Previous Article | Next Article ![]()
J Bacteriol, July 1998, p. 3517-3521, Vol. 180, No. 14
Department of Microbiology, University of
Illinois at Urbana-Champaign, Urbana, Illinois
61801,1 and
Department of Biological
Sciences, Mankato State University, Mankato, Minnesota
560022
Received 23 February 1998/Accepted 3 May 1998
Salmonella typhimurium apeR mutations lead to
overproduction of an outer membrane-associated N-acetyl
phenylalanine Mutations at the apeA
locus of Salmonella typhimurium lead to loss of a
periplasmic enzyme originally identified by its ability to hydrolyze
the chromogenic substrate N-acetyl phenylalanine We have previously described the isolation of pseudorevertants of
S. typhimurium apeA mutations that lead to restoration of the ability to hydrolyze NAPNE (6). These mutants
overproduce a membrane-associated enzyme which is distinct from ApeA
and all other known NAPNE hydrolases (12). The mutations
affect a locus, apeR, that appears to encode a negative
regulator of the transcription of the membrane hydrolase which is
thought to be the product of the apeE gene (6).
To further characterize this membrane hydrolase, we report the cloning
and nucleotide sequence of the apeE gene and further
characterization of the enzymatic activity of its product, ApeE.
Bacterial strains.
Table 1
lists the S. typhimurium LT2 strains used in this project.
Other strains used were Photorhabdus luminescens K122 (obtained from Barbara Dowds, St. Patrick's College, County Kildare, Ireland), Pseudomonas aeruginosa K (obtained from David
Nunn, University of Illinois), and derivatives of E. coli
K-12.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The apeE Gene of Salmonella
typhimurium Encodes an Outer Membrane Esterase Not Present in
Escherichia coli

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
-naphthyl ester-cleaving esterase that is encoded by
the apeE gene (P. Collin-Osdoby and C. G. Miller, Mol.
Gen. Genet. 243:674-680, 1994). This paper reports the cloning and
nucleotide sequencing of the S. typhimurium apeE gene as
well as some properties of the esterase that it encodes. The predicted
product of apeE is a 69.9-kDa protein which is processed to
a 67-kDa species by removal of a signal peptide. The predicted amino
acid sequence of ApeE indicates that it is a member of the GDSL family
of serine esterases/lipases. It is most similar to a lipase excreted by
the entomopathogenic bacterium Photorhabdus luminescens.
The Salmonella esterase catalyzes the hydrolysis of a
variety of fatty acid naphthyl esters and of C6 to
C16 fatty acid p-nitrophenyl esters but will
not hydrolyze peptide bonds. A rapid diagnostic test reported to be
useful in distinguishing Salmonella spp. from related
organisms makes use of the ability of Salmonella to
hydrolyze the chromogenic ester substrate methyl umbelliferyl
caprylate. We report that the apeE gene product is the
enzyme in Salmonella uniquely responsible for the
hydrolysis of this substrate. Southern blot analysis indicates that
Escherichia coli K-12 does not contain a close analog of
apeE, and it appears that the apeE gene is
contained in a region of DNA present in Salmonella but not
in E. coli.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
-naphthyl ester (NAPNE) (17). Mutants with a reduced
capacity for NAPNE hydrolysis are easily isolated by using this
substrate to detect activity in situ in bacterial colonies growing on
an agar surface. NAPNE is a good substrate for chymotrypsin, and ApeA
was originally thought to be a protease, protease I (19, 20). Recent work indicates that the Escherichia coli
apeA product is a thioesterase (4), and the gene is now
designated tesA.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
TABLE 1.
Bacterial strains and plasmids used
Media and growth conditions. S. typhimurium and E. coli strains were routinely grown at 37°C in Luria broth medium (Gibco BRL) aerated by shaking. P. luminescens was grown under the same conditions but at 28°C. Antibiotics were added as indicated in the following concentrations: ampicillin, 50 mg/ml; chloramphenicol, 15 mg/ml; and tetracycline, 25 mg/ml (18). Minimal (E min) soft agar overlays were prepared from E medium (30) with 0.8% Difco agar.
