Previous Article | Next Article ![]()
J Bacteriol, May 1998, p. 2660-2669, Vol. 180, No. 10
School of Animal and Microbial Sciences,
University of Reading, Reading RG6 6AJ, United Kingdom
Received 16 October 1997/Accepted 6 March 1998
The dctA gene, coding for the dicarboxylate transport
protein, has an inducible promoter dependent on activation by the
two-component sensor-regulator pair DctB and DctD. LacZ fusion analysis
indicates that there is a single promoter for dctB and
dctD. The dctA promoter is also induced by
nitrogen limitation, an effect that requires DctB-DctD and NtrC. DctB
alone is able to detect dicarboxylates in the absence of DctA and
initiate transcription via DctD. However, DctA modifies signal
detection by DctB such that in the absence of DctA, the ligand
specificity of DctB is broader. dctAp also responds to
heterologous induction by osmotic stress in the absence of DctA. This
effect requires both DctB and DctD. A transposon insertion in the
dctA-dctB intergenic region (dctA101) which
locks transcription of dctA at a constitutive level
independent of DctB-DctD results in improper signalling by DctB-DctD.
Strain RU150, which carries this insertion, is defective in
nitrogen fixation (Fix Transport and catabolism of
dicarboxylic acids are required to fuel nitrogen fixation by rhizobia
in legume nodules. In free-living cells of Rhizobium
leguminosarum and Sinorhizobium meliloti, transport of
L-malate, fumarate, and succinate occurs via the
C4-dicarboxylic transport (Dct) system (5, 8, 10,
39). This system consists of three genes: dctA, which
codes for the putative transport protein, and two divergently
transcribed genes, dctB and dctD, which activate transcription of dctA in response to the presence of
dicarboxylates (6, 15, 16, 35, 38, 46). DctB and DctD are
well characterized as a two-component sensor-regulator pair. In
free-living cultures, mutations in any of the three dct
genes result in the loss of the ability to transport and grow on
C4-dicarboxylates (1, 5, 7, 16, 35, 38). Strains
with mutations in dctA always display a nitrogen
fixation-defective (Fix Transcription from dctAp is dependent on E The C terminus of DctB has homology over 200 amino acids with a large
number of sensor proteins (35, 38). It is capable of both
autophosphorylation, presumably at histidine 416, and phosphorylation
of DctD (9). There are two putative membrane-spanning regions, between residues 25 and 42 and between residues 321 and 328, that are predicted to form a large periplasmic loop, similar to those
found in the methyl-accepting chemotaxis proteins of Escherichia
coli which sense chemoattractants in the periplasm (18,
26). It has therefore been suggested that in both R. leguminosarum and S. meliloti, DctB acts as a
membrane-bound sensor that responds to the presence of
C4-dicarboxylates and transduces this signal across the
membrane to activate its cytoplasmically located C terminus. This
results in autophosphorylation and phosphotransfer to DctD (38,
46).
However, a number of reports have shown that strains with
mutations in dctA display constitutive transcription
from dctAp, suggesting that DctA has a role in
controlling its own synthesis (16, 36, 48). It has been
proposed that in the absence of substrate, DctA and DctB may interact
with each other in the cytoplasmic membrane, preventing activation of
DctB. In the wild type, binding of a dicarboxylate would release DctB,
enabling it to activate DctD, while in a dctA strain, DctB
would always be in the activated mode (17, 48). A
modification of this model, whereby DctB senses the
C4-dicarboxylate-dependent conformational state of DctA,
rather than sensing C4-dicarboxylates directly, has been proposed (48). Thus, DctA would undergo a conformational
change, as a result of binding or transporting substrate, which would result in the release and/or activation of DctB.
Given the importance of the Dct system to nitrogen fixation and our
detailed knowledge of the binding kinetics and activation of
transcription of dctAp by DctD, the contradictions and
uncertainty in our understanding of the initial signal detection by
DctA and DctB are glaring. It is not even clear if DctB is a sensor of dicarboxylates in its own right. We therefore initiated a study of how
the dctA, dctB, and dctD promoters are
regulated by inducers and how DctA and DctB influence this process.
Bacterial strains and culture conditions.
Bacterial strains,
bacteriophage, and plasmids used in this study are described in Table
1. R. leguminosarum strains
were grown at 28°C on either TY (3) or acid minimal salts
(AMS) medium (pH 7.2) (29). All carbon and nitrogen sources
were at 10 mM concentrations unless otherwise stated. Antibiotics were used at the following concentrations (in micrograms per milliliter): kanamycin, 40; streptomycin, 500; spectinomycin, 100; tetracycline, 2 (in AMS) and 5 (in TY); and gentamicin, 20. E. coli strains were grown at 37°C on Luria-Bertani medium with antibiotic
concentrations as follows (in micrograms per milliliter): kanamycin,
25; tetracycline, 10; gentamicin, 5; and ampicillin, 50.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Roles of DctA and DctB in Signal Detection by the Dicarboxylic
Acid Transport System of Rhizobium leguminosarum
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
) and grows very poorly on
ammonia as a nitrogen source whenever the DctB-DctD signalling circuit
is activated by the presence of a dicarboxylate ligand. Mutation of
dctB or dctD in strain RU150
reinstates normal growth on dicarboxylates. This suggests that
DctD-P improperly regulates a heterologous nitrogen-sensing operon. Increased expression of DctA, either via a plasmid or by
chromosomal duplication, restores control of DctB-DctD and allows
strain RU150 to grow on ammonia in the presence of a dicarboxylate. Thus, while DctB is a sensor for dicarboxylates in its own right, it is
regulated by DctA. The absence of DctA allows DctB and DctD to become
promiscuous with regard to signal detection and cross talk with other
operons. This indicates that DctA contributes significantly to the
signalling specificity of DctB-DctD and attenuates cross talk with
other operons.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
) phenotype on plants, and
isolated bacteroids do not transport C4-dicarboxylates.
However, some strains with mutations in dctB or
dctD fix nitrogen, and isolated bacteroids transport
C4-dicarboxylates, albeit at a reduced rate (1, 5,
8).
