Previous Article | Next Article 
Vol. 180, Issue 13, 3388-3392, July 1, 1998
Identification and Characterization of Two
Quiescent Porin Genes, nmpC and ompN, in
Escherichia coli BE
Alexej
Prilipov
,
Prashant
S.
Phale,
Ralf
Koebnik,
Christine
Widmer, and
Jurg P.
Rosenbusch*
Department of Microbiology, Biozentrum,
University of Basel, CH-4056 Basel, Switzerland
 |
ABSTRACT |
The genomic DNA of the BE strain of Escherichia
coli has been scrutinized to detect porin genes that have not
been identified so far. Southern blot analysis yielded two DNA segments
which proved highly homologous to, yet distinct from, the
ompC, ompF, and phoE porin genes.
The two genes were cloned and sequenced. One of them, designated
ompN, encodes a porin which, due to low levels of
expression, has eluded prior identification. The functional properties (single-channel conductance) of the OmpN porin, purified to
homogeneity, closely resemble those of the OmpC porin from E. coli K-12. The second DNA fragment detected corresponds
to the nmpC gene, which, due to an insertion of an
IS1 element in its coding region, is not expressed in
E. coli BE.
 |
INTRODUCTION |
Outer membranes of gram-negative
bacteria are permeable to small (<600-Da), polar molecules that cross
an otherwise impermeable lipid bilayer by diffusion through
water-filled channel proteins, the porins (19).
Escherichia coli K-12 encodes three major nonspecific proteins, the OmpC, OmpF, and PhoE porins, and several other
channel-forming proteins with higher degrees of specificity. Since we
are interested in the structural and functional characterization of
nonspecific as well as specific porins to high resolution (6, 9,
25, 29, 30), it was of interest to know whether other, as yet unidentified genes coding for porin-like proteins were present in
E. coli BE, a strain in which apparently a
single porin is expressed (23, 25). During scrutiny of the
genome of the BE strain for cross-hybridizing DNA, two
additional genes were detected. One showed high similarity with the
nmpC gene of E. coli K-12 and is not
expressed in E. coli BE due to inactivation
by an IS1 element. Cloning and overexpression of the other,
which we call ompN, allowed characterization of the purified
product, which reveals biochemical and functional properties highly
similar to those of the OmpC porin.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and media.
E. coli
strains and plasmids used are listed in Table
1. Cells were grown aerobically at 37°C
on 2× YT medium (16 g of tryptone, 10 g of yeast extract, and
5 g of NaCl per liter). The antibiotics ampicillin (100 µg/ml)
and kanamycin (50 µg/ml), where required, were included in the growth
media.
Standard DNA preparations, DNA labeling, and Southern blot
analysis.
Standard DNA manipulations were performed as described
previously (27). All DNA preparations were carried out by
using available kits (Qiagen). To produce porin-specific gene probes,
DNA fragments (a 900-bp HincII-BglII
ompF fragment from pMY222, a 554-bp
EcoRI-EcoRV ompC fragment from pMY150,
and a 834-bp PstI-BglII phoE fragment from pJP29) were radioactively labeled with [
-32P]dATP
(Amersham), using a Random Primer DNA labeling kit (Bio-Rad). For
Southern blot analysis, performed as described by the manufacturer (Amersham), chromosomal DNAs of E. coli K-12 CE1249,
BE BL21(DE3), and BE BZB1107 were digested with
restriction endonuclease EcoRV and fractionated by
electrophoresis on 0.8% agarose gels. The DNA was blotted to Hybond-N
membranes (Amersham) and hybridized with the labeled porin gene probes
overnight at 65°C.
Cloning, DNA sequencing, and PCR.
Chromosomal DNA (5 µg)
from E. coli BE BL21(DE3) was digested with
EcoRV and separated on an agarose gel (0.8%). Based on
Southern blot analyses (see Results), DNA fragments of about 2.6 and
3.1 kb were isolated from gels and ligated with plasmid pGEM-5Zf(+) after linearization with EcoRV and dephosphorylation.
Resulting plasmids were transformed into strain TOP10 and plated onto
ampicillin-isopropyl-
-D-thio- galactopyranoside (IPTG)-5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
plates. White colonies were screened for recombinant plasmids harboring
sequences homologous to the ompF gene by hybridization.