Isolation of plasmids carrying apeE. Plasmids containing 8- to 15-kb fragments generated by Sau3A partial digestion of DNA from S. typhimurium TN1379 and inserted into the BamHI site of pBR328 were transformed into strain TN2540. To screen this library, a P22HT 12/4 int-3 lysate was made on the library and used to transduce TN445, an apeA apeE+ apeR+ strain, with selection for chloramphenicol resistance. These transductants were screened for NAPNE-hydrolyzing activity by overlaying the transduction plate with 2.5 ml of E min soft agar; after solidification, 10 ml of a mixture containing 0.1 M phosphate buffer (pH 6.8), 10 mg of Fast Garnet GBC (Sigma), and 2 mg of NAPNE in N,N-dimethylformamide (final concentration is 10%) was poured over the plate, and the plate was incubated at room temperature for about 1 min. The plates were then washed with sterile saline, and any NAPNE-staining clones were picked and restreaked.
Subcloning.
Subclones of pCM342 were obtained by partial
digestion of the plasmid with Sau3A, ligation into the
BamHI site of pBR328, and electroporation into E. coli DH5
. The transformants were stained for activity as
described above and restreaked. Although DH5
is
apeA+, it is easy to distinguish the dark red
color of a colony containing an apeE plasmid from the pink
color of the parental colony. The presence of an apeE
plasmid in the red-staining strains was confirmed by staining sodium
dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gels
for NAPNE activity after renaturation (see below).
DNA sequencing. DNA sequencing was carried out with a Sequenase version 2.0 DNA sequencing kit (U.S. Biochemicals) according to manufacturer's instructions. Compressed areas were resolved by automated cycle sequencing by the University of Illinois Biotechnology Center. The DNA was completely sequenced in both strands. Sequence alignment and analysis were carried out with the Wisconsin sequence analysis package (Genetics Computer Group [GCG]) and the Lasergene software DNAstar.
Southern hybridization. DNA fragments were transferred to Immobilon N (Millipore) according to the manufacturer's instructions, using a TransVac Blot apparatus (Hoefer) with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) as the transfer buffer. The DNA was cross-linked to the membrane by UV irradiation as specified by the instructions for the UV cross-linker apparatus.
Hybridization probes were generated by PCR using primers synthesized by the University of Illinois Biotechnology Center. The 2.1-kb apeE-specific probe was constructed by using primers apee3 (5'GCTCCATTATCTGCCTGT3'; bases 813 to 830) and apee17 (5'TAGCTCCAACTGACGAAAT3'; bases 2913 to 2931). The 429-bp probe specific for sequence upstream from apeE was constructed by first generating a 1.1-kb PCR product by using primers BamHIccw (5'CGAATTCATGCGTCCGGCGTAGA3'; located in vector sequence) and apee18 (5'CCGTTTCCGCCGACCCAGTGA3'; bases 1126 to 1106). This product was then cut with SmaI, and the 429-bp fragment (corresponding to bases 1 to 429) was purified by using a Geneclean II kit (Bio 101) according to manufacturer's instructions. Probes were labeled by random priming according to manufacturer's directions, using the Multiprime DNA labeling system (Amersham). Hybridization was carried out by using standard procedures (16) with 4× SSC in the prehybridization and hybridization solutions. Probes were hybridized overnight at 50°C and washed as follows: 1× SSC-1% SDS at room temperature for 1 min, 1× SSC-1% SDS at 50°C for 1 h, 0.5× SSC-1% SDS at 50°C for 1 h, and 0.1× SSC-0.2% SDS at 50°C for 1 h.Preparation of cell extracts.
Bacteria were grown to an
optical density at 600 nm of 0.6 to 0.8 and harvested by low-speed
centrifugation at 4°C for 10 min. The cell pellets were washed twice
with 50 mM Tris-HCl (pH 7.5) (Tris buffer) and resuspended in 1/50 the
original culture volume of Tris buffer. The cells were disrupted by
sonication (Branson Sonifier 250, microtip) for 1 min and spun at
40,000 × g for 40 min at 4°C. The supernatant was
kept as crude cell extract and stored at
70°C. SDS membrane
extracts were prepared by resuspension of the pellet in 1/50 the
original culture volume of 3% SDS in 50 mM phosphate buffer (pH 8.0),
incubation at 100°C for 10 min, and centrifugation at 40,000 × g for 40 min at room temperature. The supernatant was
removed and designated SDS-soluble membrane extract. Triton X-100
membrane extracts were prepared by extracting the pellet with 1/50 the
original culture volume of 2% Triton X-100 in 50 mM phosphate buffer
(pH 8.0) (phosphate buffer). After a 30-min incubation at room
temperature, the extract was diluted in half by addition of an equal
volume of phosphate buffer and spun at 40,000 × g at
4°C for 40 min. The supernatant was designated 1% Triton-soluble
membrane extract and was used for all enzyme assays unless indicated
otherwise. This procedure extracts about 25 to 35% of the
NAPNE-hydrolyzing activity present in membranes of apeR
mutant strains. Extracts of membranes prepared from strains carrying
apeE mutations contained no esterase activity.
