthesis of the lux gene autoinducer in Vibrio fischeri is positively autoregulated. Arch. Microbiol. 155:294-297. |
| 17. | Eberl, L., M. K. Winson, C. Sternberg, G. S. A. B. Stewart, G. Christiansen, S. R. Chhabra, B. W. Bycroft, P. Williams, S. Molin, and M. Givskov. 1996. Involvement of N-acyl-L-homoserine lactone autoinducers in controlling the multicellular behaviour of Serratia liquefaciens. Mol. Microbiol. 20:127-136[Medline]. |
| 18. |
Engebrecht, J., and M. Silverman.
1984.
Identification of genes and gene products necessary for bacterial bioluminescence.
Proc. Natl. Acad. Sci. USA
81:4154-4158 |
| 19. | Fedorova, N. D., M. Y. Peredelchuk, M. P. Kirpichnikov, and G. N. Bennett. 1996. Escherichia coli strain for thermoinducible T7 RNA polymerase-driven expression. Gene 177:267-268[Medline]. |
| 20. | Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu. Rev. Microbiol. 50:727-751[Medline]. |
| 21. |
Gellert, M.,
K. Mizuuchi,
M. H. O'Dea,
T. Itoh, and J.-I. Tomizawa.
1977.
Nalidixic acid resistance: a second genetic character involved in DNA gyrase activity.
Proc. Natl. Acad. Sci. USA
74:4772-4776 |
| 22. |
Gilson, L.,
A. Kuo, and P. V. Dunlap.
1995.
AinS and a new family of autoinducer synthesis proteins.
J. Bacteriol.
177:6946-6951 |
| 23. |
Gold, M.,
R. Hausmann,
U. Maitra, and J. Hurwitz.
1964.
The enzymatic methylation of RNA and DNA. VIII. Effects of bacteriophage infection on the activity of the methylating enzymes.
Proc. Natl. Acad. Sci. USA
52:292-297 |
| 24. |
Grana, D.,
T. Gardella, and M. M. Susskind.
1988.
The effects of mutations in the ant promoter of phage P22 depend on context.
Genetics
120:319-327 |
| 25. | Grassberger, M. A., F. Turnowsky, and J. Hildebrandt. 1984. Preparation and antibacterial activities of new 1,2,3-diazaborine derivatives and analogues. J. Med. Chem. 27:947-953[Medline]. |
| 26. |
Hanzelka, B. L., and E. P. Greenberg.
1996.
Quorum sensing in Vibrio fischeri: evidence that S-adenosylmethionine is the amino acid substrate for autoinducer synthesis.
J. Bacteriol.
178:5291-5294 |
| 27. |
Hatfield, D.,
M. Hofnung, and M. Schwartz.
1969.
Genetic analysis of the maltose A region in Escherichia coli.
J. Bacteriol.
98:559-567 |
| 28. | Henry, M. F., and J. E. Cronan, Jr. 1991. Escherichia coli transcription factor that both activates fatty acid synthesis and represses fatty acid degradation. J. Mol. Biol. 222:843-849[Medline]. |
| 29. |
Hughes, J. A.,
L. R. Brown, and A. J. Ferro.
1987.
Expression of the cloned coliphage T3 S-adenosylmethionine hydrolase gene inhibits DNA methylation and polyamine biosynthesis in Escherichia coli.
J. Bacteriol.
169:3625-3632 |
| 30. |
Hwang, I.,
P. L. Li,
L. Zhang,
K. R. Piper,
D. M. Cook,
M. E. Tate, and S. K. Farrand.
1994.
TraI, a LuxI homologue, is responsible for production of conjugation factor, the Ti plasmid N-acylhomoserine lactone autoinducer.