Cloned DNA was sequenced by the chain termination method
(
28), using a T7 sequencing kit (Pharmacia). To amplify the
ompN gene from other
E. coli strains by PCR
(
Pwo DNA polymerase [Boehringer
Mannheim]; 30 cycles of
amplification), we used oligonucleotides
I
(5'-
TCTAGATATTTATCGGCTAACTGAACTTCT
[
XbaI site]) and II
(5'-CA
GGATCCTTTAGAACTGATAAACCAGACC
[
BamHI site]) (restriction sites used for cloning
are underlined).
Amplified DNA from
E. coli K-12 CE1249 was cloned as an
XbaI-
BamHI fragment into plasmid pET-15b,
resulting in plasmid pOmpN.
Purification of the OmpN protein and N-terminal protein
sequencing.
E. coli BE host strain
BL21(DE3)omp8, which lacks all major porins but harbors the pOmpN
expression plasmid, was used for OmpN protein overexpression. Cells
were grown for 6 h (optical density at 600 nm of 0.6), followed by
induction with IPTG (final concentration of 1 mM). After further growth
for 4 h, cells (10 g [wet weight]) were suspended in 30 ml of
breaking buffer (10). The suspension was passed through a
French pressure cell (model FA-073; Aminco, Urbana, Ill.) at 162 MPa
thrice. The outer membrane pellet was collected by two successive
centrifugations, first at 8,000 × g for 10 min to
remove unbroken cells and then at 75,000 × g for 30 min. The membrane pellet was extracted for 2 h at 37°C with 100 ml of extraction buffer (10) containing 0.125%
octyl-polyoxyethylene (octyl-POE; Alexis, Läuflingen,
Switzerland), followed by extraction buffer containing 3%
octyl-POE. The latter extract was concentrated and applied to an
ion-exchange DEAE-Sephacel (Pharmacia) column. It was washed with
column buffer (10) containing 10 mM EDTA. The protein was
eluted by using column buffer supplemented with 50 mM EDTA and 0.1 M
NaCl and was then applied to a PBE94 chromatofocusing column
(Pharmacia), followed by Sephadex G-150 gel filtration (Pharmacia), as
described for OmpF (10). Purity of the protein was assayed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
using 12% acrylamide (16) and N-terminal protein sequencing
(Applied Biosystems model 477A sequenator). Other porins (OmpF, OmpC,
and PhoE) were purified as described previously (6).
Planar lipid bilayer experiments, liposome swelling assays, and
CD spectroscopy.
Channel conductance properties of purified porins
were measured with respect to single-channel conductance, critical
voltage of closing, and ion selectivity, or by liposome swelling assays as described previously (26). The shift in electrophoretic
mobility due to heat dissociation of trimers was monitored by SDS-PAGE (25). The circular dichroism (CD) spectrum of OmpN was
recorded in a Jasco spectrometer (model J-720) at 25°C as described
previously (25).
Homology searches.
Database BLASTP, BLASTN, and TBLASTN
searches (2) were performed via the file server at
blast{at}ncbi.nlm.nih.gov, using default parameters.
Nucleotide sequence accession numbers.
The sequences for
E. coli BE nmpC and
ompN have been deposited with GenBank under accession no.
U91745 and AF035618, respectively.
 |
RESULTS |
Identification, cloning, and sequencing of the nmpC and
ompN genes from E. coli
BE.
The electrophoretic mobilities of various
restriction fragments originating from the ompF,
ompC, and phoE genes in E. coli BL21(DE3) were determined by Southern blot analyses (data not shown).
To detect homologous genes, chromosomal DNA was purified from three
different strains of E. coli [K-12 CE1249,
BE BL21(DE3), and BE BZB1107], digested
with restriction endonuclease EcoRV, and analyzed by
Southern blot with the labeled ompF fragment as the probe
(Fig. 1). In addition to the signals
corresponding to ompF and ompC, two additional
bands (I and II) were detected. The corresponding DNA fragments
from strain BL21(DE3) were cloned and sequenced. They proved
distinct from the phoE gene. BLASTN database analyses revealed the presence of an nmpC gene, described previously
(3), in fragment I. This gene could encode a 360-residue
polypeptide, including a 23-residue signal peptide, if it were
not inactivated by an IS1 element insertion at a position
corresponding to amino acid 170 of the mature protein. The sequence of
fragment II revealed an open reading frame which encodes a
polypeptide that is highly homologous to known porins (Fig.