54,
which binds to a site located 93 bp upstream from the dctA
start codon in R. leguminosarum and in a similar position in
S. meliloti (13). Proximal and distal upstream
activator sequences which contain inverted repeats are also located
approximately 75 bp upstream from the end of the putative
54 binding site (13, 36). DctD is able to
bind in a cooperative fashion to these upstream activator sites, via a
C-terminal helix-turn-helix motif, to initiate transcription
(20-23, 41, 42, 45). Deletion of either upstream activator
sequence results in a significant reduction in transcription (20,
21). DctD has recently been shown to be able to interact with
both
54 and the
-subunit of RNA polymerase; in the
process, it hydrolyzes ATP to promote open complex formation (11,
12, 22, 23).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used
DNA and genetic manipulations. All routine DNA analysis was performed essentially according to the procedures of Sambrook et al. (40). Conjugations were performed as previously described (29). Transductions were performed with bacteriophage RL38 as described by Buchanan-Wollaston (4). Linkage in the second-site suppressor strains RU152-1, RU152-14, and RU152-22 was determined by transducing the kanamycin marker of Tn5 into strain 3841. Forty kanamycin-resistant transductants of each strain were double purified and tested for growth on glucose-ammonia and succinate-ammonia. Strain 3841 was mutagenized with Tn5 by conjugation with E. coli S17-1 containing pSUP202-1::Tn5 essentially as described by Simon et al. (43). Strain RU150 was isolated due to its poor growth on succinate-ammonia. Chromosomal DNA from strain RU150 was digested with EcoRI, and a 6.7-kb fragment was cloned into Bluescript II SK+ by selecting for kanamycin resistance. The left and right arms of the transposon were isolated by BamHI and HindIII digestion followed by self-ligation. Both arms were sequenced by using a primer that binds to the ends of IS50 (P0) and SK and KS primers in the plasmid. For clarity, the mutant allele in strain RU150 has been designated dctA101.
All sequencing was performed by the cycle sequencing method by using a Promega fmol kit according to the manufacturer's instructions. Genetics Computer Group software was used for computer-assisted sequence analysis. Custom primers used were P0 (GTTCAGGACGCTACTTG), P2 (CGCTGTCGTCCAATCTCCCAAGAC), P3 (TCTGATGGCGCAGGGGATCAAGAT), P6 (AAGGCCACAATTTCTGCGACACGG), and P7 (GTTTCTAAGGATAAGGGGATAGCG).Inverse PCR. Chromosomal DNA from strain RU152-14 was digested with EcoRI and electrophoresed on an agarose gel; the 1- to 2-kb bands were excised and purified to ensure that the Tn5-containing fragment was not present. These were ligated to form circular DNA, and the insert DNA was amplified by inverse PCR with primers P2 and P3, with 30 cycles of 94, 55, and 72°C, each for 1.5 min. The resulting 0.4-kb fragment was cloned into pGEM-T (pRU110) and sequenced on both strands as far as the central EcoRI site.
Northern blotting.
Total RNA was isolated according to the
method of Rastogi et al. (32), and 20 µg was separated on
an agarose gel and transferred by Northern blotting to an Amersham
Hybond N plus membrane. A dctA-specific probe was produced
by PCR amplification of pRU69 with primers P6 and
P7 under the same conditions as those used for inverse PCR.
The resulting 1.5-kb fragment was cloned into pGEM-T and designated
pRU123. The total-RNA blot was hybridized with the dctA DNA
probe (pRU123) which had been random primed with 50 µCi of
[
-32P]dCTP (3,000 Ci mmol
1) by using an
Amersham random priming kit according to the manufacturer's instructions.
Transcriptional lacZ fusions. The dctA-lacZ (pRU103) fusion consists of a 950-bp EcoRI fragment cloned in the transcriptional promoter probe vector pMP220 and has been described previously (34). The EcoRI site in dctA is present only in strain 3841 and results from a change from G to A at bp 2082 of the sequence published for R. leguminosarum (EMBL accession no. Z11529). This results in a coding change from Leu to Phe. The dctB-lacZ fusion has the same 950-bp EcoRI fragment but in the reverse orientation (Fig. 1). Two dctD-lacZ fusions and one dctBD-lacZ fusion were constructed. The first dctD-lacZ fusion, dctD1-lacZ, consists of a 0.53-kb PstI fragment cloned in pMP220. This plasmid, pRU292, contains the 339 bp preceding the translational start of dctD and extends 193 bp into dctD. The second dctD-lacZ fusion, dctD2-lacZ, consists of a 2.4-kb EcoRI/MluI fragment cloned in pMP220. This plasmid, pRU392, contains 1.3 kb of dctB preceding dctD and 1.1 kb of dctD. The dctBD-lacZ fusion consists of a 3.6-kb BamHI/MluI fragment cloned in pMP220. This plasmid, pRU354, contains all of dctB, the 5' end of dctA, and 1.1 kb of dctD. Notably, it contains the same point of fusion to dctD as dctD2-lacZ.
|
. The EcoRI fragment from pRU10 was cloned
into pRU348, and a partial EcoRI/XbaI digest was
used to transfer the whole insert into pMP220, creating pRU352.
-Galactosidase assays were conducted according to the method of
Miller (25) with modifications as previously described (27). For calculation of substrate-dependent induction, the average background of o-nitrophenylgalactoside hydrolyzed in
the presence of the vector pMP220 alone (168 nmol min
1 mg
of protein
1) was used for all samples.
Construction of strain RU150 dct double mutants.
All the RU150 dct double mutants were constructed by using
the sac selection system in pJQ200KS and the
interposon
encoding spectinomycin resistance (30, 31).
was made by cloning a
BamHI-digested
interposon into the BamHI site of pRU123, creating pRU155. The DNA at the 5' end of dctA
was replaced with the corresponding DNA from strain RU150 by cloning the AccIII fragment from pRU10 (EcoRI fragment
containing Tn5 from strain RU150) into pRU155, creating
pRU345. The entire insert from pRU345, which contains
IS50L upstream of dctA, was
transferred as a NotI/ApaI fragment into
pJQ200KS, generating pRU305. The NotI site used is located
in IS50L of Tn5. This plasmid
contains 894 bp upstream of the
interposon and 947 bp downstream of
it and is identical to the flanking DNA in strain RU150.
The plasmid required to produce RU150 dctB::
was made by cloning the EcoRI/EcoRV fragment (1.2 kb) from pRU47, which contains part of dctB, into Bluescript
SK
. This was digested with NruI, which cuts
dctB 949 bp from its translational start site, and a
SmaI-digested
interposon was ligated in to form pRU158.
The Tn5 EcoRI fragment from pRU10 was ligated into pRU158,
forming pRU347, and the insert was transferred as a
NotI/ApaI fragment into pJQ200KS, generating
pRU304.
To produce strain RU150
dctD::
, plasmid
pRU150 was digested with EcoRV and religated. This utilizes
an EcoRV site in the polylinker of the vector and removes
all of dctA, dctB, and the 5' end of
dctD. The internal NruI fragment (123 bp) was
deleted, and a SmaI-digested
interposon was ligated in.
The whole insert was transferred to pJQ200KS as a
NotI/ApaI fragment, forming pRU168.
To produce strain RU150
dctBD::
, plasmid
pRU150 was digested with EcoRI and religated. This utilizes
an EcoRI site in the polylinker of the vector and removes
dctA and the 5' end of dctB. The internal
NruI fragment (1.9 kb) was removed, and a
SmaI-digested
interposon was ligated in. The
EcoRI fragment from pRU10 was cloned in, and the whole
insert was transferred as a NotI/ApaI fragment
into pJQ200KS, forming pRU303.
The four plasmids pRU168, pRU303, pRU304, and pRU305 were conjugated
into strain RU150 and plated onto TY containing spectinomycin and
sucrose (5% [wt/vol]). This generated strains RU720 (dctA101
dctD::
), RU873 (dctA101
dctBD::
), RU875 (dctA101
dctB::
), and RU938 (dctA101
dctA::
). These were all confirmed as having the
correct genotypes by Southern blotting (data not shown).
