Previous Article | Next Article 
J Bacteriol, May 1998, p. 2723-2728, Vol. 180, No. 10
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Interactions between the Promoter Regions of
Nitrogenase Structural Genes (nifHDK2) and DNA-Binding
Proteins from N2- and Ammonium-Grown Cells of
the Archaeon Methanosarcina barkeri 227
Yueh-tyng
Chien,
John D.
Helmann, and
Stephen H.
Zinder*
Section of Microbiology, Cornell University,
Ithaca, New York 14853
Received 27 June 1997/Accepted 18 March 1998
 |
ABSTRACT |
Transcription initiation in Archaea (archaebacteria)
resembles the eucaryotic process, having been shown to involve TATA
box-like promoter regions as well as TATA-binding protein and TFIIB
homologs. However, little is known about transcription regulation in
archaea. We have previously demonstrated that transcripts of
nifHDK2 genes, encoding Methanosarcina barkeri
nitrogenase, are present in N2-grown cells but not in
ammonium-grown cells, indicating that nif transcription is
regulated by the nitrogen source. In this study, we detected proteins
in M. barkeri cell extracts that bind specifically to DNA
containing the putative promoter region of nifHDK2. No
binding was found when the promoter region was deleted from the DNA. A competition assay showed that the methyl coenzyme M reductase (mcr) promoter region DNA and the nifH2
promoter region DNA competed for a common factor(s). There was no
binding to the nifH2 promoter region by extracts of
ammonium-grown cells, but there was binding by these extracts to
promoter regions for mcr genes, which are presumably
constitutively expressed. Interestingly, extracts of ammonium-grown
cells inhibited binding to the nif promoter region by
extracts of N2-grown cells. Fractionation of extracts of
ammonium-grown cells with a heparin-Sepharose column resolved them into
a fraction eluting at 0 M NaCl, which inhibited binding by extracts of
N2-grown cells, and a fraction eluting at 0.5 to 0.75 M
NaCl, which showed binding to the promoter region. These results are
congruent with a model for regulation of nif gene
expression in M. barkeri in which a substance present in
ammonium-grown cells inhibits DNA binding by a transcription-associated
protein or proteins.
 |
INTRODUCTION |
It is becoming increasingly apparent
that the transcriptional apparatus of archaea (archaebacteria)
resembles the system in eucaryotes more than that in eubacteria. RNA
polymerases from archaea structurally and functionally resemble those
of eucaryotes, especially RNA polymerase II (23). Moreover,
a TATA box-like element with consensus sequence
5'-TTA(T/A)ATA-3' (32) is typically found ca.
25 bp upstream of archaeal transcription starts. No evidence of
eubacterium-like sigma factors or promoters in archaea has been found.
Instead, homologs of the TATA-binding protein (TBP) (27, 30,
33) and transcription factors TFIIB (10, 31) and TFIIS
(24) have been found in archaea. It has been shown that TBP
and TFIIB homologs (along with RNA polymerase and promoter DNA) are
sufficient for transcription initiation in a cell-free transcription
system (37) and that the Methanococcus jannaschii
genome contains open reading frames encoding TBP, TFIIB, and TFIIS
homologs (3), but no homologs of TFIIA have been found.
There have also been demonstrations of functional interactions between
archaeal and eucaryotic transcription apparatus components (30,
31, 33, 38).
Thus far the only DNA sequence element other than the TATA box and the
initiation site that has been found to promote transcription is a
purine-rich region usually (but not always) present directly upstream
of archaeal TATA box-like elements (29). Despite these advances, much remains to be learned about transcription and its initiation and regulation in archaea. The size and makeup of the archaeal transcription initiation complex is not known nor is the
potential role of upstream activators.
Evidence for regulation of the expression of some archaeal genes at the
level of transcription has accrued. Examples include carbon monoxide
dehydrogenase genes in Methanosarcina thermophila (36), heat shock genes in Haloferax volcanii
(22) and Methanosarcina mazei (9, 26),
and nitrogenase genes in methanogens (6, 35). An interesting
system in Halobacterium halobium regulates the synthesis of
the light-driven proton transporter bacteriorhodopsin (14).
In that system, the bat gene product is believed to be a
trans-acting inducer which responds to oxygen.
Interestingly, a 124-amino-acid stretch of this protein shows
significant similarity (30% identity, 56% similarity) to the N
terminus of the Klebsiella NifL protein, which is an
oxygen-sensing protein that inhibits NifA protein function in
eubacteria (17). In eubacteria, the sigma subunit of RNA
polymerase is essential for promoter recognition and transcriptional
initiation, and several alternative sigma factors have been reported
under different growth conditions (16). In contrast, no
factors involved in promoter selection, and thus transcription
specificity, have so far been identified in archaea.
Our previous results have shown that ammonium-grown cells of
Methanosarcina barkeri do not reduce acetylene to ethylene
(the standard assay for nitrogenase activity) or show bands
cross-reacting with the antibody to eubacterial component 2 in
immunoblots (25). Dot blot (6) and Northern blot
(7) hybridizations suggest that expression of the
nitrogenase structural genes was repressed by ammonium at the level of
transcription. Thus, expression of genes involved in nitrogen fixation,
an energetically costly process, is highly regulated. In this study, we
examined the binding of proteins to the TATA box (TATAAATA) promoter
region of nifHDK2 genes found upstream from the
transcription start site mapped by primer extension (see Fig. 1). This
promoter region contains a 7-bp purine-rich sequence upstream of the
TATA box. We also report here the presence of a substance in extracts
of ammonium-grown cells (ammonium-grown extracts) that inhibits binding
at the TATA box promoter region by the DNA-binding proteins.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
M. barkeri
227 (ATCC 43241, DSM 1538, and OCM 35) was obtained from our own
culture collection. M. barkeri Fusaro (OCM 83, ATCC 29787, and DSM 804) was purchased from the Oregon Collection of Methanogens.
Cells were grown under nitrogen-fixing conditions and in the presence
of ammonia, as described previously (6).
Preparation of crude extracts and protein samples from M. barkeri 227 for gel mobility shift assays.
Extracts of
N2-grown cells (N2-grown extracts) and
ammonium-grown extracts were prepared by loading the cells into a
French pressure cell (SLM Aminco, Urbana, Ill.), as described
previously (25). The cells were broken at 20,000 lb/in2, and the extract was collected in an
N2-flushed vial. Cell debris was removed by centrifugation
at 25,000 × g in 50-ml polypropylene tubes with screw
caps containing silicone rings (Nalge Co.) loaded inside the anaerobic
chamber. Crude extract was stored at
20°C.
A simple fractionation scheme was performed by running crude extract
through a heparin-Sepharose column (Pharmacia). The eluted fractions (0 M, 0 to 0.35 M, 0.35 to 0.6 M, and 0.6 to 1.0 M) were collected,
dialyzed, and concentrated before use. The ammonium-grown extract was
filtered through a 10,000-molecular-weight-cutoff Centricon-10
concentrator (Amicon Division, W. R. Grace and Co., Danvers,
Mass.). These preparations were used in the band shift assays.
Preparation of DNA for gel mobility shift assays.
DNA
fragments were amplified from M. barkeri chromosomal DNA by
PCR with two gene-specific primers. One of these primers was radioactively labeled with [
32P]dATP and T4
polynucleotide kinase (New England Biolabs). PCR fragments were
purified by the Promega Wizard PCR purification kit, according to the
manufacturer's instructions. Oligonucleotides Oligo 2 (5'-GCTCGCGAACAATGTCA-3') and Oligo nifH2
(TCCAATTCCCACCCTTTTCCG) were used to amplify a 165-bp DNA
fragment (Fig. 1), while Oligo 1 (ATACATAGTACAACGGTTACCGGC) and Oligo nifH2 were
used to amplify a 103-bp fragment. A DNA fragment (270 bp) containing
the promoter region for methyl coenzyme M reductase was prepared by PCR
from M. barkeri Fusaro chromosomal DNA by using
oligonucleotides Oligo MR1 (5'-TTTCGATCGATACGGTT-3') and
Oligo MR2 (5'-TGTCGTCGTAGATGTCT-3'). A nifH2 DNA
fragment (165 bp) containing the promoter region was amplified from
M. barkeri 227 by oligonucleotides Oligo 2 and Oligo
nifH2 (Fig. 1). These DNA fragments were used to compete with the end-labeled probe prepared as described previously.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
The 5' end and upstream region of nifH2 in
M. barkeri. *, transcription start site; Box A, archaeal
TATA box promoter; Pur Box, upstream purine-rich region; RBS, ribosome
binding site. Oligonucleotides used for PCR amplification of the
template DNAs are indicated by arrows.
|
|
Gel mobility shift assays.
Protein-DNA complexes were
resolved on low-ionic-strength polyacrylamide gels (12, 13).
Protein samples were incubated with approximately 5,000 cpm (0.3 ng) of
end-labeled double-stranded DNA fragments in the presence of 0.5 µg
of poly(dI-dC) · poly(dI-dC) (Pharmacia) in a final volume of 20 to 40 µl. In early experiments, 0.5 µg of calf thymus DNA (Sigma)
was used instead of poly(dI-dC) · poly(dI-dC), but better
results were obtained with the latter as nonspecific DNA. Incubations
were carried out on ice for 30 to 60 min in a solution of 10 mM
Tris-HCl (pH 7.6), 50 mM NaCl, 5% (vol/vol) glycerol, 1 mM EDTA, and 1 mM dithiothreitol. Samples were loaded onto low-ionic-strength 5%
(wt/vol) polyacrylamide gels (acrylamide-to-bisacrylamide weight ratio
of 37.5:1) which were preelectrophoresed for 1 h at 170 V in 1×
TBE buffer consisting of 8.9 mM Tris-HCl (pH 8.0), 8.9 mM boric acid,
and 2 mM EDTA. Gels were electrophoresed at 170 V at room temperature
until the bromophenol blue had run to the bottom of the gel. They were
then laid on top of Whatman 3MM paper, dried, and autoradiographed.
 |
RESULTS |
Detection of proteins that bind to the promoter region of
nifHDK2.
PCR was used to amplify the region upstream from
nifH2 (Fig. 1) with oligonucleotides Oligo 2 and Oligo
nifH2, producing a fragment 165 bp long. When Oligo 1 was
used in place of Oligo 2, a fragment 103 bp long and lacking the
promoter region was produced. These DNA fragments were then used as
substrates for band shift assays using crude extracts of M. barkeri cells grown with N2. As shown in Fig.
2A, extracts of N2-grown
cells contained factors binding to the fragment containing the promoter
region, thereby causing retardation of a fraction of the DNA, while no shifted bands were detected from the DNA fragment lacking the promoter
region.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Detection, by gel mobility shift assay, of binding to
the promoter region of nifH2 by proteins in a crude extract
from N2-grown M. barkeri. (A) Requirement of the
TATA box region for binding. Probe A (lanes 1 and 2) is a 165-bp
fragment amplified by PCR with oligonucleotides Oligo 2 and Oligo
nifH2 (Fig. 1) that contains the promoter region. Probe B
(lanes 3 and 4) is the 103-bp product of PCR amplification of
oligonucleotides Oligo 1 and Oligo nifH2 and lacks the TATA
box. Lanes 2 and 4 received 20 µg of crude protein extract. In each
assay, 0.5 µg of calf thymus DNA was added, and other conditions are
as described in Materials and Methods. (B) Effect of protein
concentration on shifting. Probe A was incubated with 0.5 µg of
poly(dI-dC) · poly(dI-dC) DNA and with 0, 2, 4, 8, 16, or 32 µg of protein extract per assay (lanes 1 through 6, respectively).
|
|
We examined the effect of protein concentration on the band shift
reaction and found that as little as 2 µg of crude extract
yielded
significant shifting of the DNA into two bands (Fig.
2B),
and 16 to 32 µg led to complete shifting into the slower-migrating
complex (other
preparations of cell extracts usually had lower
specific activities
than this one but gave similar results). These
observations suggest
that
M. barkeri extracts contain one or more
factors that
bind specifically to the
nifH promoter region. Whether
complexes I and II (Fig.
2) represent binding by two different
proteins
or binding at two sites by a single protein type is not
known. Since
nitrogenase genes are highly regulated by ammonium,
we also examined
the ability of ammonium-grown extracts to bind
to the
nifH2
promoter region. When up to 40 µg of protein from
ammonium-grown
extracts was used, no shifted bands were observed
with the
nifH2 promoter region (data not presented; also, see
Fig.
4B).
To characterize these DNA-binding proteins further, we employed a
simple fractionation scheme using a heparin-Sepharose column
(
15). We found, by using NaCl step gradients, that
DNA-binding
activity eluted maximally in the 0.35 to 0.6 M NaCl
fraction,
typical of many DNA-binding proteins, and that the DNA
shifted
by this fraction migrated similarly to complex II (data not
presented).
High protein concentrations from this fraction led to a
substantial
portion of the labeled DNA being retained in the sample
wells.
Specificity of proteins binding to the nifH2
promoter.
Binding occurred in the presence of nonspecific
competitors such as calf thymus DNA (Fig. 2A), poly(dI-dC) · poly(dI-dC) (Fig. 2B), and pBluescript (data not shown). To examine the
specificity of DNA binding to the nifH promoter further, we
also examined binding to the promoter region for genes encoding the
methyl coenzyme M reductase enzyme complex (mcr), which
carries out the final step in methanogenesis and is highly expressed
and presumably constitutive whether the cells are fixing N2
or not. Unfortunately, the mcr genes from strain 227 have
not been cloned so we used closely related M. barkeri
Fusaro, which has been sequenced (2) and for which the
upstream sequence TTTAAGTA has been proposed to be the
promoter.
A labeled PCR product containing the promoter region of the
mcr genes (270 bp) was used in gel shift assays to determine
whether
it would bind proteins in N
2-grown
M. barkeri extracts (Fig.
3A).
Proteins
bound to the
mcr promoter region at concentrations similar
to the
nifH2 promoter region and caused a shifted band. The
mcr promoter DNA was shifted by ammonium-grown
M. barkeri extracts
(Fig.