Enzyme assays. Hydrolysis of NAPNE was monitored spectrophotometrically essentially as described previously (20). The effects of inhibitors on hydrolysis rates were determined by mixing the inhibitor and enzyme, incubating the mixture for 30 min at room temperature, adding substrate, and monitoring the hydrolysis rate.
Gel electrophoresis. Six percent nondenaturing polyacrylamide 0.75-mm slab gels were run at 4°C according to the method of Davis (7) except that the stacking gel was omitted. The gels were run at 100 V until the tracking dye entered the gel and then at 250 V until the dye reached the end of the gel. The gels were soaked in deionized water for 30 min and then placed in 100 ml of NAPNE stain solution (90 ml of 0.1 M phosphate buffer [pH 6.8] with 10 mg of Fast Garnet GBC [Sigma] and 10 ml of NAPNE solution [0.2 mg/ml in N,N-dimethylformamide]). The gel was soaked in stain for 5 to 20 min until bands were apparent. The effects of inhibitors (except diisopropylfluorophospate [DFP]) on NAPNE hydrolysis after gel electrophoresis were determined by soaking the gel in the inhibitor solution for 30 min at room temperature and then staining as described above. For DFP, the enzyme was incubated with the inhibitor for 60 min at room temperature and the resulting gel was stained for activity.
Gels were subjected to SDS-PAGE according to the method of Laemmli (15), with the following modifications. Samples were suspended in SDS loading buffer lacking a reducing agent and heated to 55°C for 2 min before loading. After electrophoresis, gels were renatured by soaking in a solution of 1% glycerol-1% Triton X-100-50 mM Tris (pH 7.5) for 30 min. The gels were then stained as described above for nondenaturing gels. Tris-Tricine SDS-polyacrylamide gels were run according to the method of Schagger and von Jagow (23). Samples were mixed with SDS sample buffer and incubated at 100°C for 10 min before loading. These gels were then stained with Coomassie blue.Electroblotting. SDS-polyacrylamide gels were transferred to a ProBlot membrane (Applied Biosystems) with an Electroblot apparatus (Trans Blot) according to manufacturer's instructions, using 10 mM 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS; pH 11.0)-10% methanol as a transfer buffer.
N-terminal sequencing. N-terminal sequence was determined by the University of Illinois Biotechnology Center, by using an Applied Biosystems (Perkin-Elmer) model 477A Protein/Peptide Sequencer with a model 120A on-line phenylthiodydantoin analyzer.
Nucleotide sequence accession number. The DNA sequence presented here is accessible from the GenBank database under accession no. AF047014.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Cloning of the apeE locus.
To isolate clones
carrying the apeE gene, plasmids from a pBR328 chromosomal
DNA library prepared from strain TN1379 (apeA+
apeE+ apeR+) were transduced into TN445
(apeA apeE+ apeR+) and TN925
(apeA apeE apeR), and the resulting colonies were screened
to identify those able to hydrolyze NAPNE. All NAPNE-hydrolyzing colonies were tested by using nondenaturing PAGE followed by NAPNE staining to determine whether they contained ApeA (protease I) or ApeE
(see Materials and Methods). A single isolate containing ApeE was
identified. This isolate contained plasmid pCM342, which was
characterized further. This plasmid was found in the TN445 (apeR+) background, and no plasmids carrying
apeE were found in the apeR mutant strain.