Proc. Natl. Acad. Sci. USA
91:4639-4643 |
| 31. | Kaplan, H. B., and E. P. Greenberg. 1985. Diffusion of autoinducer is involved in regulation of the Vibrio fischeri luminescence system. J. Bacteriol. 163:210-214. |
| 32. | Klein, K., R. Steinberg, B. Fiethen, and P. Overath. 1971. Fatty acid degradation in Escherichia coli. An inducible system for the uptake of fatty acids and further characterization of old mutants. Eur. J. Biochem. 19:442-450[Medline]. |
| 33. |
Knoll, L. J., and J. I. Gordon.
1993.
Use of strains containing fad mutations plus a triple plasmid system to study import of myristate, its activation by Saccharomyces cerevisiae acyl-CoA synthetase and its utilization by S. cerevisiae myristoyl-CoA-protein N-myristoyltransferase.
J. Biol. Chem.
268:4281-4290 |
| 34. |
Lombardini, J.,
A. W. Coulter, and P. Talalay.
1970.
Analogues of methionine as substrates and inhibitors of the methionine adenosyltransferase reaction.
Mol. Pharmacol.
6:481-499 |
| 35. |
Magnuson, K.,
S. Jackowski,
C. O. Rock, and J. E. Cronan, Jr.
1993.
Regulation of fatty acid biosynthesis in Escherichia coli.
Microbiol. Rev.
57:522-542 |
| 36. | Miroux, B., and J. E. Walker. 1996. Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 260:289-298[Medline]. |
| 37. |
Miyamoto, C. M.,
A. F. Graham, and E. A. Meighen.
1988.
Nucleotide sequence of the luxC gene and the upstream DNA from the bioluminescent system of Vibrio harveyi.
Nucleic Acids Res.
16:1551-1562 |
| 38. | Moré, M. I., L. D. Finger, J. L. Stryker, C. Fuqua, A. Eberhard, and S. C. Winans. 1996. Enzymatic synthesis of a quorum-sensing autoinducer through use of defined substrates. Science 272:1655-1658[Abstract]. |
| 39. |
Okusu, H.,
D. Ma, and H. Nikaido.
1996.
AcrAB efflux pump plays a major role in antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants.
J. Bacteriol.
178:306-308 |
| 40. | Overath, P., G. Pauli, and H. U. Schairer. 1969. Fatty acid degradation in Escherichia coli. An inducible acyl-CoA synthetase, the mapping of old mutations, and the isolation of regulatory mutants. Eur. J. Biochem. 7:559-574[Medline]. |
| 41. |
Pearson, J. P.,
K. M. Gray,
L. Passador,
K. D. Tucker,
A. Eberhard,
B. A. Iglewski, and E. P. Greenberg.
1994.
Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes.
Proc. Natl. Acad. Sci. USA
91:197-201 |
| 42. |
Pine, M. J.
1978.
Comparative physiological effects of incorporated amino acid analogs in Escherichia coli.
Antimicrob. Agents Chemother.
13:676-685 |
| 43. | Salmond, G. P., B. W. Bycroft, G. S. Stewart, and P. Williams. 1995. The bacterial 'enigma': cracking the code of cell-cell communication. Mol. Microbiol. 16:615-624[Medline]. |
| 44. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. In Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 45. |
Satishchandran, C.,
J. C. Taylor, and G. D. Markham.
1990.
Novel Escherichia coli K-12 mutants impaired in S-adenosylmethionine synthesis.
J. Bacteriol.
172:4489-4496 |
| 46. |
Schaefer, A. L.,
D. L. Val,
B. L. Hanzelka,
J. E. Cronan, Jr., and E. P. Greenberg.
1996.
Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein.
Proc. Natl. Acad. Sci. USA
93:9505-9509 |
| 47. |
Shaw, P. D.,
G. Ping,
S. L. Daly,
C. Cha,
J. E. Cronan, Jr.,
K. L. Rinehart, and S. K. Farrand.
1997.
Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography.
Proc. Natl. Acad. Sci. USA
94:6036-6041 |
| 48. |
Simons, R. W.,
P. A. Egan,
H. T. Chute, and W. D. Nunn.
1980.