Transport assays.
R. leguminosarum strains were
prepared, and transport assays were performed, as previously described
(28); in each case, a total succinate concentration of 25 µM was used. The specific activity of [2,3-14C]succinic
acid was 4 GBq mmol
1.
Plant assays. Nodulation and acetylene reduction were determined by using plants of common vetch (Vicia sativa). Plant growth and acetylene reductions were carried out as previously described (27), except that plants were harvested 6 weeks postinoculation.
| |
RESULTS |
|---|
|
|
|---|
Transcriptional analysis of the dctA, dctB,
and dctD promoters in strain 3841.
Succinate and
aspartate are good inducers of dctAp in R. leguminosarum and S. meliloti (16, 20, 36, 47,
48). Consistent with this, strain 3841, containing a
dctA-lacZ transcriptional fusion (pRU103), had a 19- or
14-fold increase in
-galactosidase activity after growth on
succinate or aspartate (supplied as the nitrogen source), respectively,
compared to that on glucose (Table 2).
All fold inductions were calculated after subtraction of the average
background due to the vector pMP220 (168 nmol min
1 mg of
protein
1).
-Galactosidase activity increased
approximately 33-fold when strain 3841 was grown in the presence of
both succinate and aspartate, indicating an additive effect. Cells
grown on succinate-aspartate-ammonia showed an approximately 50%
reduction in
-galactosidase activity compared to
succinate-aspartate-grown cells. One possibility is that cells grown on
succinate-aspartate might be nitrogen limited. If this is correct,
dctAp may respond to nitrogen limitation as well as to the
presence of a dicarboxylate (see below).
|
-Galactosidase expression from both pRU292 and pRU392, which have
339 bp and 1.3 kb of DNA upstream of the DctD translational start site,
respectively, was similar to that obtained from strain 3841, containing
the parent pMP220 replicon (Table 3). Since pRU392 contains 1.3 kb of
dctB DNA preceding the start site of dctD, it is
unlikely that dctD has a significant promoter of its own.
Expression of
-galactosidase from the dctBD-lacZ fusion (pRU354) displayed activity similar to that from the
dctB-lacZ fusion (Table 3), indicating that dctB
and dctD are a single transcriptional unit. Given that the
translational stop site for DctB is only 5 bp upstream of the
translational start site of DctD in R. leguminosarum, this
is not an unexpected result. However, it is in marked contrast to the
conclusion, in a previous report for S. meliloti, that
dctD has its own promoter (16).
|
DctB is the sensor for dicarboxylates.
A series of models have
been proposed to explain the apparent constitutive expression of
dctAp in a strain lacking DctA (16, 20, 36, 47,
48). However, there has been one report that a
dctA::Tn5-lacZ mutant of S. meliloti does not constitutively express dctA
(2). To examine these fundamental contradictions in our
understandings of how the Dct system is regulated, expression from
dctAp was monitored by using
-galactosidase activity
under various growth conditions. Since all these strains are defective for growth on C4-dicarboxylates, induction of the
dctAp was tested by growing the strains on glucose-ammonia
in the presence of succinate or aspartate. This was possible because
glucose does not interfere with induction of dctAp by
succinate or aspartate in the wild type (Table 2).
) carrying the
dctA reporter fusion pRU103 had a 19- to 33-fold elevation
in
-galactosidase when grown in the presence of succinate or
aspartate compared to growth on glucose-ammonia (Table 2). This is
similar to results for strain 3841, indicating that transcription from
dctAp is still inducible in the absence of DctA. To ensure
that the inducibility of dctAp is not dependent on the
interposon mutant strain RU727,
-galactosidase activity from
dctA-lacZ was measured for strains RU436 and RU437,
which are dctA::Tn5 derivatives
of strain 3841. Both mutant strains showed induction from
dctAp after growth on glucose-aspartate or
glucose-succinate-ammonia (Table 2). No transcription from
dctAp was evident in any strain with dctB, dctD,
dctBD, or
dctABD
mutations, confirming that induction of dctAp is dependent
on DctB and DctD (Table 2). Similar results were obtained with
R. leguminosarum 3855 (wild type), CR534
(dctA::Tn5), CR535
(dctB::Tn5), and CR538
(dctD::Tn5). These strains were
chosen because they are the original R. leguminosarum
strains used to characterize the Dct system (35, 37).
Since all the results in Table 2 were obtained by using pRU103, which
is a transcriptional
-galactosidase fusion, we tested induction of
the dct system in R. leguminosarum by using a
translation phoA fusion derived from S. meliloti
(48). Plasmid pTH2A was conjugated into R. leguminosarum 3841 and RU727, and the alkaline phosphatase
activities were measured. After growth on glucose-NH4Cl, the activities were 13.5 ± 0.3 and 11.6 ± 0.6 nmol
min
1 mg of protein
1 for strains 3841 and
RU727 containing pTH2A, respectively. After growth on
succinate-NH4Cl, the activities were 63.4 ± 0.5 and 59.3 ± 0.7 nmol min
1 mg of protein
1
for strains 3841 and RU727, respectively. Thus, the
dctA promoter was induced by a dicarboxylic acid in both
strains, indicating that the results are not dependent on the type of
reporter fusion used. Furthermore, the S. meliloti and
R. leguminosarum dctAp's respond in the same way.
Induction of the Dct system by nitrogen limitation and osmotic stress. The above data indicate that DctB acts as a sensor for dicarboxylates and that it does not simply detect the solute binding state of DctA. However, stress-dependent induction of the Dct system has been reported for a dctA strain but not for the wild type of S. meliloti (2). To examine this further, the role of each of the genes of the Dct system in induction by osmotic stress in R. leguminosarum 3841 was investigated.
Transcription from dctAp was examined in cells grown on glucose-ammonia with either no sucrose or 0.05 or 0.1 M sucrose. These concentrations of sucrose did not alter the cells' growth rate. Strain 3841/pRU103 displayed no increase in transcription from dctAp in response to these conditions, or to higher levels of sucrose (Table 4). However, in the dctA strain (RU727), growth on 0.1 M sucrose increased transcription from dctAp 27-fold relative to growth on no sucrose (Table 4). Transcription from dctAp in strain RU727 grown in the presence of 100 mM NaCl was 1,365 nmol min
1
mg of protein
1. In contrast to this 10-fold induction,
strain 3841 was unaffected. However, 100 mM NaCl slows the growth of
R. leguminosarum, so most tests were conducted with sucrose.
Mutations in dctB (RU730) or dctD (RU711), or
deletion of dctBD (RU865) or of the whole dctABD
operon (RU714), abolished osmotic induction of dctAp (Table 4).
|
-galactosidase activity, respectively (Table 4). Thus,
nitrogen limitation leads to induction of dctAp regardless
of the presence or absence of DctA. Induction of dctAp by
nitrogen limitation is DctB-DctD dependent, since strains with
dctB (RU730), dctD (RU711),
dctBD
(RU865), or
dctABD (RU714) mutations did not induce
transcription from dctAp in response to nitrogen limitation (Table 4). The increased induction of dctAp in cells grown
on succinate-aspartate relative to succinate-aspartate-ammonia may be
due to an additive effect of a substrate inducer and nitrogen limitation (see above).