3B), while the
nifH2 promoter
region was not.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Band shift assays of labeled methyl coenzyme M reductase
(mcr) DNA and labeled nifH2 DNA by M. barkeri N2-grown and ammonium-grown extracts. The
binding reaction mixtures were as described in the legend to Fig. 2B
except that 0.3 ng of labeled nifH2 DNA was used in lanes 1 through 4 and 0.3 ng of labeled mcr DNA was used in lanes 5 through 8. (A) Lane 1, no protein (control); lane 2, 5 µg of
N2-grown extract; lane 3, 15 µg of N2-grown
extract; lane 4, 40 µg of N2-grown extract; lane 5, no
protein (control); lane 6, 5 µg of N2-grown extract; lane
7, 15 µg of N2-grown extract; lane 8, 40 µg of
N2-grown extract. (B) Lane 1, no protein (control); lane 2, 40 µg of ammonium-grown extract; lane 3, no protein (control); lane
4, 40 µg of ammonium-grown extract. Lanes 1 and 2 received 0.3 ng of
labeled nifH2 DNA, while lanes 3 and 4 received 0.3 ng of
labeled mcr extract.
|
|
We examined potential competition between the two promoter regions for
the DNA-binding proteins. Titration of the crude extracts
against a
constant amount of promoter-containing DNA fragment
(ca. 0.3 ng) gave a
clear shifting at ca. 60 µg of protein extract
(data not shown). This
quantity of crude extract was chosen for
the competition assays. The
competitions were performed by incubation
of
M. barkeri
crude extracts with the end-labeled
nifH2 promoter
and
increasing amounts of unlabeled
nifH2 and
mcr
promoter DNA.
The resulting protein-DNA complexes were resolved by gel
electrophoresis
(Fig.
4). Like the
nifH2 promoter (Fig.
4, lanes 2 through 6),
the
mcr promoter effectively competed with end-labeled
nifH2 DNA
fragment (Fig.
4, lanes 7 through 11), suggesting
that they are
competing for a common factor or factors.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 4.
Competition between the nifH2 promoter region
and the mcr promoter region from M. barkeri for
protein binding to the nifH2 promoter region. Various
amounts of unlabeled DNA fragments were added to a reaction mixture
containing 0.3 ng of labeled nifH2 promoter region DNA
before the extract was added. All binding reaction mixtures contained
60 µg of crude extract (except lane 1) and 0.5 µg of calf thymus
DNA. Reaction mixtures contained labeled nifH2 DNA plus
either no protein (NP) and unlabeled DNA (lane 1) or 0 (lane 2), 3 (lane 3), 10 (lane 4), 20 (lane 5), or 35 (lane 6) ng of an unlabeled
fragment containing the nifH2 promoter. Alternatively,
reaction mixtures contained 0 (lane 7), 3 (lane 8), 10 (lane 9), 20 (lane 10), 35 (lane 11) ng of an unlabeled fragment containing the
methyl coenzyme M reductase (mcr) promoter.
|
|
Detection of an inhibitor of binding of proteins to the
nifH2 promoter region in extracts of ammonium-grown
culture.
As described previously, up to 40 µg of extracts from
ammonium-grown cells showed no band shifting of DNA containing the
nifH2 promoter. This lack of binding may be due to any
number of reasons, including inactive extract. To investigate this
phenomenon further, we examined the effect of ammonium-grown extracts
on binding by N2-grown extracts. Adding as little as 1 µg
of protein from extracts from ammonium-grown cells to 20 µg of
protein from N2-grown cells led to complete inhibition of
band shifting (Fig. 5). Therefore, there
appears to be a substance present in ammonium-grown extracts that
inhibits binding of proteins to this DNA but not to mcr DNA. It is unlikely to be competing DNA, since one would not expect inhibition at 1/20 of the concentration used in that case (Fig. 4).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of protein binding to the nifH2
promoter region by extracts from ammonium-grown cells of M. barkeri. Binding reaction mixtures were as described in Materials
and Methods. The labeled nifH2 DNA fragment was incubated
with 20 µg of N2-grown extract and 0 (lane 1), 1 (lane
2), and 5 (lane 3) µg of ammonium-grown extract.
|
|
Ammonium-grown extracts were fractionated on a heparin-Sepharose column
(Fig.
6A). The pass-through fraction (0 M
NaCl) did
not bind DNA, while the 0.5 to 0.75 M NaCl fraction did bind
DNA
(Fig.
6B). We also tested these fractions from the
heparin-Sepharose
column derived from ammonium-grown extracts for the
ability to
inhibit DNA binding by N
2-grown crude extracts
(Fig.
6C). The
0 M NaCl flowthrough fraction was capable of inhibiting
that binding,
suggesting that an inhibitor was present in that
fraction. Some
inhibitory activity may be also present in the 0.25 to
0.5 M NaCl
fraction.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Heparin-Sepharose fractionation of extracts from
ammonium-grown cells of M. barkeri. (A) Fractionation scheme
of ammonium-grown extracts. The band-shifting and inhibitory activities
of the fractions are indicated by + or . Binding reaction
mixtures were as described in Materials and Methods. (B and C) DNA
binding (B) and inhibition of DNA binding (C) by N2
extracts by different fractions of ammonium-grown extracts. Each
reaction mixture contained 40 µg of a heparin-Sepharose fraction; in
addition, 60 µg of N2 extract was used in panel C. Lanes:
1, 0 M NaCl; 2, 0.25 M NaCl; 3, 0.5 M NaCl; 4, 0.75 M NaCl.
|
|
We speculated that the inhibitor present in the flowthrough fraction
might be a low-molecular-weight intermediate in the
NH
4+ assimilation pathway. We used band shift
assays to test the inhibitory
activities of small molecules that are
the intermediates of the
ammonium assimilation pathway, including
glutamine, glutamic acid,
and ammonia. However, none of these
molecules, alone or together,
showed any inhibitory activity when added
at a concentration up
to 50 mM (data not shown). We also found that the
inhibitor did
not pass through a 10,000-molecular-weight-cutoff
Centricon-10
concentrator. Therefore, we suggest that the inhibitor is
a protein.
 |
DISCUSSION |
Using band shift mobility assays, we demonstrated the presence of
proteins in extracts of N2-grown M. barkeri that
bind specifically to the promoter region of nifH2 (Fig. 1).
The specificity of this interaction is supported by several lines of
evidence: (i) binding to the DNA was not inhibited by various
nonspecific sources of DNA, such as poly(dI-dC) · poly(dI-dC) or
calf thymus DNA; (ii) binding to the labeled DNA was inhibited by
unlabeled DNA containing this promoter region; (iii) there was no
binding to the DNA fragment produced by PCR amplification with
oligonucleotides Oligo 1 and Oligo nifH2, which lacked the
promoter region; and (iv) binding was not detected with extracts from
ammonium-grown cells, while there was binding by these extracts to the
mcr promoter region.
The appearance of slower-migrating bands with increasing extract
concentrations (Fig. 2) in band shift assays using a DNA fragment
containing the promoter region indicates successive binding to the site
by more than one protein molecule per DNA molecule. There can be more
than one protein binding at each step, and the proteins could be the
same or different from each other. Likely candidates for part of the
DNA-binding protein complex in M. barkeri are TBP and TFIIB
homologs, both of which have been found in archaea (10, 31).
The TBP typically binds as a monomer, as it contains two nearly
identical domains (21, 27). We recently cloned the gene
encoding a TBP homolog from M. barkeri (5) and
are presently working to overexpress an active form for use in further experiments.
We detected no proteins binding to the nifH promoter region
in ammonium-grown extracts. That these ammonium-grown extracts are able
to shift the mcr promoter region demonstrates that this lack
of binding was specific and not just an artifact of a low-potency extract. The lack of binding to the nifH promoters by
extracts of ammonium-grown cells could be due to the lack of specific
binding proteins or the presence of a binding inhibitor. Our evidence supports the latter possibility, since as little as 1 µg of
ammonium-grown extract inhibited binding by 20 µg of
N2-grown extract. Moreover, when fractionated on a
heparin-Sepharose column, most of the inhibitory activity was obtained
in the pass-through fraction while a fraction eluting at higher salt
concentrations showed the ability to bind to the nifH
promoter region, indicating that the ability to bind that promoter is
present in the ammonium-grown cells but is inhibited under those
conditions. That several small molecules (ammonia, glutamate, or
glutamine) often used as cellular signals of nitrogen sufficiency
(19) did not inhibit DNA binding by N2-grown
extracts, and that this inhibitory activity was retained by a 10,000 molecular-weight-cutoff filter, suggests that the inhibitor is a
protein, but more characterization is needed.
To determine whether the nif promoter region has binding
proteins in common with other promoters, we performed competition assays, using the promoter region from a closely related M. barkeri strain, of the methyl coenzyme M reductase
(mcr) genes; these genes encode the central enzyme in
methanogenesis, which would presumably be constitutively and highly
expressed in the presence of ammonia or under nitrogen-fixing
conditions. A DNA fragment harboring this promoter region was readily
shifted with extracts from strain 227 (Fig. 3A). Thus, the
mcr promoter region readily competed with the
nifH promoter for some common part of the transcription initiation machinery (Fig. 4), most likely including the TBP and TFIIB
homologs. While the mcr and nifH2 promoter
regions compete for DNA-binding proteins, there are clearly differences
between them since, in contrast to the nifH2 promoter
region, binding to the mcr region occurred in ammonium-grown
cells. This phenomenon is difficult to explain as simple binding to a
TBP-TFIIB initiation complex and suggests the presence of a protein
providing nifH2 specificity, which would potentially
interact with the proposed ammonium-growth-specific inhibitor. Such an
inhibitor also might bind directly to the TBP or TFIIB.
We had anticipated binding by a repressor in ammonium-grown cells to be
the mechanism of ammonia repression, but we failed to find evidence for
this (Fig. 4). Indeed, Cohen-Kupec et al. (8) have
demonstrated that ammonia repression of nitrogen fixation in the
archaeon Methanococcus maripaludis involves repressor
binding to a palindromic site associated with the transcription start of the structural nif genes from that organism. We have not
found a similar site associated with the nifH2 transcription
start, or elsewhere downstream of the promoter area, in M. barkeri. It is not surprising to find that these two methanogens
have different mechanisms for regulation of transcription of their
nif genes, since the evolutionary distance between them is
comparable to that between Klebsiella pneumoniae and
Clostridium pasteurianum (39), which also have
different mechanisms of regulation (4).
The proposed mechanism of transcription inhibition in ammonium-grown
cells does have precedents. For example, the proto-oncogene product p53
(34) in eucaryotes can inhibit TBP function by binding to
it, although its binding appears to be at the amino terminus of the
TBP, which is not involved in DNA binding (18). Other examples of negative regulators in eucaryotes have also been reported (1, 11, 20, 28). Dr1 binds to TBP and thereby inhibits both
basal and activated transcription by preventing interaction of TFIIA
and TFIIB with TBP (20); Dr2 interacts with TBP and represses basal transcription (28); and Mot1 (AD1), a global repressor of RNA polymerase II transcription, inhibits TBP binding to
DNA by an ATP-dependent mechanism (1). To prove or disprove aspects of this model, we are presently attempting to purify and characterize the DNA-binding proteins and the putative inhibitor protein.
 |
ACKNOWLEDGMENTS |
This research was supported by grant DE-FG02-85ER13370 from the
U.S. Department of Energy and by USDA Hatch funds.
We thank J. P. Shapleigh for helpful advice and for sharing his
facilities with us.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Section of
Microbiology, Wing Hall, Cornell University, Ithaca, NY 14853-8101. Phone: (607) 255-2415. Fax: (607) 255-3904. E-mail:
shz1{at}cornell.edu.
 |
REFERENCES |
| 1.
|
Auble, D. T.,
K. E. Hansen,
C. G. F. Mueller,
W. S. Lane,
J. Thorner, and S. Hahn.
1994.
Mot1, a global repressor of RNA polymerase II transcription, inhibits TBP binding to DNA by an ATP-dependent mechanism.
Genes Dev.
8:1920-1934[Abstract/Free Full Text].
|
| 2.
|
Bokranz, M., and A. Klein.
1987.
Nucleotide sequence of the methyl coenzyme M reductase gene cluster from Methanosarcina barkeri.
Nucleic Acids Res.
15:4350-4351[Free Full Text].
|
| 3.
|
Bult, C. J.,
O. White,
G. J. Olsen,
L. Zhou,
R. D. Fleischmann,
G. G. Sutton,
J. A. Blake,
L. M. FitzGerald,
R. A. Clayton,
J. D. Gocayne,
A. R. Kerlavage,
B. A. Dougherty,
J.-F. Tomb,
M. D. Adams,
C. I. Reich,
R. Overbeek,
E. F. Kirkness,
K. G. Weinstock,
J. M. Merrick,
A. Glodek,
J. L. Scott,
N. S. M. Geoghagen,
J. F. Weidman,
J. L. Fuhrmann,
D. Nguyen,
T. R. Utterback,
J. M. Kelley,
J. D. Peterson,
P. W. Sadow,
M. C. Hanna,
M. D. Cotton,
K. M. Roberts,
M. A. Hurst,
B. P. Kaine,
M. Borodovsky,
H.-P. Klenk,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1996.
Complete genome sequence of the methanogenic archaeon Methanococcus jannaschii.
Science
273:1058-1073[Abstract].
|
| 4.
|
Chen, J.-S.,
S.-Z. Wang, and J. L. Johnson.
1990.
Nitrogen fixation genes in Clostridium pasteurianum, p. 483-490.
In
P. M. Grasshoff, L. E. Roth, G. Stacey, and W. E. Newton (ed.), Nitrogen fixation: achievements and objectives. Chapman and Hall, London, England.
|
| 5.
|
Chien, Y. T.,
A. D. Brabban, and S. H. Zinder.
1997.
Cloning and functional analysis of the gene encoding TATA-binding protein in the archaeon Methanosarcina barkeri 227, abstr. I-51, p. 330.
In
Abstracts of the 97th General Meeting of the American Society for Microbiology. American Society for Microbiology, Washington, D.C.
|
| 6.
|
Chien, Y.-T., and S. H. Zinder.
1994.
Cloning, DNA sequencing, and characterization of a nifD-homologous gene from the archaeon Methanosarcina barkeri 227 which resembles nifD1 from the eubacterium Clostridium pasteurianum.
J. Bacteriol.
176:6590-6598[Abstract/Free Full Text].
|
| 7.
|
Chien, Y.-T., and S. H. Zinder.
1996.
Cloning, functional organization, transcript studies, and phylogenetic analysis of the complete nitrogenase structural genes (nifHDK2) and associated genes in the archaeon Methanosarcina barkeri 227.
J. Bacteriol.
178:143-148[Abstract/Free Full Text].
|
| 8.
|
Cohen-Kupec, R.,
C. Blank, and J. H. Leigh.
1997.
Transcriptional regulation in Archaea: in vivo demonstration of a repressor binding site in a methanogen.
Proc. Natl. Acad. Sci. USA
94:1316-1320[Abstract/Free Full Text].
|
| 9.
|
Conaway, R. C., and J. W. Conaway.
1993.
General initiation factors for RNA polymerase II.
Annu. Rev. Biochem.
62:161-190[Medline].
|
| 10.
|
Creti, R.,
P. Londei, and P. Cammarano.
1993.
Complete nucleotide sequence of an archaeal (Pyrococcus woesei) gene encoding a homolog of eukaryotic transcription factor IIB (TFIIB).
Nucleic Acids Res.
21:2942[Free Full Text].
|
| 11.
|
Drapkin, R.,
A. Merino, and D. Reinberg.
1993.
Regulation of RNA polymerase II transcription.
Curr. Opin. Cell Biol.
5:469-476[Medline].
|
| 12.
|
Fried, M., and D. M. Crothers.
1981.
Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis.
Nucleic Acids Res.
9:6505-6525[Abstract/Free Full Text].
|
| 13.
|
Garner, M. M., and A. Revzin.
1981.
A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: application to components of the Escherichia coli lactose operon regulatory system.
Nucleic Acids Res.
9:3047-3060[Abstract/Free Full Text].
|
| 14.
|
Gropp, F., and M. C. Betlach.
1994.
The bat gene of Halobacterium halobium encodes a trans-acting oxygen inducibility factor.
Proc. Natl. Acad. Sci. USA
91:5475-5479[Abstract/Free Full Text].
|
| 15.
|
Hausner, W., and M. Thomm.
1993.
Purification and characterization of a general transcription factor, aTFB, from the archaeon Methanococcus thermolithotrophicus.
J. Biol. Chem.
268:24047-24052[Abstract/Free Full Text].
|
| 16.
|
Helmann, J. D.
1994.
Bacterial sigma factors, p. 1-17.
In
R. C. Conaway, and J. Conaway (ed.), Transcription: mechanisms and regulation. Raven Press, New York, N.Y.
|
| 17.
|
Hill, S.,
S. Austin,
T. Eydmann,
T. Jones, and R. Dixon.
1996.
Azotobacter vinelandii NifL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation genes via a redox-sensitive switch.
Proc. Natl. Acad. Sci. USA
93:2143-2148[Abstract/Free Full Text].
|
| 18.
|
Horikoshi, N.,
A. Usheva,
J. Chen,
A. J. Levine,
R. Weinmann, and T. Schenk.
1995.
Two domains of p53 interact with the TATA-binding protein, and the adenovirus 13S E1A protein disrupts the association, relieving p53-mediated transcriptional repression.
Mol. Cell. Biol.
15:227-234[Abstract].
|
| 19.
|
Ikeda, T. P.,
A. E. Shauger, and S. Kustu.
1996.
Salmonella typhimurium apparently perceives external nitrogen limitation as internal glutamine limitation.
J. Mol. Biol.
259:589-607[Medline].
|
| 20.
|
Inostroza, J. A.,
F. H. Mermelstein,
I. H. Ha,
W. S. Lane, and D. Reinberg.
1992.
Dr1, a TATA-binding protein-associated phosphoprotein and inhibitor of class II transcription.
Cell
70:477-489[Medline].
|
| 21.
|
Kim, J. L.,
D. B. Nikolov, and S. K. Burley.
1993.
Co-crystal structure of TBP recognizing the minor groove of a TATA element.
Nature
365:520-527[Medline].
|
| 22.
|
Kuo, Y.-P.,
D. K. Thompson,
A. St. Jean,
R. L. Charlebois, and C. J. Daniels.
1997.
Characterization of two heat shock genes from Haloferax volcanii: a model system for transcription regulation in the Archaea.
J. Bacteriol.
179:6318-6324[Abstract/Free Full Text].
|
| 23.
|
Langer, D.,
H. Johannes,
P. Thuriaux, and W. Zillig.
1995.
Transcription in Archaea: similarity to that in Eucarya.
Proc. Natl. Acad. Sci. USA
92:5768-5772[Abstract/Free Full Text].
|
| 24.
|
Langer, S. D., and W. Zillig.
1993.
Putative TFIIS gene of Sulfolobus acidocaldarius encoding an archaeal transcription elongation factor is situated differently downstream of the gene for a small subunit of DNA-dependent RNA polymerase.
Nucleic Acids Res.
21:2251[Free Full Text].
|
| 25.
|
Lobo, A. L., and S. H. Zinder.
1990.
Nitrogenase in the archaebacterium Methanosarcina barkeri 227.
J. Bacteriol.
172:6789-6796[Abstract/Free Full Text].
|
| 26.
|
Macario, A. J. L.,
C. B. Dugan, and E. C. D. Macario.
1991.
A dnaK homolog in the archaebacterium Methanosarcina mazei S6.
Gene
108:133-137[Medline].
|
| 27.
|
Marsh, T. L.,
C. I. Reich,
R. B. Whitelock, and G. J. Olsen.
1994.
Transcription factor IID in the Archaea: sequences in the Thermococcus celer genome would encode a product closely related to the TATA-binding protein of eucaryotes.
Proc. Natl. Acad. Sci. USA
91:4180-4184[Abstract/Free Full Text].
|
| 28.
|
Merino, A.,
K. R. Madden,
W. S. Lane,
J. J. Champoux, and D. Reinberg.
1993.
DNA topoisomerase I is involved in both repression and activation of transcription.
Nature
365:227-232[Medline].
|
| 29.
|
Palmer, J. R., and C. J. Daniels.
1995.
In vivo definition of an archaeal promoter.
J. Bacteriol.
177:1844-1849[Abstract/Free Full Text].
|
| 30.
|
Qureshi, S. A.,
P. Baumann,
T. Rowlands,
B. Khoo, and S. P. Jackson.
1995.
Cloning and functional analysis of the TATA-binding protein from Sulfolobus shibatae.
Nucleic Acids Res.
23:1775-1781[Abstract/Free Full Text].
|
| 31.
|
Qureshi, S. A.,
B. Khoo,
P. Baumann, and S. P. Jackson.
1995.
Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.
Proc. Natl. Acad. Sci. USA
92:6077-6081[Abstract/Free Full Text].
|
| 32.
|
Reeve, J. N.
1992.
Molecular biology of methanogens.
Annu. Rev. Microbiol.
46:165-191[Medline].
|
| 33.
|
Rowlands, T.,
P. Baumann, and S. P. Jackson.
1994.
The TATA-binding protein: a general transcription factor in eucaryotes and archaebacteria.
Science
264:1326-1329[Abstract/Free Full Text].
|
| 34.
|
Seto, E.,
A. Usheva,
G. P. Zambetti,
J. Momand,
N. Horikoshi,
R. Weinmann,
A. J. Levine, and T. Shenk.
1992.
Wild-type p53 binds to the TATA-binding protein and represses transcription.
Proc. Natl. Acad. Sci. USA
89:12028-12032[Abstract/Free Full Text].
|
| 35.
|
Souillard, N., and L. Sibold.
1989.
Primary structure, functional organization and expression of nitrogenase structural genes of the thermophilic archaebacterium Methanococcus thermolithotrophicus.
Mol. Microbiol.
3:541-551[Medline].
|
| 36.
|
Sowers, K. R.,
T. T. Thai, and R. P. Gunsalus.
1993.
Transcriptional regulation of the carbon monoxide dehydrogenase gene (cdhA) in Methanosarcina thermophila.
J. Biol. Chem.
268:23172-23178[Abstract/Free Full Text].
|
| 37.
|
Thomm, M.
1996.
Archaeal transcription factors and their role in transcription initiation.
FEMS Microbiol. Rev.
18:159-171[Medline].
|
| 38.
|
Wettach, J.,
H. P. Gohl,
H. Tschochner, and M. Thomm.
1995.
Functional interaction of yeast and human TATA-binding proteins with an archaeal RNA polymerase and promoter.
Proc. Natl. Acad. Sci. USA
92:472-476[Abstract/Free Full Text].
|
| 39.
|
Woese, C. R.
1987.
Bacterial evolution.
Microbiol. Rev.
51:221-271[Free Full Text].
|
J Bacteriol, May 1998, p. 2723-2728, Vol. 180, No. 10
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cabello, P., Roldan, M. D., Moreno-Vivian, C.
(2004). Nitrate reduction and the nitrogen cycle in archaea. Microbiology
150: 3527-3546
[Abstract]
[Full Text]
-
Ehlers, C., Grabbe, R., Veit, K., Schmitz, R. A.
(2002). Characterization of GlnK1 from Methanosarcina mazei Strain Go1: Complementation of an Escherichia coli glnK Mutant Strain by GlnK1. J. Bacteriol.
184: 1028-1040
[Abstract]
[Full Text]
-
Arcondeguy, T., Jack, R., Merrick, M.
(2001). PII Signal Transduction Proteins, Pivotal Players in Microbial Nitrogen Control. Microbiol. Mol. Biol. Rev.
65: 80-105
[Abstract]
[Full Text]
-
Enoru-Eta, J., Gigot, D., Thia-Toong, T.-L., Glansdorff, N., Charlier, D.
(2000). Purification and Characterization of Sa-Lrp, a DNA-Binding Protein from the Extreme Thermoacidophilic Archaeon Sulfolobus acidocaldarius Homologous to the Bacterial Global Transcriptional Regulator Lrp. J. Bacteriol.
182: 3661-3672
[Abstract]
[Full Text]
-
Kessler, P. S., Leigh, J. A.
(1999). Genetics of Nitrogen Regulation in Methanococcus maripaludis. Genetics
152: 1343-1351
[Abstract]
[Full Text]
-
BELL, S.D., JACKSON, S.P.
(1998). Transcription in Archaea. Cold Spring Harb Symp Quant Biol
63: 41-52
[Abstract]