Regulation of fatty acid degradation in Escherichia coli: isolation and characterization of strains bearing insertion and temperature-sensitive mutations in gene fadR.
J. Bacteriol.
142:621-632 |
| 49. |
Simons, R. W.,
K. T. Hughes, and W. D. Nunn.
1980.
Regulation of fatty acid degradation in Escherichia coli: dominance studies with strains merodiploid in gene fadR.
J. Bacteriol.
143:726-730 |
| 50. |
Steinbuchel, A., and H. G. Schlegel.
1991.
Physiology and molecular genetics of poly( -hydroxyalkanoic acid) synthesis in Alcaligenes eutrophus.
Mol. Microbiol.
5:535-542[Medline].
|
| 51. | Studier, F. W. 1991. Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol. 219:37-44[Medline]. |
| 52. |
Sugino, A.,
C. L. Peebles,
K. N. Kreuzer, and N. R. Cozzarelli.
1977.
Mechanism of action of nalidixic acid: purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme.
Proc. Natl. Acad. Sci. USA
74:4767-4771 |
| 53. |
Sun, W.,
J.-G. Cao,
K. Teng, and E. A. Meighen.
1994.
Biosynthesis of poly-3-hydroxybutyrate in the luminescent bacterium, Vibrio harveyi, and regulation by the lux autoinducer N-(3-hydroxybutanoyl)homoserine lactone.
J. Biol. Chem.
269:20785-20790 |
| 54. |
Theze, J.,
D. Margarita,
G. N. Cohen,
F. Borne, and J. C. Patte.
1974.
Mapping of the structural genes of the three aspartokinases and of the two homoserine dehydrogenases of Escherichia coli K-12.
J. Bacteriol.
117:133-143 |
| 55. |
Theze, J., and I. Saint-Girons.
1974.
Threonine locus of Escherichia coli K-12: genetic structure and evidence for an operon.
J. Bacteriol.
118:990-998 |
| 56. | Throup, J. P., M. Camara, G. S. Briggs, M. K. Winson, S. R. Chhabra, B. W. Bycroft, P. Williams, and G. S. A. B. Stewart. 1995. Characterisation of the yenI/yenR locus from Yersinia enterocolitica mediating the synthesis of two N-acylhomoserine lactone signal molecules. Mol. Microbiol. 17:345-356[Medline]. |
| 57. |
Turnowsky, F.,
K. Fuchs,
C. Jeschek, and G. Hogenauer.
1989.
envM genes of Salmonella typhimurium and Escherichia coli.
J. Bacteriol.
171:6555-6565 |
| 58. | Val, D. L., A. Chapman-Smith, M. E. Walker, J. E. Cronan, and J. C. Wallace. 1995. Polymorphism of the yeast pyruvate carboxylase 2 gene and protein: effects on protein biotinylation. Biochem. J. 312:817-825. |
| 59. | Vance, D., I. Goldberg, O. Mitsuhashi, K. Bloch, S. Omura, and S. Nomura. 1972. Inhibition of fatty acid synthetases by the antibiotic cerulenin. Biochem. Biophys. Res. Commun. 48:649-656[Medline]. |
| 60. |
Weeks, G.,
M. Shapiro,
R. O. Burns, and S. J. Wakil.
1969.
Control of fatty acid metabolism. I. Induction of the enzymes of fatty acid oxidation in Escherichia coli.
J. Bacteriol.
97:827-837 |
| 61. | Woldringh, C. L., and N. Nanninga. 1985. Structure of the nucleoid and cytoplasm in the intact cell, p. 161-198. In N. Naninga (ed.), Molecular cytology of Escherichia coli. Academic Press, Orlando, Fla. |
| 62. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline]. |
| 63. | Zhang, L., P. J. Murphy, A. Kerr, and M. E. Tate. 1993. Agrobacterium conjugation and gene regulation by N-acyl-L-homoserine lactones. Nature 362:446-448[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»