2). We designate this gene, which has not
been described previously, as ompN. To determine whether the
same gene is also present in other E. coli strains, PCR
was performed with the two ompN-specific oligonucleotides
from the BE strain (see Materials and Methods). This
resulted in the amplification of DNA fragments with the expected size
both in E. coli C and the E. coli K-12
strains. The latter was cloned and sequenced. The predicted amino acid
sequence revealed differences in two positions compared to the
E. coli BE protein: a conservative change
in the predicted
-strand 14 (V309I), and a substitution of Thr by
Ala at 338 position in a predicted surface-exposed loop L8.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Southern blot analysis. Chromosomal DNAs were purified
from E. coli CE1249 (lane a), BL21(DE3) (lane b),
and BZB1107 (lane c), respectively, and digested with EcoRV.
After fractionation of the DNA fragments by agarose gel
electrophoresis, they were blotted onto a Hybond-N membrane and probed
with [ -32P]dATP-labeled ompF-specific DNA.
With strain BL21(DE3), two EcoRV fragments appeared in
positions corresponding to ~3.1 and 2.6 kb and are labeled by arrows
as fragments I and II. Fragments corresponding to ompF
(asterisk) and ompC (circle) are indicated.
HindIII-digested DNA is shown in lane M.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of the predicted amino acid sequence of OmpN
with sequences of various known E. coli porins.
Sequences underlined below each block correspond to the strands in
the three-dimensional structures of OmpF and PhoE (6). A
highly conserved porin-specific sequence motif, PEFGGD (14),
in loop L3, and five conserved charged residues (R37, R75, D106, E110,
and R126) which form a strong transversal electrostatic field in the
channel interior are shown in bold. The additional amino acid residues,
present in the predicted surface-exposed loop L7 in OmpN, are shown in
bold italics. The overall similarity of OmpN is highest to OmpC (65%
identical residues), followed by PhoE (62% identical residues) and
OmpF (58% identical residues).
|
|
Since the deduced amino acid sequence predicts the OmpN protein to be
synthesized with a signal peptide, the processing site
was confirmed by
N-terminal protein sequencing. The mature OmpN
protein consists of 356 amino acid residues, with a calculated
mass of 39,152 Da. Comparison at
the amino acid level with other
porins (PhoE, OmpF, and OmpC from
E. coli) revealed identity of
the amino-terminal 24 residues of the mature OmpN with those of
OmpC and a high degree of
conservation with the other porins.
The multiple alignment in Fig.
2
indicates the various degrees
of identity. A highly conserved sequence
motif, PEFGGD (
14),
and five charged residues (R37, R75,
D106, E110, and R126) which
form a strong transversal electrostatic
field in the channel interior
(
6) are present at the same
positions as in the superfamily
of nonspecific porins. Altogether, the
sequence and the characteristic

-sheet CD spectrum of the
purified protein (absorption minimum
at 218 nm [
25])
suggest that OmpN porin also forms a 16-stranded
antiparallel

barrel.
A standard BLASTP database search revealed numerous homologous
proteins, among them several enterobacterial porins (
13).
Other closely related proteins, with an even higher score than
OmpC,
include the porins OmpS2 (GenBank accession no.
X89756)
and OmpS1
(
7) from
Salmonella typhi, OmpK36 from
Klebsiella pneumoniae (
1), and OpnP from
Xenorhabdus nematophilus (
8).
The OmpN protein is
also closely related to the bacteriophage-encoded
Lc/NmpC proteins
(
3) and to the NmpC-like OmpD porin from
Salmonella typhimurium (
31). Interestingly, a TBLASTN database
search identified
a very similar sequence at 43.8 min of the
E. coli K-12 chromosome.
Closer scrutiny revealed that
this sequence contains an internal
stop codon and a frameshift.
Overexpression and characterization of the OmpN porin.