Subsequent experiments indicated that transfer of pCM342 to an
apeR background produced small, slow-growing colonies, suggesting that this level of overproduction of ApeE is toxic. Restriction mapping showed that pCM342 contained an 8.3-kb insert. Sau3A partial digests of pCM342 were generated, cloned into
pBR328, and transformed into E. coli DH5
. Screening these
transformants for elevated NAPNE-hydrolyzing activity led to the
isolation of pCM343, a plasmid with a 3.3-kb insert.
Nucleotide sequence of apeE. The entire insert DNA in pCM343 was sequenced. An additional 281 bp of the pCM342 insert immediately adjacent to this sequence was also determined, for a total of 3,536 bp. The sequence contained an open reading frame (ORF) consistent with the size predicted for apeE, based on SDS-PAGE of the ApeE enzymatic activity (approximately 60 kDa [5]). This ORF (bp 759 to 2729) predicts a 69.9-kDa protein. The predicted N-terminal amino acid sequence (positions 1 to 25) resembles a signal peptide, and since ApeE is a membrane-associated activity, we expected that the Ala-X-Ala sequence at amino acids 23 to 25 might serve as a signal peptidase cleavage site. This prediction was confirmed by N-terminal sequence analysis of the mature protein, which showed that it carries an N-terminal amino acid sequence beginning with amino acid 26. The predicted molecular mass of the mature protein (67.3 kDa) is somewhat larger than that estimated from SDS-PAGE (60 kDa). The C-terminal region of the protein conforms strikingly to the pattern noted for other outer membrane proteins (25) which contain hydrophobic amino acids at positions 1, 3, 5, 7, and 9 from their C termini. The C-terminal amino acid of ApeE is phenylalanine, and hydrophobic amino acids are located at positions 3, 5, 7, and 9 from the C terminus.
A search of GenBank using the BLAST program turned up another protein with strong similarity to ApeE. This protein (LipI; GenBank accession no. P40601) is an extracellular lipase from P. luminescens, an entomopathogenic member of the family Enterobacteriaceae (31). These predicted proteins show 41% amino acid sequence identity and 62% similarity (Fig. 1). The two proteins are approximately the same length (656 [Salmonella] and 645 [Photorhabdus] amino acids for the unprocessed proteins), and regions of identity and strong similarity extend throughout the sequences. An ORF of unknown function located between the trpE and the trpGDC genes of Pseudomonas putida (10) has a product that also shows significant similarity to ApeE. Alignment of the two sequences using the GCG Gap program revealed 49.5% similarity and 29% identity. A number of conserved regions could be identified by aligning ApeE, LipI, and the Pseudomonas ORF product. Although E. coli does not appear to have an apeE gene (see below), it does contain an ORF (YHJY_ECOLI; accession no. P37663) (24) whose product has significant similarity to an approximately 200-amino-acid region at the C terminus of ApeE.
|
54-dependent promoters (26). No analog of
this gene is found in E. coli. A comparison of the gene
order in this region based on the E. coli and
Salmonella sequences is shown in Fig. 2. It appears that
both apeE and ybdI are part of a segment of DNA
present in Salmonella but not in E. coli that is
inserted (relative to E. coli) between the
Salmonella homolog of ybdG and
nfsB/nfsN. The inserted DNA extends at least to the
apeE-distal end of the Salmonella DNA segment
cloned into pCM342. This indicates that the insertion in
Salmonella is at least 3 kb in length. Preliminary
experiments in which a primer sequence taken from ybdI and
another from the published S. typhimurium nfnB
(32) sequence were used to PCR amplify S. typhimurium chromosomal DNA yielded an amplified fragment of
approximately 6 kb. This implies that the insertion in S. typhimurium may be nearly 9 kb in length.
|
apeE is not present in E. coli. Although mutations that lead to overexpression of ApeE are easily isolated as NAPNE-staining pseudorevertants of S. typhimurium apeA mutations, E. coli apeA mutants do not appear to give rise to NAPNE-staining pseudorevertants (5). This result combined with the observation that apeE might be contained on a DNA segment present in Salmonella but not E. coli suggested that E. coli may not have an apeE homolog. To test this, Southern blot analysis was carried out with a probe containing only apeE coding sequence and a probe carrying the ybdG ORF known to be present in both organisms. The apeE-specific probe hybridized to both Salmonella genomic DNA and DNA from the plasmid pCM343 but not to E. coli DNA (Fig. 3). A probe consisting of the 5' ORF hybridized to chromosomal DNA from both E. coli and S. typhimurium (data not shown). We conclude that the apeE gene is not present in E. coli K-12. The sequence of the E. coli genome which appeared after this work was complete confirms that this organism does not contain an apeE homolog.