Strain RU929 (ntrC::
) containing pRU103 did not
show increased
-galactosidase activity in response to nitrogen
limitation (Table 4), indicating that NtrC is necessary for induction
of transcription from dctAp under these conditions.
Therefore, DctB-DctD and NtrC are required for induction of
dctAp under conditions of nitrogen limitation.
The ligand specificity of DctB is modified by DctA. While the above data show that DctB is a sensor for dicarboxylates independent of DctA, the DctB-DctD-dependent osmotic stress activation of dctAp is prevented by the presence of DctA. This suggests that DctA may interact with DctB-DctD to modify its signalling ability. To test this further, we investigated the induction of dctAp by a number of nonmetabolizable analogs of succinate. In transport studies these analogs are able to compete with succinate, albeit weakly, for uptake by DctA (10). 2-Methyl succinate, itaconic acid, or 2,2-dimethyl succinic acid did not support growth of either strain 3841 (wild type) or RU727 (dctA) when present as the sole carbon source, but they did not inhibit the growth of these strains on glucose-ammonia. Therefore, strains carrying pRU103 were tested for induction of transcription from dctAp in response to these analogs when they were provided with glucose-ammonia as the growth substrates. Itaconic acid induced dctAp in strain 3841 to an extent similar to that induced by aspartate (compare Tables 2 and 4), while no induction by 2-methyl succinate, 2,2-dimethyl succinate, or asparagine was evident (Table 4). However, in strain RU727 (dctA), 2-methyl succinate and 2,2-dimethyl succinate induced transcription from dctAp to levels similar to those recorded after growth in the presence of aspartate. Thus, DctA prevents transcription from dctAp by 2-methyl succinate and 2,2-dimethyl succinate. No induction was evident in dctB or dctD strains in response to any compound, indicating that induction by succinate analogs is DctB-DctD dependent (Table 4). While 2,2-dimethyl succinate induced the dctA-lacZ fusion in strain RU727 at 5 mM, even 20 mM concentrations had no effect on strain 3841 (data not shown).
Asparagine, which supports growth of strain 3841 when supplied as a nitrogen source but not as the sole carbon source, was also tested for induction of transcription from dctAp. When cells were grown on glucose-ammonia-asparagine or on glucose-asparagine, no transcription from dctAp was evident either in strain 3841 (wild type) or in strain RU730 (dctB) or RU711 (dctD). However, in strain RU727 (dctA), a fivefold increase in transcription was evident after growth on glucose-asparagine or glucose-ammonia-asparagine. These data show that the DctB-DctD-dependent transcription of dctAp has a lower stereospecificity in the absence of DctA. The inducer profile of DctB is limited or modified by DctA so that in the absence of DctA, DctB-DctD becomes hypersensitive to induction.Isolation of a constitutive Dct mutant. In studies of the effect of the Dct system on the aspartate-mediated inhibition of the general L-amino acid permease of strain 3841, random Tn5 mutagenesis was carried out on strain 3841 (34, 44). One mutant (RU150) displayed an unusual phenotype in that it grew very poorly on succinate-ammonia (mean generation time, approximately 30 h) but grew well on succinate-aspartate (mean generation time, 4 h). Furthermore, aspartate does not support growth of strain 3841 as a carbon source (34). Strain RU150 also grew as well as strain 3841 when either glutamate, glutamine, asparagine, serine, alanine, proline, or histidine was supplied as the nitrogen source in conjunction with succinate. Of these amino acids, serine and asparagine did not support growth as the sole carbon/nitrogen source of strain 3841 or RU150. However, strain RU150 grew normally on glucose as the carbon source in conjunction with ammonia. Thus, strain RU150 requires an amino acid as a nitrogen source when growing on a C4-dicarboxylic acid but not on a sugar as the carbon source. This implies that either ammonia assimilation or nitrogen metabolism is disrupted specifically during growth on a C4-dicarboxylic acid.
Strains 3841 and RU150 were grown on glucose-ammonia, and the succinate transport rates were 6 ± 1 and 42 ± 3 nmol min
1 mg of protein
1 (± standard errors of
the mean [SEM] from three independent cultures), respectively. After
growth on glucose-aspartate, the succinate uptake rates for 3841 and
RU150 were 50 ± 5 and 44 ± 4 nmol min
1 mg of
protein
1, respectively. Thus, succinate transport is
constitutive in strain RU150.
Strain RU150 has Tn5 inserted in the dctA-dctB intergenic region. Chromosomal DNA from strains 3841 and RU150 was digested with EcoRI (which does not cut in Tn5), Southern blotted, and probed with the plasmid pSUP202::Tn5 and the dct-containing cosmid pIJ1848. A single band of 6.7 kb from strain RU150 hybridized with pSUP202::Tn5, but this band was absent in strain 3841 (data not shown). This indicates that Tn5 inserted once in strain RU150. When chromosomal DNA was hybridized with pIJ1848, a 0.9-kb EcoRI band present in strain 3841 was absent in strain RU150, being replaced by a band at 6.7 kb (data not shown). This 6.7-kb fragment presumably contains Tn5 (5.8 kb) and approximately 0.9 kb of flanking chromosomal DNA.
The generalized transducing phage RL38 was used to transduce Tn5 from strain RU150 into strain 3841 by selection for kanamycin resistance. One hundred kanamycin-resistant transductants had the same growth pattern as RU150 on succinate-ammonia, glucose-ammonia, glucose-aspartate, and succinate-aspartate, indicating 100% cotransduction of the mutation and transposon. This demonstrates that they are closely linked. The transposon in strain RU150 was cloned, and the flanking DNA was found to have virtually 100% identity at the nucleotide level to the dctA-dctB intergenic region of R. leguminosarum (38). Tn5 had inserted in an AccIII site, 9 bp upstream from the ribosome binding site of dctA. The 9-bp repeats, indicative of a Tn5 insertion, were present on either side of Tn5, duplicating the AccIII site (Fig. 1B). IS50R is adjacent to dctB, while IS50L is adjacent to dctA. The direction of transcription of the genes encoding kanamycin and streptomycin resistance is towards dctB. This allele is referred to below as dctA101. As succinate uptake is constitutive in strain RU150, the levels of transcription of dctA, dctB, and dctD were examined. Strain RU150 containing the native dctAp reporter probe (pRU103) displayed normal regulation of transcription from dctAp in response to suitable inducers (Table 2). This indicates that the sensor circuit via DctB and DctD, which detects the presence of C4-dicarboxylates and activates transcription of dctA, functions normally in strain RU150. Reporter fusions for dctA101 (pRU105), dctA101B (pRU106), and dctA101BD (pRU352) were constructed by using the EcoRI clone of the dct intergenic region from strain RU150 carrying Tn5. Expression of
-galactosidase from dctA101
in strains RU150 and 3841 was constitutive at approximately double the
level of the native dctAp under noninducing conditions
(Table 3). dctA101-lacZ had approximately one-sixth the
level of
-galactosidase relative to the native dctAp in
cells grown in the presence of succinate or aspartate. These results
are consistent with the ability of strain RU150 to transport succinate
constitutively. However, they suggest that only a small increase in the
level of transcription of dctA is required to obtain a high
level of transport activity by DctA. This result was confirmed by
Northern blotting (see below).
Expression of dctB from both its native promoter and the
putative Tn5 promoter was measured in strains 3841 and
RU150. In strain RU150 the native dctBp was expressed
constitutively at lower levels than in strain 3841 under all growth
conditions (Table 3). Strains 3841 and RU150 containing
dctA101B-lacZ displayed similar levels of
-galactosidase
on all growth substrates, although the levels were approximately
twofold higher than those for the native dctBp (Table 3).
This indicates that the level of dctB transcription in
strain RU150 is increased slightly in comparison to that in strain
3841. As expected, dctBD-lacZ and dctA101BD-lacZ showed activities similar to those of dctB and
dctA101B-lacZ, respectively. The dctA101-lacZ
fusion was expressed constitutively in both strains RU730
(dctB::
) and RU711
(dctD::
), at a level similar to that observed
in strains RU150 and 3841 (Table 3). Thus, transcription from
dctA101Ap in strain RU150 is independent of DctB and DctD.
In summary, the Tn5 insertion in dctA101 results in a low level of constitutive expression of dctA, an
approximately twofold increase in transcription of dctB, and
a slight increase in transcription of dctD. However, the
DctB-DctD signalling pathway still functions in strain RU150, since
there is a ligand-specific induction of the native dctAp
carried by a plasmid.
The dct-containing cosmid pIJ1848 complemented strain
RU150 for normal growth on succinate-ammonia, as did pIJ1969
(pIJ1848-Tn5::dctB) but not
pIJ1970
(pIJ1848-Tn5::dctA).
Consistent with this, pRU108, which contains dctA
alone with the complete dctAB intergenic region, also
complemented RU150. These results indicate that increasing the
level of dctA enables strain RU150 to grow on
succinate-ammonia.
Given that the above data indicate that DctB is a sensor for
dicarboxylates, it appears that in strain RU150 the presence of
succinate causes DctB-DctD to improperly regulate a heterologous nitrogen-sensing operon. Furthermore, it is the apparent absence of
sufficient DctA that causes DctB-DctD to signal improperly when a
ligand for DctB is present. The ability of DctA to regulate DctB is
similar to its role in modifying the response of the dct operon to osmotic stress and succinate analogs.
The phenotype of strain RU150 is suppressed by chromosomal duplication of dctA. Strain RU150 was plated on succinate-ammonia agar in the absence of kanamycin, and after 3 to 5 days, spontaneous revertants which grew as well as strain 3841 were obtained. Revertant strains were classified on the basis of their ability to grow in the absence or presence of kanamycin as either primary- or second-site suppressor mutants, respectively. Transduction analysis of the second-site suppressor strains indicates that the reversion in strain RU152-22 is 100% cotransducible with Tn5, while it is unlinked to Tn5 in strains RU152-1 and RU152-14.
Southern blotting of genomic DNA from strains RU152-1, RU152-14, and RU150 with either IS50L (pRU75) or an internal fragment of Tn5 (pRU80) indicates that they contain a single EcoRI-hybridizing fragment of 6.7 kb (data not shown). Strain RU152-22 has a smaller band of approximately 6.3 kb, indicating that a deletion had occurred within Tn5. In addition, strains RU152-1 and RU152-14 contain second, smaller bands of 1.8 and 2.5 kb, respectively, which are homologous to IS50 but not to the central region of Tn5 (data not shown). The 1.8-kb DNA fragment that contains a second copy of IS50 in strain RU152-14 was amplified by inverse PCR and cloned. The 0.4-kb PCR product, which is the size of the flanking DNA minus IS50 (1.4 kb), has greater than 95% identity at the nucleotide level to the 5' end of dctA, up to the central EcoRI site. The sequence on the other side of the EcoRI site revealed no significant homology to any published sequences. Thus, in strain RU151-14, IS50L had transposed without internal Tn5 DNA, duplicating at least the 5' end of dctA. Chromosomal DNA from strains 3841, RU150, RU152-1, and RU152-14 was digested with SmaI, Southern blotted, and hybridized with dctA (pRU123), IS50L (pRU75), and a DNA fragment located immediately downstream of dctA (pRU402). All three probes gave two hybridizing bands in strains RU152-1 and RU152-14 but only one band in strain RU150, demonstrating that a complete copy of dctA had transposed in the suppressor strains (data not shown). To determine if the extra copy of dctA in strains RU152-1 and RU152-14 results in an increase in transcription, the levels of dctA mRNA from several strains were measured by Northern blotting. After induction with aspartate or succinate, strain 3841 had a 20-fold increase in dctA mRNA relative to the level in glucose-grown cells (Fig. 2). Moreover, strain 3841 grown on succinate-aspartate produced the highest levels of dctA mRNA, which is similar to the result obtained from lacZ fusion analysis of dctAp. Strain RU150 produced dctA mRNA constitutively, at a level higher than that in strain 3841 grown on glucose-ammonia. However, in accord with the lacZ analysis, it was approximately one-eighth of the level in strain 3841 grown on succinate or aspartate. Strains RU152-1 and RU152-14 also produced dctA mRNA constitutively, but the level was significantly elevated in comparison to that in strain RU150. Extra dctA mRNA is presumably made in these strains due to the presence of an extra copy of dctA. The levels of dctA mRNA produced in strains RU152-1 and RU152-14 were slightly different from each other and were 25 to 50% of that observed in strain 3841 grown on succinate-aspartate or glucose-aspartate. Therefore, strain RU150 is complemented for growth on succinate-ammonia either by the presence of dctA on a plasmid or by its duplication in the chromosome.
|
Mutation of dctB or dctD in strain RU150 restores normal growth. In order to map the location of the mutation in strain RU152-22, the 6.2-kb EcoRI fragment containing Tn5 was cloned from the chromosome into Bluescript II SK+ by selecting for kanamycin resistance (pRU93). Mapping revealed a 0.5-kb deletion, including the region between the intergenic SalI site and the first 300 bp of dctB, which removes the promoter and 5' end of dctB. This will prevent expression of DctB and presumably DctD, since it requires dctBp. Thus, DctB and DctD play a key role in preventing strain RU150 from using ammonia as a nitrogen source when succinate is the sole carbon source for growth.
To confirm this, a series of directed dctA, dctB, and dctD double mutants were constructed in strain RU150. Strain RU938 (RU150 dctA::
)
grew normally on glucose-ammonia and glucose-aspartate but did not grow
on succinate-ammonia or succinate-aspartate due to mutation of
DctA. Strains RU150, RU875 (RU150 dctB::
),
RU720 (RU150 dctD::
), and RU938 (RU150
dctBD::
) all grew on glucose-ammonia, glucose-aspartate, and succinate-aspartate. In contrast to strain RU150, the three double mutants also grew well on
succinate-ammonia. Thus, strain RU150 can be rescued for growth on
succinate-ammonia either by an increase in the transcription of
dctA or by mutation of dctB or dctD.
Plant properties.
Strain RU150 formed white nodules on
Vicia sativa. Plants inoculated with strain RU150 and grown
on nitrogen-free medium were yellow and did not reduce acetylene, while
strain 3841 reduced acetylene at 0.41 µmol h
1
plant
1. These data indicate that strain RU150 is unable
to fix nitrogen.
| |
DISCUSSION |
|---|
|
|
|---|
The data presented here confirm the results of previous studies showing that induction of dctAp requires DctB and DctD, while the dctB promoter is constitutive (6, 16, 35, 38, 46, 48). However, lacZ fusion analysis in this study clearly shows that dctD is transcribed from the dctB promoter. Our finding that the dctB promoter also drives expression of dctD is consistent with the translational start site of dctD being 5 bp downstream from the stop codon for dctB. This is in marked contrast to the conclusion of a previous study with S. meliloti Rm2011 that dctD has its own promoter, which is severalfold stronger than the dctB promoter (16). While this may be due to different levels of regulation in the two species, the fusion used to show that dctD has its own promoter in S. meliloti has a transposon located upstream of it in dctB. As with strain RU150 in this study, such an upstream transposon may provide an alternative promoter. In several studies, dctB mutants have been complemented with plasmids that do not contain intact copies of dctD, suggesting that dctD has its own promoter (46, 48). We have also complemented dctB mutants with plasmids lacking an intact dctD or complemented dctD mutants with plasmids containing insertions in dctB. However, these results are difficult to interpret because even weak plasmid or transposon promoters may cause sufficient transcription of a regulator protein such as DctD, which is presumably required only in very small amounts in the cell. Indeed, many of the complex allele-specific effects of chemical and transposon mutants of dctB may be caused by differential transcription of dctD, assuming that it normally uses the dctB promoter (24, 38, 46).
A key question regarding the regulation of expression of dctA concerns the relative roles of DctA and DctB. In the first study in which this was examined, R. leguminosarum CR534 (dctA::Tn5) had constitutive expression from a dctA-lacZ fusion in cells grown on glucose-ammonia (36). The level of expression of the dctA-lacZ fusion in strain CR534 was approximately one-half the level found in the wild type grown on succinate-ammonia. When this dctA strain was grown in the presence of succinate, a further twofold increase in transcription from dctAp was apparent. Thus, while expression from dctAp was deregulated in the absence of DctA, succinate increased the induction (36). In S. meliloti transcription from a plasmid-borne dctA-phoA translational fusion was constitutive in a dctA strain grown on glucose-ammonia (48). The levels were 20-fold higher than that in the wild type grown on glucose-ammonia and were double that in the wild type grown on succinate-ammonia. Transcription from dctAp in the dctA strain still increased by 25% after growth in the presence of succinate (48). It was also shown that constitutive expression from dctAp was dependent on DctB and DctD, as dctA dctB and dctA dctD double mutants had only background levels of transcription (48). In another study, a dctA-phoA fusion was constitutively expressed in a dctA strain at levels sixfold higher than those in the wild type grown on succinate-ammonia (16). This led to models in which DctB detects the presence of inducing ligands indirectly via the solute binding state of DctA. However, one study with S. meliloti showed that a chromosomal Tn5-lacZ fusion was not constitutive (2). It was also found that dctAp could be induced by osmotic stress and calcium limitation. We therefore reexamined this question with R. leguminosarum and found that dctAp remains inducible in a dctA strain. Most measurements were made by using a transcriptional lacZ fusion, but the same results were obtained with a translational phoA fusion to the S. meliloti dctA gene. Thus, the reported differences are not due to either the species or the type of fusion. Instead, dctAp becomes highly sensitive to induction in the absence of DctA. This can be seen in at least two different ways. Firstly, dctAp becomes sensitive to cross-induction by stimuli other than a dicarboxylate; an example of this is induction by osmotic stress. Secondly, the specificity for dicarboxylate ligands is much wider in a dctA strain, indicating that DctB is activated by a wider range of molecules (Table 4). It should be noted that DctB and DctD are needed for induction under all these conditions. Models requiring that DctB detect the solute binding state of DctA are not consistent with these data. Instead, DctB must act as a sensor for dicarboxylates, which is compatible with the presence of a large putative periplasmic loop having a ligand binding site. However, it is clear that DctA modifies either ligand binding or the signalling state of DctB. One possibility is that DctA interacts with DctB in the membrane and alters the conformation of DctB, changing its stereospecificity for ligand binding. An alternative is that the ligand binding stereospecificity of DctB is unaltered but that DctA alters the signalling ability of DctB. For example, DctA might interact with DctB, altering its relative kinase and phosphatase activities. There are numerous ways in which protein-protein interaction could do this, including altering the dimerization of DctB. The physiological and genetic approaches used in this study do not directly address the nature of the possible interaction between DctA and DctB. This would require a physical approach, which is made complex because both are integral membrane proteins. However, the possibility that DctA interacts with DctB and alters its proposed kinase or phosphatase activity might explain why in a dctA strain DctB and DctD cross-regulate heterologous operons (see below). It should be noted that while physical interaction between DctA and DctB is among the simplest explanations for these data, there is no direct evidence for this. The apparent contradictions in the literature regarding the inducibility of dctAp in a dctA strain may be due to the hypersensitivity of DctB-DctD in the absence of DctA, where even small differences in media and growth conditions can lead to apparent constitutive expression of dctA reporter fusions.
The isolation of strain RU150 allowed the importance of DctA in
regulation of DctB-DctD to be examined because it uncoupled expression
of DctA from DctB-DctD. In this strain expression of DctA is driven
from a putative transposon promoter where the transcription of
dctA is locked at a constitutive low level. This strain
shows wild-type transport rates for dicarboxylates, which indicates that the higher levels of transcription measured in the wild type may
not be needed to generate sufficient protein complex for transport. Consistent with this, it has been shown that in S. meliloti
fivefold overexpression of dctA from a trp
promoter does not result in an increase in the rate of succinate
transport (32). One possibility is that higher levels of
transcription of dctA increase the level of the DctA
protein, which is needed to regulate DctB. The locking of the level of
dctA transcription has a profound effect on signalling by
DctB-DctD. In this mutant, DctB-DctD still shows normal transcriptional control of a plasmid copy of a dctA-lacZ fusion. This
is important because it shows that the dicarboxylate-dependent
induction of phosphorylation of DctB-DctD still functions.
What is notable is that DctB-DctD now appears to cause improper
regulation of heterologous operons. Thus, when a dicarboxylate is
included in the growth medium, which will lead to phosphorylation of
DctD, strain RU150 is unable to grow properly unless an organic
nitrogen source is present. This effect is prevented by mutation of
either DctB or DctD, which, together with the requirement for the
presence of a dicarboxylate to prevent growth on ammonia, suggests that the improper regulation is caused by phosphorylated DctD. Increasing the level of transcription of dctA carried either by a
plasmid or by chromosomal duplication reestablishes proper control of DctB-DctD, enabling strain RU150 to grow on succinate-ammonia. Given
the conserved structure of
54-dependent activators, such
as DctD, NtrC, and NifA, it is not remarkable that DctD might be
capable of interfering with the regulation of other sensing operons.
Indeed, it has been shown several times before that transposon and
chemical mutants of the dct system can have complex
regulatory effects on other signalling systems (24, 38, 46).
We do not know what system is being interfered with in strain RU150;
however, the NtrC-dependent promoter for glnII was
apparently regulated normally in strain RU150 (33). An
important feature of this study is the demonstration that DctA has two
roles in the cell; the first is as a transport protein such that DctA
expressed constitutively in strain RU150 with a deletion in
dctB or dctD will transport and permit growth on
succinate. The second role appears to be regulation of DctB-DctD. While
it is not clear how DctA regulates DctB-DctD, we suggest above that DctA may modify the kinase or phosphatase activity of DctB. If DctB-DctD becomes more sensitive to phosphorylation in the absence of
DctA, then other stimuli, such as osmotic pressure, might cause activation of dctAp via cross talk. Increased sensitivity of
DctB-DctD to phosphorylation could cause excessive phosphorylated DctD
to improperly regulate other operons. Given the conserved structure of
regulators such as DctD, NtrC, and NifA, which may have arisen by gene
duplication, it is an interesting possibility that the unique product
of an operon may impose signalling specificity. In this context DctA
attenuates cross talk with other systems.
| |
ACKNOWLEDGMENTS |
|---|
We thank the University of Reading endowment trust for supporting this research.
We thank T. Finan for providing plasmid pTH2A.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: School of Animal and Microbial Sciences, University of Reading, Whiteknights, P.O. Box 228, Reading RG6 6AJ, United Kingdom. Phone: 44 118 9318895. Fax: 44 118 9316537. E-mail: p.s.poole{at}reading.ac.uk.
Present address: Institute of Molecular Medicine, University of
Oxford, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Arwas, R., I. A. McKay, F. R. P. Rowney, M. J. Dilworth, and A. R. Glenn. 1985. Properties of organic acid utilization mutants of Rhizobium leguminosarum strain 300. J. Gen. Microbiol. 131:2059-2066. |
| 2. | Batista, S., S. Castro, O. M. Aguilar, and G. Martinezdrets. 1992. Induction of C4-dicarboxylate transport genes by external stimuli in Rhizobium meliloti. Can. J. Microbiol. 38:51-55[Medline]. |
| 3. | Beringer, J. E. 1974. R factor transfer in Rhizobium leguminosarum. J. Gen. Microbiol. 84:188-198[Medline]. |
| 4. | Buchanan-Wollaston, V. 1979. Generalized transduction in Rhizobium leguminosarum. J. Gen. Microbiol. 112:135-142. |
| 5. | Engelke, T., M. N. Jagadish, and A. Pühler. 1987. Biochemical and genetical analysis of Rhizobium meliloti mutants defective in C4-dicarboxylate transport. J. Gen. Microbiol. 133:3019-3029. |
| 6. |
Engelke, T.,
D. Jording,
D. Kapp, and A. Pühler.
1989.
Identification and sequence analysis of the Rhizobium meliloti dctA gene encoding the C4-dicarboxylate carrier.
J. Bacteriol.
171:5551-5560 |
| 7. |
Finan, T. M.,
I. Oresnik, and A. Bottacin.
1988.
Mutants of Rhizobium meliloti defective in succinate metabolism.
J. Bacteriol.
170:3396-3403 |
| 8. |
Finan, T. M.,
J. M. Wood, and D. C. Jordan.
1983.
Symbiotic properties of C4-dicarboxylic acid transport mutants of Rhizobium leguminosarum.
J. Bacteriol.
154:1403-1413 |
| 9. | Giblin, L., J. Archdeacon, and F. Ogara. 1996. Modular structure of the Rhizobium meliloti DctB protein. FEMS Microbiol. Lett. 139:19-25[Medline]. |
| 10. | Glenn, A. R., P. S. Poole, and J. F. Hudman. 1980. Succinate uptake by free-living and bacteroid forms of Rhizobium leguminosarum. J. Gen. Microbiol. 119:267-271. |
| 11. |
Gu, B. H.,
J. H. Lee,
T. R. Hoover,
D. Scholl, and B. T. Nixon.
1994.
Rhizobium meliloti dctD, a 54-dependent transcriptional activator, may be negatively controlled by a subdomain in the C-terminal end of its two-component receiver module.
Mol. Microbiol.
13:51-66[Medline].
|
| 11a. | Gu, B. H., and B. T. Nixon. Unpublished data. |
| 12. |
Huala, E.,
J. Stigter, and F. M. Ausubel.
1992.
The central domain of Rhizobium leguminosarum DctD functions independently to activate transcription.
J. Bacteriol.
174:1428-1431 |
| 13. |
Jiang, J.,
B. Gu,
L. M. Albright, and B. T. Nixon.
1989.
Conservation between coding and regulatory elements of Rhizobium meliloti and Rhizobium leguminosarum dct genes.
J. Bacteriol.
171:5244-5253 |
| 14. | Johnston, A. W. B., and J. E. Beringer. 1975. Identification of the Rhizobium strains in pea root nodules using genetic markers. J. Gen. Microbiol. 87:343-350[Medline]. |
| 15. | Jording, D., and A. Pühler. 1993. The membrane topology of the Rhizobium meliloti C4-dicarboxylate permease (DctA) as derived from protein fusions with Escherichia coli K12 alkaline-phosphatase (PhoA) and beta-galactosidase (lacZ). Mol. Gen. Genet. 241:106-114[Medline]. |
| 16. |
Jording, D.,
P. K. Sharma,
R. Schmidt,
T. Engelke,
C. Uhde, and A. Pühler.
1992.
Regulatory aspects of the C4-dicarboxylate transport in Rhizobium meliloti transcriptional activation and dependence on effective symbiosis.
J. Plant Physiol.
141:18-27.
|
| 17. | Jording, D., C. Uhde, R. Schmidt, and A. Pühler. 1994. The C4-dicarboxylate transport-system of Rhizobium meliloti and its role in nitrogen-fixation during symbiosis with alfalfa (medicago-sativa). Experientia 50:874-883. |
| 18. | Krikos, A., N. Mutoh, A. Boyd, and M. I. Simon. 1983. Sensory transducers of Escherichia coli are composed of discrete structural and functional domains. Cell 33:615-622[Medline]. |
| 19. |
Labes, M.,
V. Rastogi,
R. Watson, and T. M. Finan.
1993.
Symbiotic nitrogen fixation by a nifA deletion mutant of Rhizobium meliloti: the role of an unusual ntrC allele.
J. Bacteriol.
175:2662-2673 |
| 20. |
Ledebur, H.,
B. Gu,
J. Sojda III, and B. T. Nixon.
1990.
Rhizobium meliloti and Rhizobium leguminosarum dctD gene products bind to tandem sites in an activation sequence located upstream of 54-dependent dctA promoters.
J. Bacteriol.
172:3888-3897 |
| 21. | Ledebur, H., and B. T. Nixon. 1992. Tandem DctD-binding sites of the Rhizobium meliloti dctA upstream activating sequence are essential for optimal function despite a 50-fold to 100-fold difference in affinity for DctD. Mol. Microbiol. 6:3479-3492[Medline]. |
| 22. |
Lee, J. H., and T. R. Hoover.
1995.
Protein cross-linking studies suggest that Rhizobium meliloti C4-dicarboxylic acid transport protein-d, a 54-dependent transcriptional activator, interacts with sigma(54)-subunit and the beta-subunit of RNA polymerase.
Proc. Natl. Acad. Sci. USA
92:9702-9706 |
| 23. |
Lee, J. H.,
D. Scholl,
B. T. Nixon, and T. R. Hoover.
1994.
Constitutive ATP hydrolysis and transcription activation by a stable, truncated form of Rhizobium meliloti DctD, a 54-dependent transcriptional activator.
J. Biol. Chem.
269:20401-20409 |
| 24. | Mavridou, A., M. A. Barny, P. Poole, K. Plaskitt, A. E. Davies, A. W. B. Johnston, and J. A. Downie. 1995. Rhizobium leguminosarum nodulation gene (nod) expression is lowered by an allele-specific mutation in the dicarboxylate transport gene dctB. Microbiology 141:103-111[Abstract]. |
| 25. | Miller, J. H. 1972. In Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 26. |
Park, C., and G. L. Hazelbauer.
1986.
Mutations specifically affecting ligand interaction of the Trg chemosensory transducer.
J. Bacteriol.
167:101-109 |
| 27. | Poole, P. S., A. Blyth, C. J. Reid, and K. Walters. 1994. myo-Inositol catabolism and catabolite regulation in Rhizobium leguminosarum bv viciae. Microbiology 140:2787-2795. |
| 28. | Poole, P. S., M. Franklin, A. R. Glenn, and M. J. Dilworth. 1985. The transport of L-glutamate by Rhizobium leguminosarum involves a common amino acid carrier. J. Gen. Microbiol. 131:1441-1448. |
| 29. | Poole, P. S., N. A. Schofield, C. J. Reid, E. M. Drew, and D. L. Walshaw. 1994. Identification of chromosomal genes located downstream of dctD that affect the requirement for calcium and the lipopolysaccharide layer of Rhizobium leguminosarum. Microbiology 140:2797-2809[Abstract]. |
| 30. | Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313[Medline]. |
| 31. | Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 127:15-21[Medline]. |
| 32. |
Rastogi, V.,
M. Labes,
T. Finan, and R. Watson.
1992.
Overexpression of the dctA gene in Rhizobium meliloti effect on transport of C4 dicarboxylates and symbiotic nitrogen fixation.
Can. J. Microbiol.
38:555-562[Medline].
|
| 33. | Reid, C. J. 1995. In Ph.D. thesis. University of Reading, Reading, United Kingdom. |
| 34. | Reid, C. J., D. L. Walshaw, and P. S. Poole. 1996. Aspartate transport by the Dct system in Rhizobium leguminosarum negatively affects nitrogen-regulated operons. Microbiology 142:2603-2612[Abstract]. |
| 35. | Ronson, C. W. 1988. Genetic regulation of C4-dicarboxylate transport in rhizobia, p. 547-551. In H. Bothe, F. J. Bruijn, and W. E. Newton (ed.), Nitrogen fixation: hundred years after. Gustav Fischer, New York, N.Y. |
| 36. | Ronson, C. W., and P. M. Astwood. 1985. Genes involved in the carbon metabolism of bacteroids, p. 201-207. In H. J. Evans, P. J. Bottomley, and W. E. Newton (ed.), Nitrogen fixation research progress. Martinus Nijhoff, Dordrecht, The Netherlands. |
| 37. |
Ronson, C. W.,
P. M. Astwood, and J. A. Downie.
1984.
Molecular cloning and genetic organization of C4-dicarboxylate transport genes from Rhizobium leguminosarum.
J. Bacteriol.
160:903-909 |
| 38. |
Ronson, C. W.,
P. M. Astwood,
B. T. Nixon, and F. M. Ausubel.
1987.
Deduced products of C4-dicarboxylate transport regulatory genes of Rhizobium leguminosarum are homologous to nitrogen regulatory gene products.
Nucleic Acids Res.
15:7921-7934 |
| 39. |
Ronson, C. W.,
P. Lyttleton, and J. G. Robertson.
1981.
C4-dicarboxylate transport mutants of Rhizobium trifolii form ineffective nodules on Trifolium repens.
Proc. Natl. Acad. Sci. USA
78:4284-4288 |
| 40. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. In Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 41. |
Scholl, D., and B. T. Nixon.
1996.
Cooperative binding of DctD to the dctA upstream activation sequence of Rhizobium meliloti is enhanced in a constitutively active truncated mutant.
J. Biol. Chem.
271:26435-26442 |
| 42. | Scholl, D., and T. Nixon. 1995. Cooperative binding of DctD to the dctA promoter region. Protein Eng. 8:75. |
| 43. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad-host-range mobilization system for in vivo genetic engineering: transposon mutagenesis of Gram-negative bacteria. Bio/Technology 1:784-791. |
| 44. | Walshaw, D. L., and P. S. Poole. 1996. The general L-amino acid permease of Rhizobium leguminosarum is an ABC uptake system that influences efflux of solutes. Mol. Microbiol. 21:1239-1252[Medline]. |
| 45. |
Wang, Y.-K., and T. R. Hoover.
1997.
Alterations within the activation domain of the 54-dependent activator DctD that prevent transcriptional activation.
J. Bacteriol.
179:5812-5819 |
| 46. | Watson, R. J. 1990. Analysis of the C4-dicarboxylate transport genes of Rhizobium meliloti: nucleotide sequence and deduced products of dctA, dctB and dctD. Mol. Plant-Microbe Interact. 3:174-181[Medline]. |
| 47. | Watson, R. J., V. K. Rastogi, and Y. K. Chan. 1993. Aspartate transport in Rhizobium meliloti. J. Gen. Microbiol. 139:1315-1323. |
| 48. | Yarosh, O. K., T. C. Charles, and T. M. Finan. 1989. Analysis of C4-dicarboxylate transport genes in Rhizobium meliloti. Mol. Microbiol. 3:813-823[Medline]. |
This article has been cited by other articles: