Department of Biological Sciences, Northern
Illinois University, DeKalb, Illinois 60115
A key reaction in the biosynthesis of menaquinone involves the
conversion of the soluble bicyclic naphthalenoid compound
1,4-dihydroxy-2-naphthoic acid (DHNA) to the membrane-bound
demethylmenaquinone. The enzyme catalyzing this reaction,
DHNA-octaprenyltransferase, attaches a 40-carbon side chain to DHNA.
The menA gene encoding this enzyme has been cloned and
localized to a 2.0-kb region of the Escherichia coli genome
between cytR and glpK. DNA sequence analysis of
the cloned insert revealed a 308-codon open reading frame (ORF), which by deletion analyses was shown to restore anaerobic growth of a
menA mutant. Reverse-phase high-performance liquid
chromatography analysis of quinones extracted from the
orf-complemented cells independently confirmed the
restoration of menaquinone biosynthesis, and similarly, analyses of
isolated cell membranes for DHNA octaprenyltransferase activity
confirmed the introduction of the menA product into the orf-complemented menA mutant. The validity of
an ORF-associated putative promoter sequence was confirmed by primer
extension analyses.
 |
TEXT |
Menaquinone (MK; vitamin
K2) plays an essential role in several anaerobic electron
transport systems. It is the major electron carrier during anaerobic
growth with various electron acceptors (10). The genetics,
biochemistry, and molecular biology of its biosynthetic pathway have
been recently reviewed (12). Six genes, designated
menA, -B, -C, -D,
-E, and -F, have been implicated in the
biosynthesis of MK from chorismate and 2-ketoglutarate. Five of these,
menB, -C, -D, -E, and
-F, all clustered at 51 min on the Escherichia
coli chromosome, are responsible for the conversion of chorismate
and 2-ketoglutarate to the soluble naphthalenoid aromatic compound
1,4-dihydroxy-2-naphthoic acid (DHNA) (12). In a subsequent
reaction, the DHNA is attached to the membrane-bound octaprenylpyrophosphate and results in the formation of
demethylmenaquinone (DMK). This latter step, prior to the
methylation of DMK to MK, is under the control of menA,
located at 88 min on the E. coli chromosome (12).
In 1975, Bentley (3) demonstrated that cell-free extracts of
E. coli can convert DHNA in the presence of farnesyl
pyrophosphate and Mg2+ to MK-3 and/or DMK-3. In a
subsequent investigation, Shineberg and Young (21) showed
that crude membranes of E. coli can carry out this reaction
in the presence of either the synthetic compound solanesyl
pyrophosphate or the natural octaprenyl pyrophosphate. Shineberg and
Young named the enzyme 1,4-dihydroxy-2-naphthoate octaprenyltransferase and showed that the menA mutants
lacked this enzyme (21).
The conversion of DHNA to DMK proceeds in three stages as summarized in
Fig. 1. These stages are the removal of
the carboxyl group of DHNA as CO2, the attachment of the
isoprenoid side chain, and a quinol-to-quinone oxidation, which is
thought to be spontaneous (4).
In this study, we have cloned, sequenced, and identified the
menA open reading frame (ORF) encoding the
octaprenyltransferase.
(A preliminary communication of some of these findings has been
published previously [22]).
Bacterial strains and growth conditions.
The strains of
E. coli and the primary plasmids used are listed in Table
1. Other plasmids constructed in this
study are shown in Fig. 2.
Complementation of the menA mutant with plasmids was
performed, as previously described (17, 20), by anaerobic growth on glycerol minimal medium with trimethylamine
N-oxide (TMAO) as an electron acceptor (7). Cells
for the isolation of quinones and membranes were grown anaerobically in
2-liter Erlenmeyer flasks with screw caps filled to the top with
minimal medium (14) containing glucose as the carbon source.
For anaerobic growth of the menA mutant, the glucose minimal
medium was supplemented with 5 µg of uracil per ml (15).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 2.
The menA plasmids. pMK2 was constructed by
insertion into pUC18 of a 2.0-kb PstI fragment derived from
pLC28-47; pMK3 has an EcoRV fragment deletion of pMK2; pMK4
contains only the EcoRV fragment of pMK2; and pMK5 and pMK6
contain the 0.5- and 1.5-kb HindIII/PstI
fragments of pMK2, respectively. Complementation was assayed by
anaerobic growth on glycerol medium with TMAO as the electron acceptor.
B, BglII; D, HindIII; E, EcoRI; H,
HincII; P, PstI; V, EcoRV.
|
|
DNA and RNA isolation and construction of plasmids.
Plasmid
DNAs were isolated by the alkaline lysis procedure of Birnboim and Doly
(5) and then purified in ethidium bromide-CsCl gradients.
Total RNA from E. coli PL2024 cells was isolated as previously described (2). Cells for RNA isolation were grown either aerobically or anaerobically in Luria-Bertani medium
supplemented with 10 mM glucose.
Plasmids used in this study contained inserts derived from plasmid
pLC28-47 (16) and subcloned into pUC18. DNA fragments for
cloning were electroeluted from 0.7% agarose gel slices, ligated, and
transformed as previously described (17, 20). The host for
initial transformation was either HB101 or JM83.
DNA sequencing and sequence analysis.
DNA sequence was
determined by the dideoxynucleotide chain termination method
(19) with the Sequenase 2.0 kit from Amersham Corp.
(Arlington Heights, Ill.) and [
-32P]dATP (ICN, Costa
Mesa, Calif.). Compressed regions were resolved with 7-deaza-dGTP.
Sequencing reactions were primed with universal, reverse, and
sequence-generated synthetic oligonucleotide primers synthesized on an
Applied Biosystems (Foster City, Calif.) 391 DNA synthesizer. All
sequences were confirmed by sequencing of the complementary strand.
Nucleic acid and deduced protein sequences were analyzed with Pustell
(IBI, New Haven, Conn.) and PC/Gene (Intelligenetics, Mountain View,
Calif.) sequence analysis software.
Primer extensions.
Primer extensions were performed with the
AMV reverse transcriptase primer extension system (Promega, Madison,
Wis.). The manufacturer's suggestions were followed, but the following
modifications were made. After the completion of the primer extension
reactions, the RNA-cDNA mixture was ethanol precipitated, and the
pellet was washed twice with 70% ethanol and resuspended in 3 µl of
diethyl pyrocarbonate-treated water. Following the addition of 1 µl
of loading dye, the solution was heated to 90°C for 2 min and
analyzed on 6% polyacrylamide sequencing gels. Equal quantities of
anaerobically or aerobically produced total RNA (as determined
spectrophotometrically) were used for the appropriate assays.
Accompanying DNA sequence ladders were generated with the Amersham
Corp.
Taq cycle sequencing kit according to the
manufacturer's directions.
Isolation and identification of MK and DMK by RPHPLC.
The
isolation of quinones from cells was done with the chloroform-methanol
technique of Bligh and Dyer (6). Approximately 2 g of
wet cells was extracted with 25 ml of chloroform-methanol (2:1
[vol/vol]) for 3 h by constant stirring over a magnetic stirrer. The mixture was filtered through Whatman no. 1 filter paper to remove
cell debris, and the filtrate was collected in a conical flask and
dried under reduced pressure at 40°C in a rotary evaporator (13). The lipid extract was resuspended in a small volume of hexane and passed through a Sep-Pak silicon cartridge (Waters, Bedford,
Mass.) to remove contaminating lipids. The cartridge was eluted with
hexane-diethylether (96:4 [vol/vol]). The elutant was collected,
dried under a stream of N2, and suspended in 20 µl of
acetone. Five microliters was typically injected into the column for
the identification of quinones. Extreme care was taken to minimize
exposure to light at all stages. The separation and analysis of
quinones were performed on a Waters 670 liquid chromatograph equipped
with a Zorbax ODS prepacked (250 by 4.6 mm in diameter) reverse-phase
high-performance liquid chromatography (RPHPLC) column (Chrompack Inc.,
Raritan, N.J.). Samples were eluted with methanol-isopropylether (3:1 [vol/vol]) at 0.8 ml/min. The
quinones were detected with a UV detector at 245 nm. Menaquinones with 3 and 8 isoprene units (MK-3 and MK-8) were used as standards.
Isolation of membranes and assay of DHNA
octaprenyltransferase.
Anaerobically grown cultures were harvested
at late log phase by centrifugation at 3,000 × g for
10 min. The pellet was washed once by resuspension in 200 ml of 50 mM
potassium phosphate buffer (pH 7.0) and recentrifuged. Each gram of
washed pellet was resuspended in 1.5 ml of 50 mM potassium phosphate
buffer (pH 7.0) containing 5 mM 2-mercaptoethanol and then passed twice
through a French pressure cell at 15,000-20,000 lb/in2 at
4°C. A small amount of DNase was added to reduce viscosity. The
extract was centrifuged for 30 min at 3,000 × g, and
the supernatant was further centrifuged at 150,000 × g
in a swinging bucket rotor (AH650 in a Sorval RC 70 ultracentrifuge)
for 3 h at 4°C. The pellet was washed once by resuspension and
centrifugation for a further 3 h. The washed pellet was
resuspended in the buffer and used as the membrane fraction. The
protein content of extracts was determined by the method of Lowry et
al. (11) with bovine serum albumin as the standard.
For the assay of octaprenyltransferase, the procedure of Shineberg and
Young (21) was used with modifications. The reaction mixture
consisted of 10 µl of cell extract or membranes (0.2 to 0.25 mg of
protein), 11.4 nmol of [3H]farnesyl pyrophosphate
(specific activity, 44 µCi/mmol), 0.1 M Tris-HCl buffer (pH 8.0), 10 mM MgSO4, 10 mM dithiothreitol, and 0.4% Triton X-100 in a
total volume of 0.5 ml. The reaction was started by the addition of 100 nmol of 1,4-dihydroxy-2-naphthoic acid in 10 µl of ethanol-diethyl
ether (2:1 [vol/vol]). The tubes were incubated at 37°C for 30 min.
The reaction was stopped by the addition of 2 ml of 0.1 M acetic acid
in methanol and extracted twice with 3 ml of pentane. The combined
pentane extracts were evaporated to dryness in a scintillation vial, 6 ml of Ultima Gold scintillation fluid (Packard Instrument Co., Inc.)
was added, and the radioactivity was determined.
Cloning, sequencing, and identification of the menA
gene.
The menA gene is located at 88 min on the
E. coli linkage map (12) and has been shown to be
cotransducible at frequencies of 60 and 90%, respectively, with the
metB and glpK loci (12). Since the
Clarke-Carbon plasmid pLC 28-47 (16) spans this region, it
was used as a starting point for cloning experiments. A 2.0-kb, PstI fragment located between cytR and
glpK (Fig. 2) was subcloned into the PstI site of
pUC18 and designated pMK2. When transformed into the menA
mutant, AN67 pMK2 was found to complement the mutant phenotype as
assayed by the restoration of anaerobic growth on glycerol-TMAO medium.
The nucleotide sequence of the pMK2 insert was determined to identify a
potential menA ORF. Two intact ORFs were located within the
insert. One of these (orf308) encoded a 308-residue
polypeptide, and the other (orf161) encoded a 161-residue
protein. Appropriately positioned putative promoter sequences, with
consensus
10 and
35 elements, and consensus ribosome binding site
sequences were located 5' to each ORF. To identify the ORF encoding the
octaprenyltransferase, four pMK2 deletion plasmids (Fig. 2) were
constructed and used to complement the menA mutant.
Complementation occurred in the presence of pMK6, which retains an
intact orf308 and a deleted orf161, but not in
the presence of pMK5 (deleted orf308 and intact orf161) or of pMK3 or pMK4 (both reading frames disrupted).
Thus, orf308 was designated the menA gene.
Analysis of menaquinones and octaprenyltransferase activity in
various strains.
E. coli cells contain both MK-8 and DMK-8,
both of which are known to be membrane bound (4). To confirm
that the restoration of anaerobic growth on glycerol-TMAO by
complementation was due to the restoration of the ability to synthesize
menaquinones, the wild-type strain PL2024, the menA mutant
AN67, and the two plasmid-containing strains AN67/pMK2 and AN67/pMK6
were grown for the analysis of quinone content. Quinones from these
strains were extracted and analyzed by RPHPLC. The results shown in
Fig. 3 clearly indicate the absence of
both DMK and MK in the untransformed menA mutant. In
contrast, the levels of both these napthoquinones in the
orf308-complemented mutant (AN67/pMK6) indicate restoration of quinone synthesis. Similar results were obtained with AN67/pMK2 (data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
HPLC tracing of menaquinones extracted from the wild
type (A), the menA mutant (B), and the menA
mutant complemented by plasmid pMK6 (C). Peaks were identified by
authentic standards. DMK-8 and MK-8 eluted at 13.6 and 15.2 min,
respectively.
|
|
Since the menA mutant showed restoration of MK-8 and DMK-8
when either pMK2 or pMK6 was carried, it was important to verify that
the restoration correlated with the appearance of DHNA
octaprenyltransferase in the plasmid-containing strains. Hence, the
enzyme activity was assayed in membrane preparations from the wild-type
strain PL2024, the menA mutant AN67, and the two
plasmid-containing strains. As is evident from Table
2, enzyme activity is fully restored in
both AN67/pMK2 and AN67/pMK6. However, the activity was notably higher
in the presence of pMK6. This higher level agrees with an increased
level of DMK in the complemented strain (Fig. 3).
Similarities of octaprenyltransferases.
The menA
region of the E. coli chromosome has also been sequenced as
part of the genome sequencing project (18) and is identical to the sequence reported here. We now, however, identify the reported E. coli genome project orf308 reading frame as
menA. A search of the GenBank database with the deduced DHNA
octaprenyltransferase sequence identified two relevant categories of
polypeptides. The first category included presumptive
menA-encoded products in Haemophilus influenzae
(accession no. U32732) and Synechocystis sp. (accession no.
D90911), both of which are based upon our reporting of the E. coli menA sequence, and possibly the Bacillus subtilis 33.8-kDa gene product of ipa-6d (accession no. S39661 and
X73124). All three of these proteins include the octaprenyl
pyrophosphate binding motif noted below. A second category, however,
was created by the ubiA gene product 4-hydroxybenzoate
octaprenyltransferase from E. coli. Since menaquinone and
ubiquinone have identical octaprenyl side chains, and since both have a
common pool of octaprenyl pyrophosphate, we aligned the deduced
polypeptide sequences of the menA and ubiA gene
products. The results indicated 35% overall similarity (21% identity)
(Fig. 4), which is even more apparent in
a comparison of their hydrophobicity plots (Fig.
5). Highly conserved within the deduced
DHNA octaprenyltransferase polypeptide is a sequence (LANDYGD)
reminiscent of the putative polyprenyl pyrophosphate binding region
(1) (Fig. 4).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Alignment of deduced menA and ubiA
polypeptides. Amino acids are represented by the single-letter code.
*, amino acid identity; ., amino acid similarity; , gaps introduced
to facilitate the alignment. The putative polyprenyl pyrophosphate
binding site is indicated in bold-faced type.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Hydrophobicity comparison of the deduced
menA- and ubiA-encoded polypeptides. Hydrophobic
values are given on the ordinate. Positive hydrophobic values indicate
hydrophobic regions, and negative values indicate hydrophilic regions.
Amino acid residue numbers are shown on the abscissa. A moving
11-amino-acid window was used to generate the plots. E. coli
ubiA polypeptide (25).
|
|
menA transcriptional analysis.
Following the
confirmation of orf308 as the menA locus, the
validity of the associated putative promoter was tested by primer extension analyses. Since DMK and MK are the primary quinones during
anaerobic growth but are also synthesized under aerobic conditions,
total RNA was prepared from both aerobically and anaerobically grown
wild-type cells. Equal quantities of RNA from both sets of cells were
independently assayed for transcriptional initiation sites with the two
discrete primers indicated in Fig. 6. In
all instances the +1 site was identified as 57 bp 5' to the
translational initiation codon. The levels of primed RNA were greater
in aerobically than in anaerobically prepared cells (Fig. 6). To verify
this result, additional RNA preparations from aerobically grown cells with minimal medium, plus either glucose or glycerol, were compared with anaerobically grown equivalents containing TMAO as the electron acceptor. While the levels of transcript were reduced in these sets of
experiments compared to those in complex-media-grown cells, the greater
level of transcript was still apparent in the aerobically grown
samples.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
Primer extension identification of menA
transcriptional initiation. Equivalent amounts of
spectrophotometrically determined RNA from aerobically
(+O2) and anaerobically ( O2) grown PL2024
cells were extended with the oligonucleotide
GAGGGTTTTAGGTCGTAAACTTTCC derived from the menA
sequence 3' to the translational initiation codon. DNA sequence ladders
(lanes G, A, T, and C) are extensions of pMK2 DNA with the same primer.
*, transcriptional initiation origin. A second primer, located 25 bp
upstream from the first and having the sequence
GTTGTTCAGTCATAATACGCGCCAATAA, gave similar results.
|
|
The analysis of the 5'-flanking sequence of menA indicated
the presence of presumptive
70 promoter elements coupled
with an appropriately positioned ribosomal binding site. Primer
extension studies allowed us to confirm a transcriptional start site
downstream from the putative perfect consensus (TATAAT)
10 promoter.
However, 18 bp upstream, only a poorly matched (ATGAAG)
35 consensus
sequence was evident, suggesting the possible need for additional
regulatory factors to obtain higher levels of transcriptional
initiation.
Transcriptional analyses show a greater abundance of menA
transcript in aerobically grown than anaerobically grown cells. Previous studies have shown that aerobically grown cells contain about
10-fold-higher levels of DMK than of MK (23). Under
anaerobic conditions, the level of MK increases, while the level of DMK decreases to a very low level (24). Recently, it has been
shown that an enzyme (UbiE) involved in uniquinone (required for
aerobic electron transport) biosynthesis can methylate DMK to MK
(9). However, a more definitive assessment of the regulation
of synthesis of DMK and MK must await the results of ongoing operon and
protein lac fusion studies on the menA and
ubiE genes.
Finally, we note a potential effect of the upstream hslU
locus on menA transcripts. Plunkett et al. (18)
described a potential stem-loop structure hypothesized as a
transcriptional terminator for hslU. This structure must
also be part of the menA transcript, as it lies directly
between the menA transcriptional and translational initiation points. As such, it may play a role in menA mRNA
stability in a manner similar to the more complex stem-loop arrangement found in ompA message (8). Such enhancement of
mRNA stability would help explain the apparent paradox of aerobically
elevated transcript levels for a menaquinone biosynthesis gene.
Nucleotide sequence accession number.
The sequence data
reported in this study appear in the EMBL, GenBank, and DDBJ nucleotide
sequence databases under accession no. U56082.
This research was supported by Public Health Service grant GM 50262 from the National Institutes of Health.
| 1.
|
Asby, M. N.,
S. Y. Kutsunai,
S. Ackerman,
A. Tzagoloff, and P. A. Edwards.
1992.
COQ2 is a candidate for the structural gene encoding para-hydroxybenzoate:octaprenyltransferase.
J. Biol. Chem.
267:4128-4136[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1989.
In
Current protocols in molecular biology, p. 4.4.1-4.9.8.
John Wiley and Sons, New York, N.Y.
|
| 3.
|
Bentley, R.
1975.
Biosynthesis of vitamin K and other natural naphthoquinones.
Pure Appl. Chem.
41:47-68.
|
| 4.
|
Bentley, R., and R. Meganathan.
1982.
Biosynthesis of vitamin K (menaquinone) in bacteria.
Microbiol. Rev.
46:241-280[Free Full Text].
|
| 5.
|
Birnboim, B. G., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523[Abstract/Free Full Text].
|
| 6.
|
Bligh, E. G., and W. J. Dyer.
1959.
A rapid method of total lipid extraction and purification.
Can. J. Biochem. Physiol.
37:911-917.
|
| 7.
|
Daruwala, R., and R. Meganathan.
1991.
Dimethyl sulfoxide reductase is not required for trimethylamine N-oxide reduction in Escherichia coli.
FEMS Microbiol. Lett.
83:255-260.
|
| 8.
|
Emory, S. A.,
P. Bouvet, and J. G. Belasco.
1992.
A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli.
Genes Dev.
6:135-148[Abstract/Free Full Text].
|
| 9.
|
Lee, P. T.,
A. Y. Hsu,
H. T. Ha, and C. F. Clarke.
1997.
A C-methyltransferase involved in both ubiquinone and menaquinone biosynthesis: isolation and identification of the Escherichia coli ubiE gene.
J. Bacteriol.
179:1748-1754[Abstract/Free Full Text].
|
| 10.
|
Lin, E. C. C., and D. Kuritzkes.
1987.
Pathways for anaerobic electron transport, p. 202-221.
In
F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
|
| 11.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 12.
|
Meganathan, R.
1996.
Biosynthesis of the isoprenoid quinones menaquinone (vitamin K2) and ubiquinone (coenzyme Q), p. 642-656.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 13.
|
Meganathan, R., and R. Coffell.
1985.
Identity of the quinone in Bacillus alcalophilus.
J. Bacteriol.
164:911-913[Abstract/Free Full Text].
|
| 14.
|
Miguel, L., and R. Meganathan.
1991.
Electron donors and the quinone involved in dimethyl sulfoxide reduction in Escherichia coli.
Curr. Microbiol.
22:109-115.
|
| 15.
|
Newton, N. A.,
G. B. Cox, and F. Gibson.
1971.
The function of menaquinone (vitamin K2) in Escherichia coli K12.
Biochim. Biophys. Acta.
244:155-166[Medline].
|
| 16.
|
Nishimura, A.,
K. Akiyama,
Y. Kohara, and K. Horiuchi.
1992.
Correlation of a subset of the pLC plasmids to the physical map of Escherichia coli K-12.
Microbiol. Rev.
56:137-151[Abstract/Free Full Text].
|
| 17.
|
Palaniappan, C.,
V. Sharma,
M. E. S. Hudspeth, and R. Meganathan.
1992.
Menaquinone (vitamin K2) biosynthesis: evidence that the Escherichia coli menD gene encodes both 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylic acid synthase and -ketoglutarate decarboxylase activities.
J. Bacteriol.
174:8111-8118[Abstract/Free Full Text].
|
| 18.
|
Plunkett, G., III,
V. Burland,
D. L. Daniels, and F. R. Blattner.
1993.
Analysis of the Escherichia coli genome. III. DNA sequence of the region from 87.2 to 89.2 minutes.
Nucleic Acids Res.
21:3391-3398[Abstract/Free Full Text].
|
| 19.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 20.
|
Sharma, V.,
K. Suvarna,
R. Meganathan, and M. E. S. Hudspeth.
1992.
Menaquinone (vitamin K2) biosynthesis: nucleotide sequence and expression of the menB gene from Escherichia coli.
J. Bacteriol.
174:5057-5062[Abstract/Free Full Text].
|
| 21.
|
Shineberg, B., and I. G. Young.
1976.
Biosynthesis of bacterial menaquinones: the membrane associated 1,4-dihydroxy-2-naphthoate octaprenyltransferase of Escherichia coli.
Biochemistry
15:2754-2758[Medline].
|
| 22.
|
Suvarna, K.,
R. Meganathan, and M. E. S. Hudspeth.
1994.
Menaquinone (vitamin K2) biosynthesis: cloning and nucleotide sequence of the menA gene from Escherichia coli, abstr. K-159, p. 303.
In
Abstracts of the 94th General Meeting of the American Society for Microbiology 1994. American Society for Microbiology, Washington, D.C.
|
| 23.
|
Unden, G.
1988.
Differential roles of menaquinone and demethylmenaquinone in anaerobic electron transport of E. coli and their fnr-independent expression.
Arch. Microbiol.
150:499-503[Medline].
|
| 24.
|
Wallace, B. J., and I. G. Young.
1977.
Roles of quinone in electron transport to oxygen and nitrate in Escherichia coli studies with a ubiA and menA double mutant.
Biochim. Biophys. Acta
461:84-100[Medline].
|
| 25.
|
Wu, G.,
H. D. Williams,
F. Gibson, and R. K. Poole.
1993.
Mutants of Escherichia coli affected in respiration: the cloning and nucleotide sequence of ubiA, encoding the membrane-bound p-hydroxybenzoate:octaprenyltransferase.
J. Gen. Microbiol.
139:1795-1805[Medline].
|