|
Substrate specificity of apeE. The ApeE activity was originally recognized by its hydrolysis of NAPNE. We have previously reported evidence suggesting that ApeE does not have proteolytic activity despite the apparent specificity of the enzyme for the amino acid residue in the ester substrate (ApeE hydrolyzes the Phe ester but not the corresponding Leu substrate [6]). To learn more about the enzyme's specificity, we tested the ability of ApeE to hydrolyze a variety of chromogenic substrates (Table 2). Since none of the naphthylamides, nitroanilides, or peptides were hydrolyzed, we tentatively conclude that the enzyme will not cleave amide bonds. Clearly the enzyme is not specific for amino acid esters since naphthyl esters of short-chain fatty acids are rapidly cleaved. Indeed, the best substrates, naphthyl butyrate and naphthyl caproate, are hydrolyzed much more rapidly than the Phe derivatives. Many of the ester substrates that were not hydrolyzed are significantly more polar than those which were. Although naphthyl esters of lauric and palmitic acid were not hydrolyzed, p-nitrophenyl palmitate is a good substrate.
|
-naphthyl butyrate at an appreciable rate. The apeE gene
designation seems clearly inappropriate since the acetyl-phenylalanine
naphthyl ester esterase activity of the gene product almost certainly
has no physiological significance. It seems reasonable to delay such a
name change, however, until a better understanding of the enzyme's specificity and function allow assignment of a meaningful mnemonic.
Hydrolysis of MUCAP.
One method for identifying
Salmonella spp. in the clinical laboratory involves the use
of methylumbelliferyl caprylate (MUCAP), a substrate that
fluoresces upon hydrolysis of the ester bond (1, 8, 11, 22).
This substrate can be used to distinguish salmonellae from other
bacteria, including Escherichia, Enterobacter, Yersinia, and Shigella spp. Colonies of
Salmonella strains TN1379, TN445, TN478, and TN925 were
tested for their abilities to hydrolyze MUCAP. All
apeE+ strains fluoresced, but TN925, an
apeE strain lacking the enzyme, did not fluoresce. In
addition, E. coli DH5
containing plasmid pCM343
fluoresced, while the same E. coli strain with pBR328, the
parent vector for pCM343, did not. These results indicate that the
apeE gene product is responsible for the hydrolysis of MUCAP
in salmonellae.
Inhibitors of ApeE.
The ability of various inhibitors to
inhibit the hydrolysis of NAPNE by ApeE was tested either by
spectrophotometric assays or by incubating the inhibitors with
nondenaturing gels through which extracts containing the activity had
been incubated prior to staining. Spectrophotometric assays showed that
none of the following inhibitors had a significant effect (>20%) on
ApeE activity: phenylmethylsulfonyl fluoride (3 mM), EDTA (0.1 M),
p-chloromercuribenzoate (10 mM), iodoacetamide (1 mM),
pepstatin A (0.25 mM), and
-mercaptoethanol (50 mM). In the gel
activity stain assay, DFP (1 mM) showed strong inhibition although a
faint band of activity could be observed after treatment with the
inhibitor. We believe that this result indicates that ApeE is DFP
sensitive. The residual activity may be a result of the failure of the
inhibitor to fully inactivate the enzyme during the incubation time
allowed, or it may represent a small fraction of the enzyme that is not
sensitive to the inhibitor (2). Under the same conditions,
none of the following had any observable effect:
N-tosyl-L-lysine chloromethyl ketone (0.5 mM), N-tosyl-L-phenylalanine chloromethyl ketone (0.5 mM), eserine (1 mM), EDTA (100 mM), bis-p-nitrophenyl
phosphate (1 mM), and N-ethylmaleimide (100 mM).
The ApeE esterase can be reactivated after SDS-PAGE.
When a
Triton X-100 extract of whole membranes containing ApeE is subjected to
SDS-PAGE and the resulting gel is incubated in a renaturation buffer
(see Materials and Methods), renatured enzyme is easily detected (data
not shown). Using the more sensitive
-naphthyl caproate substrate,
activity can be observed after electrophoresis of either boiled or
unboiled samples. The electrophoretic mobility of the activity in the
unboiled samples is somewhat greater than that observed after boiling,
suggesting that the enzyme is not completely unfolded by treatment with
SDS at room temperature.
Other enzymatic properties. When NAPNE was used as a substrate, the enzyme was found to have a pH optimum of approximately 8.0. Attempts to determine kinetic constants for this substrate were limited by its insolubility. No indication of saturation was observed at 0.15 mM NAPNE.
Physiological function of ApeE. The data that we present provide few clues concerning the physiological function of the ApeE protein. It is clearly not required for growth. It is conceivable that it is involved in the catabolism of fatty acid esters, although it is apparently not regulated by cyclic AMP receptor protein (based on the absence of a cyclic AMP receptor protein binding site in the promoter region). Preliminary experiments indicate that an apeE+ strain but not an apeE mutant utilizes Tween 80 as a sole carbon source (6a). Perhaps elucidation of the nature of the regulatory gene which controls its transcription (apeR) will provide clues concerning ApeE's physiological role.
| |
ACKNOWLEDGMENT |
|---|
This work was supported by grant AI10333 from the National Institute for Allergy and Infectious Diseases.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, University of Illinois at Urbana-Champaign, B103 CLSL, 601 S. Goodwin, Urbana, IL 61801. Phone: (217) 244-8418. Fax: (217) 244-6697. E-mail: charlesm{at}uiuc.edu.
Present address: Department of Biology, Washington University, St.
Louis, MO 63130.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Aguirre, P. M.,
J. B. Cacho,
L. Folgueira,
M. Lopez,
J. Garcia, and A. C. Velasco.
1990.
Rapid fluorescence method for screening Salmonella spp. from enteric differential agars.
J. Clin. Microbiol.
28:148-149 |
| 2. | Balls, A. K., and E. F. Jensen. 1952. Stoichiometric inhibition of chymotrypsin. Adv. Enzymol. 13:321-343. |
| 3. | Chang, R. C., J. C. Chen, and J. F. Shaw. 1995. Vibrio mimicus arylesterase has thioesterase and chymotrypsin-like activity. Biochem. Biophys. Res. Commun. 213:475-483[Medline]. |
| 4. |
Cho, H., and J. E. Cronan, Jr.
1994.
"Protease I" of Escherichia coli functions as a thioesterase in vivo.
J. Bacteriol.
176:1793-1795 |
| 5. | Collin-Osdoby, P. 1982. Studies of a regulated outer membrane esterase from Salmonella typhimurium. Ph.D. thesis. Case Western Reserve University, Cleveland, Ohio. |
| 6. | Collin-Osdoby, P., and C. G. Miller. 1994. Mutations affecting a regulated, membrane-associated esterase in Salmonella typhimurium LT2. Mol. Gen. Genet. 243:674-680[Medline]. |
| 6a. | Conlin, C. A. Unpublished data. |
| 7. | Davis, B. J. 1964. Disc electrophoresis. II. Method and application to human serum proteins. Ann. N. Y. Acad. Sci. 121:404. |
| 8. | Dealler, S. F., J. Collins, and A. L. James. 1992. A rapid heat-resistant technique for presumptive identification of Salmonella on desoxycholate-citrate agar. Eur. J. Clin. Microbiol. Infect. Dis. 11:249-252[Medline]. |
| 9. |
Debarbouille, M.,
I. Martin-Verstraete,
A. Klier, and G. Rapoport.
1991.
The transcriptional regulator LevR of Bacillus subtilis has domains homologous to both sigma 54- and phosphotransferase system-dependent regulators.
Proc. Natl. Acad. Sci. USA
88:2212-2216 |
| 10. |
Essar, D. W.,
L. Eberly, and I. P. Crawford.
1990.
Evolutionary differences in chromosomal locations of four early genes of the tryptophan pathway in fluorescent pseudomonads: DNA sequences and characterization of Pseudomonas putida trpE and trpGDC.
J. Bacteriol.
172:867-883 |
| 11. |
Freydiere, A. M., and Y. Gille.
1991.
Detection of salmonellae by using Rambach agar and by a C8 esterase spot test.
J. Clin. Microbiol.
29:2357-2359 |
| 12. | Heiman, C., and C. G. Miller. 1978. Acylaminoacid esterase mutants of Salmonella typhimurium. Mol. Gen. Genet. 164:57-62[Medline]. |
| 13. |
Hilton, S., and J. T. Buckley.
1991.
Studies on the reaction mechanism of a microbial lipase/acyltransferase using chemical modification and site-directed mutagenesis.
J. Biol. Chem.
266:997-1000 |
| 14. | Kazlauskas, R. J. 1994. Elucidating structure-mechanism relationships in lipases: prospects for predicting and engineering catalytic properties. Trends Biotechnol. 12:464-472[Medline]. (Erratum, 13:195, 1995.) |
| 15. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 16. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 17. |
Miller, C. G.,
C. Heiman, and C. Yen.
1976.
Mutants of Salmonella typhimurium deficient in an endoprotease.
J. Bacteriol.
127:490-497 |
| 18. | Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 19. | Pacaud, M., S. Sibilli, and G. Bras. 1976. Protease I from Escherichia coli. Some physicochemical properties and substrate specificity. Eur. J. Biochem. 69:141-151[Medline]. |
| 20. | Pacaud, M., and J. Uriel. 1971. Isolation and some properties of a proteolytic enzyme from Escherichia coli (protease I). Eur. J. Biochem. 23:435-442[Medline]. |
| 21. |
Robertson, D. L.,
S. Hilton,
K. R. Wong,
A. Koepke, and J. T. Buckley.
1994.
Influence of active site and tyrosine modification on the secretion and activity of the Aeromonas hydrophila lipase/acyltransferase.
J. Biol. Chem.
269:2146-2150 |
| 22. |
Ruiz, J.,
M. A. Sempere,
M. C. Varela, and J. Gomez.
1992.
Modification of the methodology of stool culture for Salmonella detection.
J. Clin. Microbiol.
30:525-526 |
| 23. | Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379[Medline]. |
| 24. |
Sofia, H. J.,
V. Burland,
D. L. Daniels,
G. R. Plunkett, and F. R. Blattner.
1994.
Analysis of the Escherichia coli genome. V. DNA sequence of the region from 76.0 to 81.5 minutes.
Nucleic Acids Res.
22:2576-2586 |
| 25. | Struyve, M., M. Moons, and J. Tommassen. 1991. Carboxy-terminal phenylalanine is essential for the correct assembly of a bacterial outer membrane protein. J. Mol. Biol. 218:141-148[Medline]. |
| 26. |
Stulke, J.,
I. Martin-Verstraete,
V. Charrier,
A. Klier,
J. Deutscher, and G. Rapoport.
1995.
The HPr protein of the phosphotransferase system links induction and catabolite repression of the Bacillus subtilis levanase operon.
J. Bacteriol.
177:6928-6936 |
| 27. | Thornton, J., S. P. Howard, and J. T. Buckley. 1988. Molecular cloning of a phospholipid-cholesterol acyltransferase from Aeromonas hydrophila. Sequence homologies with lecithin-cholesterol acyltransferase and other lipases. Biochim. Biophys. Acta 959:153-159[Medline]. |
| 28. | Upton, C., and J. T. Buckley. 1995. A new family of lipolytic enzymes? Trends Biochem. Sci. 20:178-179[Medline]. |
| 29. | Verger, R. 1980. Enzyme kinetics of lipolysis. Methods Enzymol. 64:340-392[Medline]. |
| 30. |
Vogel, H. J., and D. M. Bonner.
1956.
Acetylornithinase of Escherichia coli: partial purification and some properties.
J. Biol. Chem.
218:97-106 |
| 31. |
Wang, H., and B. C. A. Dowds.
1993.
Phase variation in Xenorhabdus luminescens: cloning and sequencing of the lipase gene and analysis of its expression in primary and secondary phases of the bacterium.
J. Bacteriol.
175:1665-1673 |
| 32. |
Watanabe, M.,
M. Ishidate, Jr., and T. Nohmi.
1990.
Nucleotide sequence of Salmonella typhimurium nitroreductase gene.
Nucleic Acids Res.
18:1059 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |