Previous Article | Next Article 
Vol. 180, Issue 13, 3453-3461, July 1, 1998
Evolution of Cyanobacteria by Exchange of Genetic
Material among Phyletically Related Strains
Knut
Rudi1*,
Olav M.
Skulberg2, and
Kjetill S.
Jakobsen1*
1 Division of General Genetics, Department of
Biology, University of Oslo, 0315 Oslo,1 and
2 Norwegian Institute for Water Research, 0411 Oslo,2 Norway
 |
ABSTRACT |
The cyanobacterial radiation consists of several lineages of
phyletically (morphologically and genetically) related organisms. Several of these organisms show a striking resemblance to fossil counterparts. To investigate the molecular mechanisms responsible for
stabilizing or homogenizing cyanobacterial characters, we compared the
evolutionary rates and phylogenetic origins of the small-subunit
rRNA-encoding DNA (16S rDNA), the conserved gene rbcL
(encoding D-ribulose 1,5-bisphosphate carboxylase-oxygenase large subunit), and the less conserved gene rbcX. This
survey includes four categories of phyletically related organisms: 16 strains of Microcystis, 6 strains of Tychonema,
10 strains of Planktothrix, and 12 strains of
Nostoc. Both rbcL and rbcX can be
regarded as neutrally evolving genes, with 95 to 100% and 50 to 80%
synonymous nucleotide substitutions, respectively. There is generally
low sequence divergence within the Microcystis,
Tychonema, and Planktothrix categories both for
rbcLX and 16S rDNA. The Nostoc category, on the
other hand, consists of three genetically clustered lineages for these
loci. The 16S rDNA and rbcLX phylogenies are not congruent
for strains within the clustered groups. Furthermore, analysis of the
phyletic structure for rbcLX indicates recombinational events between the informative sites within this locus. Thus, our
results are best explained by a model involving both intergenic and
intragenic recombinations. This evolutionary model explains the DNA
sequence clustering for the modern species as a result of sequence
homogenization (concerted evolution) caused by exchange of genetic
material for neutrally evolving genes. The morphological clustering, on
the other hand, is explained by structural and functional stability of
these characters. We also suggest that exchange of genetic material for
neutrally evolving genes may explain the apparent stability of
cyanobacterial morphological characters, perhaps over billions of
years.
 |
INTRODUCTION |
The current species diversity of the
cyanobacterial radiation comprises several lineages of phyletically
(morphologically and genetically) related organisms (26). An
intriguing question is whether this reflects stability of
cyanobacterial characters or whether the phyletic similarities
originate from relatively recent common ancestors. Analyses of
precambrian microfossils (superficially, hardly distinguishable from
recent cyanobacteria) support the view of retention of cyanobacterial
properties (1, 11, 28). However, on the basis of molecular
data, a 2-billion-year-old mutual ancestor for prokaryotes has been
suggested (5), implying that the similarities between the
earliest records of cyanobacteria and present-day species do not
reflect homologies but rather indicate analogies. In this context, the
phyletically clustered groups may reflect a relatively recent
divergence of the modern species.
In this work we have addressed, by molecular evolutionary studies, the
mechanisms responsible for conserving or homogenizing phyletical
characters within groups of cyanobacteria. We investigated the
evolutionary rates and origins for two genomic regions, by analyzing strains both within and among groups of phyletically related
organisms. This was done by comparative analysis of the small-subunit
rRNA-encoding DNA (16S rDNA), which is conserved by the RNA function
(37), and the rbcLX region with both conserved and less conserved elements. The rbcLX region contains an
intergenic spacer (with no identified functional units), the gene
rbcX with a possible chaperonin-like function
(18), and the 3' end of rbcL (encoding the
highly conserved D-ribulose 1,5-bisphosphate carboxylase-oxygenase large subunit [LSU]) (23). We
analyzed a data set consisting of four phyletically clustered
cyanobacterial strain categories, as inferred from microscopic
observations and 16S rDNA analysis (26, 31). The data
set includes the Microcystis category (16 strains),
consisting of unicellular organisms, the Tychonema (6 strains) and Planktothrix (10 strains) categories, which contain multicellular, filamentous organisms, and the
Nostoc category (12 strains), which includes both
morphologically and genetically slightly divergent organisms (26,
34). The strains in this last category share among other features
the ability of cellular differentiation to produce heterocysts with
nitrogenase activity.
Our sequence data suggest an evolutionary model involving several
events of gene transfer between phyletically closely related organisms
but not between less related organisms. We propose that this gene
transfer has led to the observed sequence homogeneity for the groups of
related organisms and that exchange of genetic material stabilizes the
function and structure of proteins encoded by neutrally evolving genes.
Our gene transfer model may explain the similarity between the fossil
and the recent species.
 |
MATERIALS AND METHODS |
Sample preparation.
The organisms investigated are listed in
Table 1. The majority of the strains were
isolated at the Norwegian Institute for Water Research (33).
The strains were grown in laboratory cultures as previously described
by Rudi et al. (26).
View this table:
[in this window]
[in a new window]
|
Table 1
Strains of cyanobacteria used in this study and data bank
accession numbers for 16S rDNA and rbcLX sequences
|
|
The investigated 16S rDNA and rbcLX regions are shown in
Fig. 1. To generate sequence data,
genomic DNA was isolated, and the rDNA region was amplified and
sequenced as described by Rudi et al. (25, 26). The
rbcLX region was amplified with the primers CW
(5'CGTAGCTTCCGGTGGTATCCACGT3') and CX
(5'GGGGCAGGTAAGAAAGGGTTTCGTA3'). For the
Planktothrix category, CW and DF (5'GGGCARYTTCCACAKNGTCCA3') were used. The PCR program used consisted of an initial denaturation step at 94°C for 4 min and then cycling with the following
parameters: 94°C for 30 s, 40°C for 30 s, and 72°C for
2 min for 2 cycles, then 94°C for 30 s, 55°C for 30 s,
and 72°C for 2 min for 38 cycles, ending with an extension step for 7 min. In addition to the PCR primers, the internal sequencing primer DN
(5'TTGAAGCAATGGATACCGTCTGA3') was used for the
Nostoc category, and primer DL
(5'TTGGATTGTGGGTCAGACTTG3') was used for the
Planktothrix category.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 1.
Structures of the 16S rDNA (A) and rbcLX (B)
regions. The primers used for PCR amplification and sequencing are
indicated with arrows. Two of the strains (Nostoc sp. strain
NIVA-CYA 308 and N. commune) contain an approximately 155-nt
insertion between rbcX and rbcS.
|
|
Phylogenetic reconstruction.
The sequences were aligned
either manually or by using the multisequence alignment algorithm
PILEUP (14) in the Wisconsin package version 8.1 for
UNIX (Genetic Computer Group, Madison, Wis.).
Phylogenetic trees were constructed with the neighbor-joining method (27) or based on parsimony analysis
(9), using the Phylogeny Inference Package (PHYLIP; version
3.5) developed by J. Felsenstein (Department of Genetics, University of
Washington, Seattle), and the package Phylogenetic Analysis Using
Parsimony (PAUP; version 3.1.1) developed by D. L. Swofford
(Illinois Natural History Survey, Champaign). The Kimura two-parameter
model with a transversion:transition weight of 2:1 (16) was
applied to compute the nucleotide distance matrix, and Dayhoff's PAM
001 matrix (4) was used for calculating the amino acid
distance matrix for the neighbor-joining analysis. Bootstrap analysis
(8) constituted the basis for inferring confidence of the
branch points in the phylogenetic trees. Consensus trees were
constructed from 500 bootstrap replicates.
Finally, we tested whether two or more tree topologies generated from
different data sets for the same taxa were significantly
different.
This analysis was done with the Templeton-Felsenstein
test
(
36) for user-defined trees, implemented in the DNAPARS
program of the PHYLIP package.
Phyletic structure of the nucleotide alignments.
The tree
length distribution based on the informative sites for the phylogenetic
trees was analyzed by use of either the exhaustive (for 11 taxa or
less) or the random tree (for more than 11 taxa) option in the PAUP
package. We used the third moment statistics (g1) implemented in this
package to determine the randomization value of the informative sites.
This value was used to evaluate the phyletic information, according to
the criteria given by Hillis and Huelsenbeck (15).
Models for estimating nucleotide substitution distributions.
For nucleotide alignments with randomized phyletic structures, the
observed frequency distributions of nucleotide substitutions in the
alignments were compared to the expected distribution from alignments
randomized by independent substitutions and to the distribution given
that each of the informative sites in the alignment is due to single
substitutions (phyletically informative substitutions).
The frequency of nucleotide substitutions in the model based on
mutationally randomized data was calculated assuming a star-like
phylogenetic structure:
p =
m/(
n × s), where
p is mutational frequency,
m is
nucleotide substitutions (i.e., sites differing from the
50% majority
rule consensus sequence for each subgroup of taxa)
for each of the
individual sequences in the alignment,
n is the
number of
taxa, and
s is neutral positions in the alignment (i.e.,
third codon position and intergenic spacers). The distribution
of sites
in the alignment for which a given number of taxa have
nucleotide
substitutions was then calculated by using the binomial
probability distribution
P(
x) = {
n!/[(
n
x)! ×
x!]} × [
px × (1
p)
n
x] for
1
x
n/2, where
n is the number of
taxa,
x is the number
of taxa with nucleotide substitutions,
and
P is the probability
for this number of taxa with
nucleotide substitutions.
For the scenario where each polymorphic site has arisen once from a
single (phyletically informative) substitution, we also
assume that the
current genotypes have arisen from a common ancestor
in an expanding
population. In this model, the substitution frequencies
are given by
p = u/s, where
u is the number of
polymorphic positions
in the alignment and
s is the number
of neutral positions in the
alignment. We assume that each of the
periods which have resulted
in
x = 1 up to
x
n/2 nucleotide differences per position
in
the alignment has occupied the same time span during evolution
(
n is the total number of taxa and
x is number of
taxa with nucleotide
substitutions). Furthermore, we assume that there
were (
n/x) equally
distributed taxa for each of these
periods. The frequency distribution
per position in the alignment for a
given number of taxa with
nucleotide is thus inversely
proportional to the number of substitutions.
Since the integral of the
probability density function over the
sample space must be 1, a
parameter was used to correct the formula.
The following probability
density function was used in the calculations:
where
P is the probability for this number of taxa
with nucleotide substitutions.
 |
RESULTS |
We have sequenced 16S rDNA and rbcLX regions from a
total of 44 strains belonging to the cyanobacterial categories
Microcystis, Planktothrix, Tychonema,
and Nostoc (Fig. 1). This sequence information was used to
construct phylogenetic trees and for the comparison of the evolutionary
patterns of the regions analyzed.
16S rDNA.
In the 16S rDNA region (Fig. 1A), the sequence
divergence between species belonging to different categories varies
from 0.1 to 0.15 nucleotide substitutions per position. For the most
divergent strains in the Nostoc category, the sequence
divergence is about 0.05 nucleotide substitutions per position. This
category, however, consists of three genetically distinct
lineages
Nostoc lineage I, II, and III. Strains NIVA-CYA
142, 266/1, 83/1, 103, 267/4, 281/1 belong to Nostoc
lineage I, strains Nostoc commune, Nostoc flagelliforme, and NIVA-CYA 124, 194, and 308 belong to
Nostoc lineage II, and strain NIVA-CYA 246 belongs to
Nostoc lineage III. There are only 0.005 nucleotide
substitutions per position among the most divergent strains within both
the Microcystis and the Planktothrix category,
while the strains in the Tychonema category are all
monomorphic.
rbcL and rbcX genes.
The investigated
strains show an overall homogeneous structure of the rbcLX
region (Fig. 1B). The rbcL gene is relatively conserved
(
0.2 nucleotide substitutions per position), while the intergenic
region as well as the gene rbcX are variable, with
0.3
nucleotide substitutions per position when species belonging to
different categories are compared. There are no significant differences
in codon usage for the strains within each clustered group. The
sequence divergence for the rbcL and the rbcX
gene is only 0.002 nucleotide substitutions per position within the Tychonema and Planktothrix categories. There are
about 0.01 nucleotide substitutions per position between the most
divergent isolates in the Microcystis category. The
Nostoc category shows the same three genetically clustered
lineages as for 16S rDNA, with approximately 0.05 nucleotide
substitutions per position for the most divergent strains within each
lineage. On the other hand, for species belonging to different
lineages, the sequence divergence is on average 0.1 and 0.2 nucleotide
substitutions per position for rbcL and rbcX, respectively.
Notably, a strain isolated from Svalbard (
Nostoc sp. strain
NIVA-CYA 308) contains a 154-nucleotide (nt) insertion in the
rbcLX region, which is highly similar to a 157-nt insertion
found
in a strain from China (
N. commune) (Fig.
1B). The
self-splicing
ability of this insertion was investigated by reverse
transcriptase
PCR. No amplification products corresponding to a spliced
RNA
were visible on ethidium bromide-stained agarose gels (results
not
shown).
Both the
rbcL and
rbcX genes are subjected to
purifying selection, with 95 to 100% and 50 to 80% synonymous
nucleotide substitutions
for
rbcL and
rbcX,
respectively. There are no significant differences
in the percentages
of synonymous relative to replacement mutations
when strains both
within and between the phyletically related
groups are compared.
Evolutionary rates for the 16S rDNA and rbcLX
regions.
The evolutionary rates for the 16S rDNA and
rbcLX regions were calculated within and between
Nostoc lineages I and II. Within Nostoc lineages
I and II, the sequence divergence in the rbcX region is only
2 to 2.5 times that of the 16S rDNA divergence. However, the sequence
divergence between lineages I and II displays a 4.5- to 35-fold-higher
difference in the rbcX region compared to 16S rDNA (Fig.
2). The spacer between rbcL
and rbcX for Nostoc lineage I and II has a
variation in length from 70 to 132 bp. Within the lineages, the
sequence divergence is in the same range as for rbcX, both
for the spacer and for the rbcL gene, while between the
lineages the divergence is on average 1.5 and 0.3 times the variation
in rbcX for the spacer and rbcL, respectively (results not shown). For the rbcL gene, only 0 to 5% of the
mutations are replacement substitutions. This indicates that most of
the replacement substitutions are eliminated by selection. The
rbcX gene, with 20 to 50% replacement substitutions,
is also constrained by function, but more mutations are tolerated here.
The spacer region, however, displaying the highest evolutionary rate,
has probably a low functional constraint.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 2.
rbcX (A) and rDNA (B) distance trees for
Nostoc lineages I, II, and III. The trees were built with
the neighbor-joining method (27) from the PHYLIP package,
using distance matrices derived from the Kimura two-parameter model
(16). Numbers at the nodes indicate the percentage of 500 bootstrap trees (8) in which the cluster descending from the
node was found. Abbreviations for strains used: AL 1, Anabaena
lemmermannii NIVA-CYA 266/1; AL 2, A. lemmermannii
NIVA-CYA 83/1; AL 3, A. lemmermannii NIVA-CYA 281/1; AS,
Anabaena sp. strain NIVA-CYA 267/4; AF, Aphanizonenon
flos-aquae NIVA-CYA 142; AG, Aphanizomenon gracile
NIVA-CYA 103; NS 1, Nostoc sp. strain NIVA-CYA 124; NS 2, Nostoc sp. strain NIVA-CYA 194; NS 3, Nostoc sp.
strain NIVA-CYA 308; NS 4, Nostoc sp. strain NIVA-CYA 246;
NC, N. commune; NF, N. flagelliforme.
|
|
Comparison of the 16S rDNA and rbcLX phylogenies for
the genetically distinct clusters of strains.
For this comparison,
we used the translated rbcL and rbcX sequences,
because the amino acid sequence displays suitable polymorphism for phyletic reconstruction (and the nucleotide sequence has too high
variation). Comparison of the phylogeny based on 16S rDNA and the
translated (amino acid) sequence of rbcX for the six
genetically distinct clusters of strains defined in this work shows the
same clustering of strains (Fig. 3).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of distance trees for the
rbcX amino acid sequence (A) and 16S rDNA nucleotide
sequence (B) for the six evolutionary distinct clusters
described in this work. The strains used in the phylogenetic
analysis were selected to include all of the genotypes. The distance
matrix for the amino acid sequences was calculated by using Dayhoff's
PAM 001 matrix (4), while the 16S rDNA distance matrix was
calculated with the Kimura two-parameter model (16). The
trees were built by using the neighbor-joining algorithm
(27) from the PHYLIP package. The numbering at nodes
indicates the percentage of that branch in 500 bootstrap trees
(8).
|
|
There are, however, some discrepancies in the two trees for the
branches leading to
Nostoc lineages I, II, and III and for
the branches leading to
Planktothrix and
Tychonema. For the branch
leading to
Nostoc
lineage II in the
rbcX amino acid tree, this
difference can
be due to low statistical confidence, as indicated
by the low
bootstrap support. The branches leading to
Planktothrix and
Tychonema receive relatively high bootstrap support in both
the
rbcX amino acid tree and the 16S rDNA tree.
However, the branching
pattern for these categories is not stable in
the
rbcX amino acid
tree and is dependent on the trains
considered in the phylogenetic
analysis (results not shown).
The
rbcL amino acid tree is generally congruent with the
rbcX amino acid tree. The only differences are the branches
leading
to
Nostoc lineages I, II, and III, where the
rbcL amino acid tree
is congruent with the 16S rDNA tree
(results not shown).
Comparison of the 16S rDNA and rbcLX phylogenies for
the genetically clustered strains.
There is low accordance, using
both the neighbor-joining method (Fig. 2) and the maximum parsimony
analysis (Fig. 4), between the 16S rDNA
phylogeny and the rbcLX phylogeny for isolates within Nostoc lineages I and II. The only Nostoc strains
which are clustered in both the 16S rDNA and rbcLX trees are
Anabaena flos-aquae NIVA-CYA 83/1 (AL 2) and 266/1 (AL 1)
(Fig. 2 and 4). The clustering of organisms is highly congruent when
results from the two phylogenetic methods are compared (compare Fig. 2
and 4). This is exemplified by the strains Aphanizomenon
flos-aquae NIVA-CYA 142 (AF) and Aphanizomenon gracile
NIVA-CYA 103 (AG), for which 16S rDNAs are grouped with 84% bootstrap
support by the neighbor-joining method (Fig. 2B) and with 96%
bootstrap support by the parsimony analysis (90% identity for
the informative sites [Fig. 2B and 4B]). In contrast to rDNA, the
rbcLX locus reveals a phylogeny where the strains are
relatively distantly related (43% identity for the informative
sites [Fig. 2A and 4A]). This suggests that the rDNA and
rbcLX loci do not have the same evolutionary pattern. The only difference between the parsimony and neighbor-joining analyses is
the location of Nostoc sp. strain NIVA-CYA 194 (NS 2) for
the rbcLX region (Fig. 2A and 4A). However, when only the
strains in Nostoc lineage II are considered in the
neighbor-joining analysis, the branching pattern is congruent with that
of the parsimony analysis (results not shown).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
Maximum parsimony tree for Nostoc lineages I
and II, displaying the rbcLX locus (A) and the 16S rDNA
locus (B). Congruent trees were built both with the DNAPARS program
from the software package PHYLIP and by the exhaustive tree search in
the software package PAUP (9). The evolutionary distances
between the strains are not shown. Informative sites used in the
reconstruction are shown for each branch. The numbering at the nodes
indicate the percentage of 500 bootstrap trees in which the cluster
descending from the node was found with the DNAPARS program. The strict
consensus are shown for all trees, except the 16S rDNA tree for
Nostoc lineage I, where the majority rule tree is shown.
Strain abbreviations are as for Fig. 2.
|
|
The Templeton-Felsenstein test (
36) implemented in the
DNAPARS program in the PHYLIP software package was used to test whether
the
rbcLX and 16S rDNA tree topologies are significantly
different.
In this analysis, we assumed that the 16S rDNA topologies
correlate
with the true phylogeny. The shortest trees generated with
both
the
rbcLX and 16S rDNA data were used as user-defined
trees on
the
rbcLX data set. For
Nostoc lineage
I, the
rbcLX and 16S rDNA
topologies were significantly
different (variance in step differences
as determined by the step
differences at individual positions
[Its SD] = 5.20. However, for
Nostoc lineage II the topological
differences were not
significant (Its SD = 1.73).
Although not strongly supported statistically, strains in the
Microcystis category can also have different evolutionary
patterns
for 16S rDNA and
rbcLX. Strains NIVA-CYA 118/2,
169/7, 161/1,
144, 264, and 324/1 have T in position 234 relative to
the published
16S rDNA sequence for
Microcystis aeruginosa
NIVA-CYA 43, while
the other strains have C at this position. Based on
informative
sites in the
rbcLX region, two phyletic clusters
could be identified.
These clusters are composed of strains NIVA-CYA
264, 324/1 and
161/1 and strains NIVA-CYA 57 and 144, respectively
(Fig.
5).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 5.
Strict consensus maximum parsimony tree for the
Microcystis group, displaying the rbcLX locus.
Congruent trees were built with the DNAPARS program from the software
package PHYLIP and by the branch and bound tree search in the software
package PAUP (9). The evolutionary distances between the
strains are not indicated. Informative sites used in the reconstruction
are shown for each branch. The numbering at the nodes indicate the
percentage of 500 bootstrap trees in which the cluster descending from
the node was found with the DNAPARS program.
|
|
There are no informative sites for the
Planktothrix category
for 16S rDNA. There are, however, two phyletic clusters of sequences
for the
rbcLX locus (supported by five of six informative
sites).
Planktothrix strains NIVA-CYA 29, 299, 56/1, 11, and
65 have the
informative sites CTTTA, while strains NIVA-CYA 116, 18, 320,
1 and 55 have the informative sites TCGCG. There are no
informative
sites in either
rbcLX or 16S rDNA for the
Tychonema category.
Phyletic structure of the 16S rDNA and rbcLX nucleotide
alignments.
Using the exhaustive and the random tree search in the
program package PAUP, we determined the tree length distribution of the
data. The exhaustive tree search was used for data consisting of 11 or
fewer taxa, while the random tree search with 100,000 replicates was
used for more than 11 taxa.
The third momentum statistics of the three lengths for each set of
trees were calculated, and phyletic structure was evaluated
according
to the criteria given by Hillis and Huelsenbeck (
15).
Both
for
Nostoc lineage I and
Nostoc lineage II, the
16S rDNA
data have a significant phyletic structure (Table
2). The situation,
however, is different
for the
rbcLX locus. The
Planktothrix data
do not
have significant phyletic structure, because only one branch
in the
phylogenetic tree is supported by the five informative
sites (Table
2).
There is some phyletic structure for
Microcystis,
i.e., for
informative sites 1, 2, 6, 7, and 15 shown in Fig.
5.
However, when
strains NIVA-CYA 57, 144, 264, 324/1, and 161/1
are omitted in the
phylogenetic analysis (Fig.
5), the phyletic
structure is lost
(Table
2). Finally, the analysis shows that
there are no phyletic
structures in the
rbcLX locus for
Nostoc lineages I and II (Table
2).
Nucleotide substitution distribution for the rbcLX
locus.
The observed distribution of nucleotide substitutions for
the rbcLX locus was compared to the distribution expected
for random independent substitutions and to the expected
distribution for phyletically informative substitutions (see Materials
and Methods). As inferred from Fig. 6,
the observed distributions resemble the distribution based on the
assumption of phyletically informative substitutions. Thus, the
inference from this is that each separate informative site is
phyletically informative (from the definition of a single
substitution), while the combination of these sites in phylogenetic
reconstruction resembles randomly generated data (Table 2).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 6.
Analysis of the frequency distribution of substitutions
in the rbcLX alignment for Nostoc lineage I (A),
Planktothrix (B), Microcystis (C), and
Nostoc lineage II (D). The frequency distributions of
positions in the alignments, where the number of taxa with 1 up to
n/2 nucleotide differences from the consensus sequence for
each subgroup of taxa, were determined for a model based on independent
substitutions (black bars), phyletically informative substitutions
(gray bars), and observed distribution (white bars). These
distributions were calculated as described in Materials and Methods.
|
|
In
Nostoc lineage II, the distribution of informative sites
fits a distribution consisting of blocs of sequences with different
evolutionary affiliations (Fig.
7). This
is particularly exemplified
by the distribution of informative sites in
the comparison of
strains AL 1 and AL 2. All first 4 informative sites
are different,
while the next 10 informative sites are identical.
Assuming that
these two sequences have diverged by four random
substitutions,
the probability
P (
d0
d) = (10 × 10! × 4!)/14! = 0.00999, where
d is the observed distance between the substitutions, and
d0 is
the distance expected for the
substitutions from a random data.
A mosaic data structure is also
suggested from the distribution
of the six informative sites for the
Planktothrix data. Four of
these sites are located within 80 of the 3' nucleotides in the
990-nt alignment. We could, however, not
easily identify such
mosaic structures in the
Microcystis or
the
Nostoc lineage II
data (Fig.
4A and
5).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 7.
Mosaic structure of the informative sites in the
rbcLX alignment for Nostoc lineage I. Blocks of
sequences with similar phyletic affiliations are boxed. Informative
sites 1 and 2 are in the rbcL region, while the other
informative sites are in the rbcX region. Strain
abbreviations are as for Fig. 2.
|
|
 |
DISCUSSION |
Data structure of the rbcLX locus.
Assuming that
the sites in the spacer between the rbcL and rbcX
genes and the third codon position in protein coding genes are neutral,
we estimated that there are less than 13.8% polymorphic neutral sites
in the rbcLX region for the clustered groups. Based on these
observations, we find it unlikely that our data are subjected to errors
caused by mutational saturation, which would require
75% probability
of nucleotide change (15). The randomization values for the
rbcLX locus (Table 2) are quite intriguing because only
10% phylogenetic signal is usually sufficient to skew the tree
length distribution beyond the 95% confidence limit of the random
distribution (15).
It can be argued that the above estimate of neutral sites is an
overestimate and that there are only a few hypervariable sites
in our
alignments. But since it is not the same positions that
are variable
and informative in the alignments for the different
groups, we exclude
this possibility. Another possible explanation
for the randomization of
the informative sites in the alignments
is that the
rbcLX
gene region has branched at a distinct point
during evolution, and the
informative sites therefore are caused
by two or more independent
substitutions (although the sequences
are not saturated by mutations).
A consequence of such a model
is that the clustering of organisms seen
for the
rbcLX trees in
Fig.
2A and
4A does not reflect the
true phylogeny. Nevertheless,
the conclusion drawn from the
Nostoc data, according to this model,
is that the
evolutionary pattern for
rbcLX is different from that
for
16S rDNA. However, the multiple independent substitution model
would
imply a random distribution of substitution for the neutral
nucleotide
positions in the alignment, which is clearly not observed
(Fig.
6).
Thus, the low phyletic signal, according to the criteria
given by
Hillis and Huelsenbeck (
15) of the informative sites
in the
alignments, cannot be explained by multiple independent
substitutions.
Our results suggest that each separate informative site in the
rbcLX alignment is due to single substitutions (phyletically
informative), while the combination of these sites in phylogenetic
reconstruction yields a random tree length distribution. This
observation can be explained only by recombinational events between
the
informative sites. Notably, mosaic structures for the informative
sites
in
Nostoc lineage I further support recombinational events
within the
rbcLX locus (Fig.
7) (
6,
21,
35).
The seemingly random tree length distribution for the
rbcLX
data (Table
2) could be due to the fact that the tree topologies
involving all of the informative sites are compositions of different
topologies based on subfragments of the data. Although the
rbcLX topologies for
Nostoc lineages I and II
have low phyletic structure,
according to tree length distribution
criterion, these topologies
receive high support from the bootstrap
criterion. Furthermore,
the
rbcLX tree topology is
significantly different from the 16S
rDNA topology, according to
the Templeton-Felsenstein test (
36)
for
Nostoc lineage I. On the other hand, more sequence data and
taxa are needed to rigorously resolve the question about the 16S
rDNA
and
rbcLX topologies for
Nostoc lineage II. Taken
together,
however, our results suggest recombinations between the
rbcLX and 16S rDNA loci (intergenic recombination) in
addition to the
previously discussed recombinations within the
rbcLX locus (intragenic
recombination).
Possible mechanisms for exchange of genetic material.
Transformation is so far the only known biological mechanism for
exchange of chromosomal DNA in cyanobacteria (19). For incorporating DNA into the genome, homologous recombination is a
ubiquitous mechanism in eubacteria (19). For homologous
recombination in Escherichia coli, there is a sharp decline
in the number of recombinants with decreasing sequence identity.
Compared to the frequencies for a fragment with 100% similarity in a
400-bp region, there were 42- and 300-fold decreases of cointegrate
formation for fragments with 90% and 65 to 70% identity, respectively
(30). Accordingly, stable exchange of genetic information
solitarily within closely related groups of cyanobacteria observed in
this work can be explained by homologous recombination frequencies (20).
However, there are also other possible mechanisms for genetic exchange
solitarily within genetically clustered groups. These
mechanisms
involve, for example, conjugation, transducing bacteriophages,
simultaneous competence, recognition sequence, restriction modification
barriers, or codon usage (
19). The exchange of genetic
information
could also be an intrinsic property of the
rbcLX
locus and not
a general mechanism. The knowledge of the physiology and
genetics
involved in the process of exchange of genetic material is,
however,
limited to a few microorganisms mainly of medical interest.
Further
studies addressing these mechanisms in aquatic organisms and
habitats
are necessary (
19).
Models for explaining the sequence homogeneity within the
phyletically clustered groups of organisms.
The most restrictive
explanation for the sequence homogeneity within the clustered groups of
organisms is that each cluster has evolved relatively recently
from their common ancestors. However, recent common ancestors cannot
explain the differences in relative evolutionary rates within, as
opposed to among, the genetically clustered groups for rbcX
compared to 16S rDNA. In Nostoc lineages I and II, the
rbcX divergence between, relative to within the clusters, is
3 to 3.5, while for 16S rDNA this ratio is 0.2 to 1.5 (this effect is
not as profound for the rbcL locus, because LSU is highly
conserved by function). Presupposing a recent common ancestor, one
should expect the opposite result of what we observed (i.e., lower
ratios for rbcX compared to 16S rDNA). This is because the
neutral sites in protein-coding sequences are relatively rapidly saturated by mutations, leading to a slower evolutionary rate for
distantly related species than for closely related species (17). rRNA, on the other hand, has a high degree of
functional constancy, resulting in a relative clock-like evolutionary
rate (i.e., similar rates for closely and distantly related strains) (37).
The high level of neutral mutations compared to replacement mutations
both within and among the clustered groups argues against
periods of
positive selection, e.g., in a speciation process (
22).
Although periods of positive selection can explain both the resemblance
of the fossil and the recent species and the DNA sequence homogeneity
within the clusters, these mechanisms cannot be used as an explanation
model for the phyletic clustering of the modern species.
Concerted evolution, however, can be used as a possible
model for the phyletic clustering of the modern species.
Furthermore,
concerted evolution can be explained by the genetic
exchange within
the clustered groups, as inferred from our data. The
high degree
of sequence similarity for strains within, as opposed to
between,
the groups for the
rbcX gene is according to this
model caused
by a relatively higher frequency of transfer of genetic
material
for this locus compared to 16S rDNA. This argument is also
supported
by the fact that 16S rRNA is encoded by multicopy genes and
that
it interacts in a large macromolecular assembly. rRNA is probably
more resistant to gene exchange than assemblies which are encoded
in a
single operon, such as the
rbcLXS operon.
Macroevolution of cyanobacterial characters.
In the fossil
records, stasis
evolutionary lineages that persist for long
periods without change of macroevolutionary (morphological) characters
is common. This led to the theory about punctuated equilibrium, stating that macroevolutionary characters are stable for
long time periods, interrupted by short periods of their abrupt changes
(12). However, for molecular characters (amino and nucleic acid sequences), the comparison between the time of divergence and the
molecular divergence for different species gave rise to the neutral
theory of molecular evolution (17). This theory, in
contrast, states that the evolution of molecular characters is gradual
and clock-like. Although not currently widely accepted, a view of
macroevolution
phyletic gradualism
is that morphological characters
also can evolve in a gradual fashion (29).
Fossil specimens of cyanobacteria are in many cases rather well
preserved, providing similar characters used for the microscopical
identification of living species. Of particular interest are organisms
with distinct morphological features, such as some species in
the
taxonomic group
Entophysalidaceae. Golubic and Hofmann
(
11)
compared a 2.2-billion-year-old specimen with two
modern
Entophysalis species. They showed that the fossil and
the modern species are
morphologically comparable (in cell shape and in
the form and
arrangement of originally mucilaginous cellular
envelopes). Both
the fossil and the current species form
microtexturally similar
stromatolitic structures in comparable
intertidal to shallow marine
environmental settings. Taken together,
the data provide relevant
evidence that the fossil cyanobacteria were
homologs and not analogs
to the recent species.
However, this contradicts the presumed 2-billion-year-old common
ancestor of prokaryotes and eukaryotes (
5). Nevertheless,
this estimate has lately been criticized by several authors as
an
underestimate (
10,
13). Based on our data, we propose
an
alternative explanation model for this discrepancy. We suggest
that
only the highly conserved genes used in the estimations could
share
approximately 2-billion-year-old common ancestors (as discussed
below).
Preservation of macroevolutionary characters by exchange of genetic
material for neutrally evolving genes.
The work of Stulp
(34) has shown that organisms belonging to Nostoc
lineage I can occupy different distinct ecological niches, which
indicates that they may have diverged by selection for some characters
while still exchanging genetic material at the rbcLX locus.
Although not thoroughly investigated, this is probably also the case
for the other phyletically clustered groups of organisms defined in
this work.
Based on a theoretical model, Cohan (
2,
3) has deduced that
a relatively high level (in prokaryotic terms) of genetic
exchange allows differentiation of ecologically selective
genes
while maintaining ongoing exchange of genetic material for
neutrally
evolving genes. In this regard, the
rbcLX locus
examined in this
work has the evolutionary pattern expected for a
neutral gene
locus. Our molecular results show that the divergence
between
the different bacterial groups (e.g.,
Nostoc
lineages I, II, and
III) for the
rbcLX locus has mainly been
caused by neutral mutations,
suggesting homogenization within these
groups through neutral
gene exchange.
In general, mutations in neutrally evolving genes are most likely to be
either indifferent or negative (
17). Harmful mutations
are
removed by selection, while slightly negative mutations may
become
fixed in the population through linkage with positive mutations
or
through genetic drift. It is interesting that proteins encoded
by
neutrally evolving genes can diverge with more than 70% amino
acid
substitutions and still have a conserved function and three-dimensional
structure (
24). Thus, there has to exist a strong selection
pressure to maintain protein structure and function. The mechanisms
responsible for conserving protein structure and function are
not
likely to be fundamentally different from the mechanisms conserving
macroevolutionary characters, because macroevolutionary characters
reflect protein function and structure at a higher level of complexity.
In terms of neutrally evolving genes, the major obstacle is then
to
protect the structure and function of the gene products from
being lost
by fixation of slightly negative mutations in the population.
The
exchange of genetic material could therefore be a means of
protecting
what has been invented during billions of years of
evolution from being
lost by random events. This can contribute
to explain the apparent
stability of macroevolutionary (morphological)
characters, perhaps over
billions of years (
28).
An interesting interpretation of the results of Doolittle et al.
(
5), in light of our results, is that the neutral evolving,
highly conserved genes used in their calculations shared
approximately
2-billion-year-old common ancestors because of exchange
of genetic
material (see discussion above), while these organisms had
diverged
at their adaptive genes, giving them different phenotypes.
Exchange
of genetic material for neutrally evolving genes should be a
serious
concern for dating prokaryotic divergence by use of molecular
clocks, especially clocks calibrated based on eukaryotic species.
Morphological and molecular clustering of modern
cyanobacteria.
Finally, we suggest that the morphological
clustering of the living cyanobacteria reflects stability through
structure and function of relevant characters. The DNA sequence
clustering is a result of sequence homogenization and concerted
evolution by exchange of genetic material for neutrally evolving genes.
Those conclusions are in accordance with both the theory of punctuated equilibrium and the neutral theory of molecular evolution.
 |
ACKNOWLEDGMENTS |
This work was part of a research project granted to K.S.J. (grant
107622/420) by the Norwegian Research Council.
We thank Randi Skulberg, Norwegian Institute for Water Research, for
excellent work in cultivating the cyanobacteria and Frank Larsen, Dynal
A.S., for use of sequencing facilities and laboratory equipment. We are
grateful to Zebo Huang, Institute of Hydrobiology, Chinese Academy of
Science, Wuhan, for providing the strains of N. commune and
N. flagelliforme. We thank William Davies and John G. Ormerod for comments on the manuscript, Per Erik Jorde for help with
statistical analysis, and Arne Holst Jensen for help with the
phylogenetic analyses. Finally, we are grateful to two anonymous
reviewers for helpful comments and suggestions on the manuscript.
 |
FOOTNOTES |
*
Corresponding authors. Mailing address: Division of
General Genetics, Department of Biology, University of Oslo, P.O. Box 1031 Blindern, 0315 Oslo, Norway. Fax: 47.22.85.46.05. Phone and E-mail
for K. Rudi: 47.22.85.45.73 and
knut.rudi{at}bio.uio.no. Phone and E-mail for K. S. Jakobsen: 47.22.85.46.02 and
kjetill.jakobsen{at}bio.uio.no.
 |
REFERENCES |
-
Castenholz, R. W.
(1992)
Species usage, concept, and evolution in the cyanobacteria (blue-green algae).
J. Phycol.
28,
737-745.
-
Cohan, F. M.
(1994)
The effects of rare but promiscuous genetic exchange on evolutionary divergence in procaryotes.
Am. Nat.
143,
965-986.
-
Cohan, F. M.
(1995)
Does recombination constrain neutral divergence among bacterial taxa?
Evolution
49,
164-175.
-
Dayhoff, M. O.,
and Orcutt, B. C.
(1979)
Methods for identifying proteins by using partial sequences.
Proc. Natl. Acad. Sci. USA
76,
2170-2174[Abstract/Free Full Text].
-
Doolittle, R. F.,
Feng, D. F.,
Tsang, S.,
Cho, G.,
and Little, E.
(1996)
Determining divergence times of the major kingdoms of living organisms with a protein clock.
Science
271,
470-477[Abstract].
-
DuBose, R. F.,
Dykhuizen, D. E.,
and Hartl, D. L.
(1988)
Genetic exchange among natural isolates of bacteria: recombination within the phoA gene of Escherichia coli.
Proc. Natl. Acad. Sci. USA
85,
7036-7040[Abstract/Free Full Text].
-
Eldredge, N.,
and Gould, S. J.
(1972)
Punctuated equilibria: an alternative to phyletic gradualism
in
Models in paleobiology. (Schopf, T. J. M., ed), pp. 82-115, Freeman, Cooper, & Co., San Francisco, Calif.
-
Felsenstein, J.
(1985)
Confidence limits on phylogenies: an approach using the bootstrap.
Evolution
39,
783-791.
-
Fitch, W. M.
(1977)
On the problem of discovering the most parsimonious tree.
Am. Nat.
111,
223-257.
-
Gogarden, J. P.,
Olendzenski, L.,
Hilario, E.,
Simon, C.,
and Holsinger, K. E.
(1996)
Dating the cenancester of organisms.
Science
274,
1750-1751[Medline].
-
Golubic, S.,
and Hofmann, H. J.
(1976)
Comparison of Holocene and mid-Precambrian Entophysalidaceae (Cyanophyta) in stromatolitic algal mats: cell division and degradation.
J. Paleontol.
50,
1074-1082.[Abstract]
-
Gould, S. J.,
and Eldredge, N.
(1993)
Punctuated equilibrium comes of age.
Nature
366,
223-227.
-
Hasegawa, M.,
and Fitch, W. M.
(1996)
Dating the cenancester of organisms.
Science
274,
1750.
-
Higgins, D. G.,
and Sharp, P. M.
(1989)
Fast and sensitive multiple sequence alignments on a microcomputer.
CABIOS
5,
151-153.[Abstract/Free Full Text]
-
Hillis, D. M.,
and Huelsenbeck, J. P.
(1992)
Signal, noise, and reliability in molecular phylogenetic analyses.
J. Hered.
83,
189-195[Abstract/Free Full Text].
-
Kimura, M.
(1980)
A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.
J. Mol. Evol.
16,
111-120[Medline].
-
Kimura, M.
(1983)
The neutral theory of molecular evolution
in
Evolution of genes and proteins. (Nei, M., and Koehn, R. K., eds), pp. 208-233, Sinauer Associates, Sunderland, Mass.
-
Li, L. A.,
and Tabita, R.
(1997)
Maximum activity of recombinant ribulose 1,5-bisphosphate carboxylase/oxygenase of Anabaena sp. strain CA requires the product of the rbcX gene.
J. Bacteriol.
179,
3793-3796[Abstract/Free Full Text].
-
Lorenz, M. G.,
and Wackernagel, W.
(1994)
Bacterial gene transfer by natural genetic transformation in the environment.
Microbiol. Rev.
58,
563-602[Abstract/Free Full Text].
-
Matic, I.,
Rayssiguier, C.,
and Radman, M.
(1995)
Interspecies gene exchange in bacteria: the role of SOS and mismatch repair systems in evolution of species.
Cell
80,
507-515[Medline].
-
McGuire, G.,
Wright, F.,
and Prentice, M. J.
(1997)
A graphical method for detecting recombination in phylogenetic data sets.
Mol. Biol. Evol.
14,
1125-1131[Abstract].
-
Messier, W.,
and Stewart, C. B.
(1997)
Episodic adaptive evolution of primate lysozymes.
Nature
385,
151-154[Medline].
-
Pasternak, J. J.,
and Glick, B. R.
(1991)
Molecular evolutionary analyses of the small and large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase.
Can. J. Bot.
70,
715-723.
-
Rost, B.,
and Sander, C.
(1996)
Bridging the protein sequence-structure gap by structure predictions.
Annu. Rev. Biophys. Biomol. Struct.
25,
113-136[Medline].
-
Rudi, K.,
Kroken, M.,
Dahlberg, O. J.,
Deggerdal, A.,
Jakobsen, K. S.,
and Larsen, F.
(1997)
Rapid, universal method to isolate PCR-ready DNA using magnetic beads.
BioTechniques
22,
506-511.[Medline]
-
Rudi, K.,
Skulberg, O. M.,
Larsen, F.,
and Jakobsen, K. S.
(1997)
Strain characterization and classification of oxyphotobacteria in clone cultures on the basis of 16S rRNA sequences from the variable regions V6, V7, and V8.
Appl. Environ. Microbiol.
63,
2593-2599[Abstract].
-
Saitou, N.,
and Nei, M.
(1987)
The neighbor-joining method: a new method for reconstructing phylogenetic trees.
Mol. Biol. Evol.
4,
406-425[Abstract].
-
Schopf, J. W.
(1996)
Are the oldest fossils cyanobacteria?
in
Evolution of microbial life. (Roberts, D. M., Sharp, P., Alderson, G., and Collins, M., eds), pp. 23-61, Cambridge University Press, Cambridge, England.
-
Sheldon, P. R.
(1987)
Parallel gradualistic evolution of Ordovician trilobites.
Nature
330,
561-563[Medline].
-
Shen, P.,
and Huang, H. V.
(1986)
Homologous recombination in Escherichia coli: dependence on substrate length and homology.
Genetics
112,
441-457[Abstract/Free Full Text].
-
Skulberg, O. M.,
Carmichael, W. W.,
Codd, G. A.,
and Skulberg, R.
(1993)
Taxonomy of toxic Cyanophyceae (cyanobacteria)
in
Algal toxins in seafood and drinking water. (Falconer, J. R., ed), pp. 145-164, Academic Press Ltd., London, England.
-
Skulberg, O. M., and R. Skulberg. 1997. Personal
communication.
-
Skulberg, R.,
and Skulberg, O. M.
(1990)
Forskning med algekulturer.-NIVAs kultursamling av alger. Research with algal cultures.-NIVA's Culture Collection of Algae., Norsk institutt for vannforskning, Oslo, Norway.
-
Stulp, B. K.
(1983)
Morphological and molecular approaches to the taxonomy of the genus Anabaena (Cyanophyceae, Cyanobacteria)., Drukkerij van Denderen B.V., Groningen, Germany.
-
Stephens, J. C.
(1985)
Statistical methods of DNA sequence analysis: detection of intragenic recombination or gene conversion.
Mol. Biol. Evol.
2,
539-556[Abstract].
-
Templeton, A. R.
(1983)
Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and the apes.
Evolution
37,
221-244.
-
Woese, C. R.
(1987)
Bacterial evolution.
Microbiol. Rev.
51,
221-271[Free Full Text].
Copyright © 1998 by American Society for Microbiology
This article has been cited by other articles:
-
Tooming-Klunderud, A., Mikalsen, B., Kristensen, T., Jakobsen, K. S.