For the
construction of an OmpN expression plasmid, the PCR-amplified
ompN gene fragment from E. coli K-12 CE1249
was cloned as an XbaI-BamHI fragment (sites are
present at the 5' termini of the PCR primers) behind the T7-specific
promoter of plasmid pET-15b. The resulting plasmid, pOmpN, allowed the
overexpression of OmpN in E. coli BL21(DE3)omp8
(Fig. 3A), with its purification yielding
2 to 3 mg of OmpN protein per g (wet weight) of cell mass. The purity
of the protein was established by SDS-PAGE (Fig. 3B) and N-terminal
sequencing, which yielded the unique sequence AEVYNKDGNKLD. The apparent molecular mass of
the polypeptide as determined by SDS-PAGE after 95°C heat
treatment was 39 kDa (Fig. 3), which is in agreement with the
calculated value from the deduced amino acid sequence. In samples not
treated by heat prior to electrophoresis, the band revealed a
significantly lower migration rate, characteristic for a trimeric state
of association of porin monomers (25). The thermal
stability with respect to the dissociation of the OmpN trimers
into its monomers in the presence of 1% SDS occurred with a
midpoint at 70°C. By comparison, the corresponding transition temperatures of OmpC, OmpF, and PhoE porins are at 80, 75, and 75°C.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 3.
SDS-PAGE analysis of E. coli porins. (A)
Overexpression of OmpN porin in E. coli
BL21(DE3)omp8. Membrane pellets were extracted with 3% octyl-POE
as described in Materials and Methods. Protein samples (from 15 ml of
culture) were applied to the gel without ( ) or with (+) heat
treatment for 10 min at 95°C in sample buffer. (B) Electrophoretic
mobilities of purified porins (indicated at the top), which were used
for functional analyses, represent monomers (high mobility) and trimers
(low mobility). They were purified from E. coli outer
membranes as described in the text. The protein samples (3 to 5 µg)
were heated as described above. Lane M, molecular weight standard.
|
|
Reconstitution of the purified OmpN protein into planar lipid bilayers
was as efficient as that of OmpF porin (
29). The
current
traces were essentially free of noise and allowed the
channel
conductance properties to be monitored. Like other
E. coli porins, OmpN porin showed high cooperativity in the
initiation
step, with conductance steps of 1.63 ± 0.06 nS (59 events), corresponding
to the cooperative insertion of three monomers
(single-channel
conductances, 0.50 ± 0.03 nS; 286 events). Table
2 summarizes
the measured values for
single-channel conductances, critical
voltage of channel closing, ion
selectivities for various nonspecific
porins. Similar to channels in
the OmpC porin, OmpN channels are
less sensitive to applied
transmembrane potentials, requiring
significantly higher voltages
before the channels close (at ~250
mV). The rates of sugar permeation
through different porin channels,
as determined by liposome swelling
assays, exhibit a complex pattern
(Table
3), as discussed below.
 |
DISCUSSION |
Initially, a single gene was found to encode a porin protein in
E. coli BE (23, 25).
Subsequently, an increasing number of porin variants, specific and
nonspecific, were described. To determine how many further cryptic
porins exist, we scrutinized the genome of E. coli
BE, using a porin-specific gene probe. As described in this
report, scrutiny of the E. coli BL21(DE3)
chromosome revealed the presence of two other related genes.
The first gene identified in this study was very similar to the
E. coli K-12 nmpC gene (91% identity at the
amino acid level). The NmpC protein was first identified in
pseudorevertants of E. coli K-12 strains which were
impaired in the expression of both ompF and ompC
porin genes (22). Apparently, this membrane protein was
synthesized due to a precise excision of the IS5 element
(3) and could functionally replace the OmpF or OmpC porin
(12). In K-12 wild-type strains, the protein is not
expressed, due to the presence of an IS5 element near the 3'
end of the coding sequence (3, 11). While this element does
not exist at that position in B strains, the nmpC gene
analog is not expressed in E. coli BE, as
in this case an insertional inactivation by an IS1
element occurs. Thus, in both E. coli B and
E. coli K-12, the nmpC genes are inactivated
by insertion sequence elements, though their respective identities and
locations are different.
The second gene, ompN, encodes a protein that is closely
related to enterobacterial porins. Expression of the chromosomal ompN gene in strain BL21(DE3)omp8 was examined by
comparison with an isogenic ompN knockout mutant. This
revealed that under normal laboratory growth conditions in rich media,
the gene product is found at levels in the outer membrane too low to be
quantitated and partially overlapping another gel band. The
ompN gene has also been found in E. coli C
and K-12 strains. The demonstration that OmpN porin has properties
which both in biochemical as well as in functional terms resemble those
of the nonspecific porins brings their number to at least four:
OmpC, OmpF, OmpN, and PhoE. An additional functional analog, the
OmpG protein, has been identified and characterized (17).
However, this protein does not exhibit substantial sequence homology to
the four nonspecific porins mentioned, and its relationship remains to
be determined.
Compared to OmpF porin from E. coli K-12, the
OmpN protein contains an additional stretch of nine amino acid
residues, predicted to be located in the surface-exposed loop L7. It is
noteworthy that in terms of its functional properties, the OmpN and
OmpC porins reveal very similar channel conductances (5), a
finding that may be explained by the observation that these two
porins both contain short inserts in regions of two loops
(corresponding to L4 and L8) compared to the OmpF and PhoE porins (Fig.
2). Surprisingly, the differential uptake of mono- and disaccharides of
the OmpN protein resembles that of the OmpF porin more closely than
that in the OmpC protein (Table 3), differences which in the apparent absence of solute binding sites are rather interesting. Determinations of the structures of both OmpC and OmpN porins to high resolution, now
in progress, should allow these differences to be explained.
 |
ACKNOWLEDGMENTS |
We thank P. Jenö, Department of Biochemistry, Biozentrum
Basel, for N-terminal protein sequencing.
This study was supported by grant 31-36352 from the Swiss National
Science Foundation. R.K. was supported by grant Ko1686/1-1 from the
Deutsche Forschungsgemeinschaft.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Biozentrum, University of Basel, Klingelbergstrasse 70, CH-4056 Basel, Switzerland. Phone: 41-61-267 21 10. Fax: 41-61-267 21 18. E-mail: rosenbusch{at}ubaclu.unibas.ch.
Present address: Ivanovsky Institute of Virology, 123098 Moscow,
Russia.
 |
REFERENCES |
-
Alberti, S.,
Rodriquez-Quinones, F.,
Schirmer, T.,
Rummel, G.,
Tomas, J. M.,
Rosenbusch, J. P.,
and Benedi, V. J.
(1995)
A porin from Klebsiella pneumoniae: sequence homology, three-dimensional model, and complement binding.
Infect. Immun.
63,
903-910[Abstract].
-
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
Basic local alignment search tool.
J. Mol. Biol.
215,
403-410[Medline].
-
Blasband, A. J.,
Marcotte, W. R.,
and Schnaitman, C. A.
(1986)
Structure of the lc and nmpC outer membrane protein genes of lambdoid bacteriophages.
J. Biol. Chem.
261,
12723-12732[Abstract/Free Full Text].
-
Bosch, D.,
Leunissen, J.,
Verbakel, J.,
de Jong, M.,
van Erp, H.,
and Tommassen, J.
(1986)
Periplasmic accumulation of truncated forms of outer-membrane PhoE protein of Escherichia coli K-12.
J. Mol. Biol.
189,
449-455[Medline].
-
Buehler, L. K.,
Kusumoto, S.,
Zhang, H.,
and Rosenbusch, J. P.
(1991)
Plasticity of Escherichia coli porin channels
dependence of their conductance on strain and lipid environment.
J. Biol. Chem.
266,
24446-24450[Abstract/Free Full Text]. -
Cowan, S. W.,
Schirmer, T.,
Rummel, G.,
Steiert, M.,
Ghosh, R.,
Pauptit, R. A.,
Jansonius, J. N.,
and Rosenbusch, J. P.
(1992)
Crystal structures explain functional properties of two E. coli porins.
Nature
358,
727-733[Medline].
-
Fernández-Mora, M.,
Oropeza, R.,
Puente, J. L.,
and Calva, E.
(1995)
Isolation and characterization of ompS1, a novel Salmonella typhi outer membrane protein-encoding gene.
Gene
158,
67-72[Medline].
-
Forst, S.,
Waukau, J.,
Leisman, G.,
Exner, M.,
and Hancock, R.
(1995)
Functional and regulatory analysis of the OmpF-like porin, OpnP, of the symbiotic bacterium Xenorhabdus nematophilus.
Mol. Microbiol.
18,
779-789[Medline].
-
Garavito, R. M.,
and Rosenbusch, J. P.
(1980)
Three-dimensional crystals of an integral membrane protein: an initial X-ray analysis.
J. Cell Biol.
86,
327-329[Abstract/Free Full Text].
-
Garavito, R. M.,
and Rosenbusch, J. P.
(1986)
Isolation and crystallization of bacterial porin.
Methods Enzymol.
125,
309-328[Medline].
-
Highton, P. J.,
Chang, Y.,
Marcotte, W. R.,
and Schnaitman, C. A.
(1985)
Evidence that the outer membrane protein gene nmpC of Escherichia coli K-12 lies within the defective qsr' prophage.
J. Bacteriol.
162,
256-262[Abstract/Free Full Text].
-
Hindahl, M. S.,
Crockford, G. W. K.,
and Hancock, R. E. W.
(1984)
Outer membrane protein NmpC of Escherichia coli: pore-forming properties in black lipid bilayers.
J. Bacteriol.
159,
1053-1055[Abstract/Free Full Text].
-
Hutsul, J.-A.,
and Worobec, E.
(1994)
Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.
Microbiology
140,
379-387[Abstract/Free Full Text].
-
Jeanteur, D.,
Lakey, J. H.,
and Pattus, F.
(1991)
The bacterial porin superfamily: sequence alignment and structure prediction.
Mol. Microbiol.
5,
2153-2164[Medline].
-
Jeanteur, D.,
Schirmer, T.,
Fourel, D.,
Simonet, V.,
Rummel, G.,
Widmer, C.,
Rosenbusch, J. P.,
Pattus, F.,
and Pagès, J.-M.
(1994)
Structural and functional alterations of a colicin-resistant mutant of porin (OmpF) from Escherichia coli.
Proc. Natl. Acad. Sci. USA
91,
10675-10679[Abstract/Free Full Text].
-
Lugtenberg, B.,
Meijers, J.,
Peters, R.,
van den Hoek, P.,
and van Alphen, L.
(1975)
Electrophoretic resolution of the `major outer membrane protein' of Escherichia coli K12 into four bands.
FEBS Lett.
58,
254-258[Medline].
-
Misra, R.,
and Benson, S. A.
(1989)
A novel mutation, cog, which results in production of a new porin protein (OmpG) of Escherichia coli K-12.
J. Bacteriol.
171,
4105-4111[Abstract/Free Full Text].
-
Mizuno, T.,
Chou, M.-Y.,
and Inouye, M.
(1984)
A unique mechanism regulating gene expression: translational inhibition by a complementary RNA transcript (micRNA).
Proc. Natl. Acad. Sci. USA
81,
1966-1970[Abstract/Free Full Text].
-
Nikaido, H.
(1992)
Porins and specific channels of bacterial outer membranes.
Mol. Microbiol.
6,
435-442[Medline].
-
Prakash-Cheng, A.,
Chung, S. S.,
and Ryu, J.
(1993)
The expression and regulation of hsdK genes after conjugative transfer.
Mol. Gen. Genet.
241,
491-496[Medline].
-
Prilipov, A., P. S. Phale, P. Van Gelder, J. P. Rosenbusch, and R. Koebnik. Coupling site-directed mutagenesis
with high-level expression: large scale production of porin mutants of
E. coli. FEMS Microbiol. Lett., in press.
-
Pugsley, A. P.,
and Schnaitman, C. A.
(1978)
Identification of three genes controlling production of new outer membrane pore proteins in Escherichia coli K-12.
J. Bacteriol.
135,
1118-1129[Abstract/Free Full Text].
-
Pugsley, A. P.,
and Rosenbusch, J. P.
(1983)
OmpF porin synthesis in Escherichia coli strains B and K-12 carrying heterologous ompB and/or ompF loci.
FEMS Microbiol. Lett.
16,
143-147.
-
Ramakrishnan, G.,
Ikenaka, K.,
and Inouye, M.
(1985)
Uncoupling of osmoregulation of the Escherichia coli K-12 ompF gene from ompB-dependent transcription.
J. Bacteriol.
163,
82-87[Abstract/Free Full Text].
-
Rosenbusch, J. P.
(1974)
Characterization of the major envelope protein from Escherichia coli. Regular arrangement on the peptidoglycan and unusual dodecyl sulfate binding.
J. Biol. Chem.
249,
8019-8029[Abstract/Free Full Text].
-
Saint, N.,
Lou, K.-L.,
Widmer, C.,
Luckey, M.,
Schirmer, T.,
and Rosenbusch, J. P.
(1996)
Structural and functional characterization of OmpF porin mutants selected for larger pore size. II. Functional characterization.
J. Biol. Chem.
271,
20676-20680[Abstract/Free Full Text].
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
-
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74,
5463-5467[Abstract/Free Full Text].
-
Schindler, H.,
and Rosenbusch, J. P.
(1978)
Matrix protein from Escherichia coli outer membranes forms voltage-controlled channels in lipid bilayers.
Proc. Natl. Acad. Sci. USA
75,
3751-3755[Abstract/Free Full Text].
-
Schirmer, T.,
Keller, T. A.,
Wang, Y. F.,
and Rosenbusch, J. P.
(1995)
Structural basis for sugar translocation through maltoporin channels at 3.1 Å resolution.
Science
267,
512-514[Abstract/Free Full Text].
-
Singh, S. P.,
Miller, S.,
Williams, Y. U.,
Rudd, K. E.,
and Nikaido, H.
(1996)
Immunochemical structure of the OmpD porin from Salmonella typhimurium.
Microbiology
142,
3201-3210[Abstract/Free Full Text].
-
Struyvé, M.,
Visser, J.,
Adriaanse, H.,
Benz, R.,
and Tommassen, J.
(1993)
Topology of PhoE porin: the `eyelet' region.
Mol. Microbiol.
7,
131-140[Medline].
Copyright © 1998 by American Society for Microbiology
This article has been cited by other articles:
-
Pelosi, L., Kuhn, L., Guetta, D., Garin, J., Geiselmann, J., Lenski, R. E., Schneider, D.
(2006). Parallel Changes in Global Protein Profiles During Long-Term Experimental Evolution in Escherichia coli. Genetics
173: 1851-1869
[Abstract]
[Full Text]
-
Chen, S., Zhang, A., Blyn, L. B., Storz, G.
(2004). MicC, a Second Small-RNA Regulator of Omp Protein Expression in Escherichia coli. J. Bacteriol.
186: 6689-6697
[Abstract]
[Full Text]
-
Fernandez-Mora, M., Puente, J. L., Calva, E.
(2004). OmpR and LeuO Positively Regulate the Salmonella enterica Serovar Typhi ompS2 Porin Gene. J. Bacteriol.
186: 2909-2920
[Abstract]
[Full Text]
-
Nikaido, H.
(2003). Molecular Basis of Bacterial Outer Membrane Permeability Revisited. Microbiol. Mol. Biol. Rev.
67: 593-656
[Abstract]
[Full Text]
-
Flores-Valdez, M. A., Puente, J. L., Calva, E.
(2003). Negative Osmoregulation of the Salmonella ompS1 Porin Gene Independently of OmpR in an hns Background. J. Bacteriol.
185: 6497-6506
[Abstract]
[Full Text]
-
Schneider, D., Duperchy, E., Coursange, E., Lenski, R. E., Blot, M.
(2000). Long-Term Experimental Evolution in Escherichia coli. IX. Characterization of Insertion Sequence-Mediated Mutations and Rearrangements. Genetics
156: 477-488
[Abstract]
[Full Text]
-
Magnet, S., Courvalin, P., Lambert, T.
(1999). Activation of the Cryptic aac(6')-Iy Aminoglycoside Resistance Gene of Salmonella by a Chromosomal Deletion Generating a Transcriptional Fusion. J. Bacteriol.
181: 6650-6655
[Abstract]
[Full Text]
-
Doménech-Sánchez, A., Hernández-Allés, S., Martínez-Martínez, L., Benedí, V. J., Albertí, S.
(1999). Identification and Characterization of a New Porin Gene of Klebsiella pneumoniae: Its Role in beta -Lactam Antibiotic Resistance. J. Bacteriol.
181: 2726-2732
[Abstract]
[Full Text]
-
Hernández-Allés, S., Benedí, V. J., Martínez-Martínez, L., Pascual, A., Aguilar, A., Tomás, J. M., Albertí, S.
(1999). Development of Resistance during Antimicrobial Therapy Caused by Insertion Sequence Interruption of Porin Genes. Antimicrob. Agents Chemother.
43: 937-939
[Abstract]
[Full Text]