(2008). The mosaic structure of the mcyABC operon in Microcystis. Microbiology
154: 1886-1899
[Abstract]
[Full Text]
-
Rounge, T. B., Rohrlack, T., Tooming-Klunderud, A., Kristensen, T., Jakobsen, K. S.
(2007). Comparison of Cyanopeptolin Genes in Planktothrix, Microcystis, and Anabaena Strains: Evidence for Independent Evolution within Each Genus. Appl. Environ. Microbiol.
73: 7322-7330
[Abstract]
[Full Text]
-
Tooming-Klunderud, A., Rohrlack, T., Shalchian-Tabrizi, K., Kristensen, T., Jakobsen, K. S.
(2007). Structural analysis of a non-ribosomal halogenated cyclic peptide and its putative operon from Microcystis: implications for evolution of cyanopeptolins. Microbiology
153: 1382-1393
[Abstract]
[Full Text]
-
Emlyn-Jones, D., Woodger, F. J., Price, G. D., Whitney, S. M.
(2006). RbcX Can Function as a Rubisco Chaperonin, But is Non-Essential in Synechococcus PCC7942. Plant Cell Physiol
47: 1630-1640
[Abstract]
[Full Text]
-
Zhaxybayeva, O., Gogarten, J. P., Charlebois, R. L., Doolittle, W. F., Papke, R. T.
(2006). Phylogenetic analyses of cyanobacterial genomes: Quantification of horizontal gene transfer events. Genome Res
16: 1099-1108
[Abstract]
[Full Text]
-
Lyra, C., Laamanen, M., Lehtimaki, J. M., Surakka, A., Sivonen, K.
(2005). Benthic cyanobacteria of the genus Nodularia are non-toxic, without gas vacuoles, able to glide and genetically more diverse than planktonic Nodularia. Int. J. Syst. Evol. Microbiol.
55: 555-568
[Abstract]
[Full Text]
-
Rajaniemi, P., Hrouzek, P., Kastovska, K., Willame, R., Rantala, A., Hoffmann, L., Komarek, J., Sivonen, K.
(2005). Phylogenetic and morphological evaluation of the genera Anabaena, Aphanizomenon, Trichormus and Nostoc (Nostocales, Cyanobacteria). Int. J. Syst. Evol. Microbiol.
55: 11-26
[Abstract]
[Full Text]
-
Thacker, R. W., Paul, V. J.
(2004). Morphological, Chemical, and Genetic Diversity of Tropical Marine Cyanobacteria Lyngbya spp. and Symploca spp. (Oscillatoriales). Appl. Environ. Microbiol.
70: 3305-3312
[Abstract]
[Full Text]
-
Fujishiro, T., Ogawa, T., Matsuoka, M., Nagahama, K., Takeshima, Y., Hagiwara, H.
(2004). Establishment of a Pure Culture of the Hitherto Uncultured Unicellular Cyanobacterium Aphanothece sacrum, and Phylogenetic Position of the Organism. Appl. Environ. Microbiol.
70: 3338-3345
[Abstract]
[Full Text]
-
Welker, M., Brunke, M., Preussel, K., Lippert, I., von Dohren, H.
(2004). Diversity and distribution of Microcystis (Cyanobacteria) oligopeptide chemotypes from natural communities studied by single-colony mass spectrometry. Microbiology
150: 1785-1796
[Abstract]
[Full Text]
-
Mikalsen, B., Boison, G., Skulberg, O. M., Fastner, J., Davies, W., Gabrielsen, T. M., Rudi, K., Jakobsen, K. S.
(2003). Natural Variation in the Microcystin Synthetase Operon mcyABC and Impact on Microcystin Production in Microcystis Strains. J. Bacteriol.
185: 2774-2785
[Abstract]
[Full Text]
-
Baker, J. A., Entsch, B., Neilan, B. A., McKay, D. B.
(2002). Monitoring Changing Toxigenicity of a Cyanobacterial Bloom by Molecular Methods. Appl. Environ. Microbiol.
68: 6070-6076
[Abstract]
[Full Text]
-
Dyble, J., Paerl, H. W., Neilan, B. A.
(2002). Genetic Characterization of Cylindrospermopsis raciborskii (Cyanobacteria) Isolates from Diverse Geographic Origins Based on nifH and cpcBA-IGS Nucleotide Sequence Analysis. Appl. Environ. Microbiol.
68: 2567-2571
[Abstract]
[Full Text]
-
Rudi, K., Fossheim, T., Jakobsen, K. S.
(2002). Nested Evolution of a tRNALeu(UAA) Group I Intron by both Horizontal Intron Transfer and Recombination of the Entire tRNA Locus. J. Bacteriol.
184: 666-671
[Abstract]
[Full Text]
-
Tillett, D., Parker, D. L., Neilan, B. A.
(2001). Detection of Toxigenicity by a Probe for the Microcystin Synthetase A Gene (mcyA) of the Cyanobacterial Genus Microcystis: Comparison of Toxicities with 16S rRNA and Phycocyanin Operon (Phycocyanin Intergenic Spacer) Phylogenies. Appl. Environ. Microbiol.
67: 2810-2818
[Abstract]
[Full Text]
-
Barker, G. L. A., Handley, B. A., Vacharapiyasophon, P., Stevens, J. R., Hayes, P. K.
(2000). Allele-specific PCR shows that genetic exchange occurs among genetically diverse Nodularia (Cyanobacteria) filaments in the Baltic Sea. Microbiology
146: 2865-2875
[Abstract]
[Full Text]
-
Rudi, K., Skulberg, O. M., Skulberg, R., Jakobsen, K. S.
(2000). Application of Sequence-Specific Labeled 16S rRNA Gene Oligonucleotide Probes for Genetic Profiling of Cyanobacterial Abundance and Diversity by Array Hybridization. Appl. Environ. Microbiol.
66: 4004-4011
[Abstract]
[Full Text]
-
Shirkey, B., Kovarcik, D. P., Wright, D. J., Wilmoth, G., Prickett, T. F., Helm, R. F., Gregory, E. M., Potts, M.
(2000). Active Fe-Containing Superoxide Dismutase and Abundant sodF mRNA in Nostoc commune (Cyanobacteria) after Years of Desiccation. J. Bacteriol.
182: 189-197
[Abstract]
[Full Text]
-
Beard, S. J., Handley, B. A., Hayes, P. K., Walsby, A. E.
(1999). The diversity of gas vesicle genes in Planktothrix rubescens from Lake Zurich. Microbiology
145: 2757-2768
[Abstract]
[Full Text]