Previous Article | Next Article 
Journal of Bacteriology, August 1998, p. 4007-4010, Vol. 180, No. 15
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Role of PhoP~P in Transcriptional Regulation of Genes Involved
in Cell Wall Anionic Polymer Biosynthesis in Bacillus
subtilis
Ying
Qi and
F. Marion
Hulett*
Laboratory for Molecular Biology, University
of Illinois at Chicago, Chicago, Illinois 60607
Received 19 March 1998/Accepted 19 May 1998
 |
ABSTRACT |
tagA, tagD, and tuaA operons
are responsible for the synthesis of cell wall anionic polymer,
teichoic acid, and teichuronic acid, respectively, in Bacillus
subtilis. Under phosphate starvation conditions, teichuronic acid
is synthesized while teichoic acid synthesis is inhibited. Expression
of these genes is controlled by PhoP-PhoR, a two-component system. It
has been proposed that PhoP~P plays a key role in the activation of
tuaA and the repression of tagA and
tagD. In this study, we demonstrated the role of PhoP~P in the switch process from teichoic acid synthesis to teichuronic acid
synthesis, by using an in vitro transcription system. The results
indicate that PhoP~P is sufficient to repress the transcription of
the tagA and tagD promoters and also to
activate the transcription of the tuaA promoter.
| |
TEXT |
In Bacillus subtilis, the
Pho regulon consists of genes whose expression is responsive to
phosphate concentration and regulated by the PhoP-PhoR two-component
regulator proteins (5, 6, 9, 22). PhoR, a histidine kinase,
senses a signal and is autophosphorylated under phosphate starvation
conditions, or in the presence of ATP in vitro, and it then transfers
the phosphoryl group to PhoP, a response regulator. Phosphorylated PhoP
(PhoP~P) acts as a transcriptional activator or repressor of Pho
regulon genes (operons), including phoA, phoB,
pstS, phoD, tuaA, tagA, and
tagD (1, 2, 8, 9, 11, 13, 20). DNase I
footprinting data showed that both PhoP and PhoP~P bound to a PhoP
core binding region located between positions 
22 and 60 in all
known Pho regulon promoters (11-14), while PhoP~P also
bound to sites in the coding regions of some Pho regulon genes
(14).
Products encoded by tuaA, tagA, and
tagD operons are involved in anionic cell wall polymer
synthesis. The tuaA operon is responsible for synthesis of
teichuronic acid, a phosphate-free polymer synthesized during phosphate
starvation (3, 4, 24). The tagA and
tagD operons are divergently transcribed and are responsible
for synthesis of teichoic acid, a phosphate-containing anionic polymer.
Under phosphate-limiting conditions, the biosynthesis of teichoic acid ceases and is replaced by the synthesis of teichuronic acid (3, 10), thereby reducing the requirement for cell wall phosphate and
saving phosphorus for cellular metabolism and DNA synthesis.
Genetic, promoter fusion, and footprinting data suggested that
PhoP-PhoR controlled the switch from synthesis of one kind of anionic
polymer to that of another under phosphate starvation conditions
(11, 14, 18). Analysis of the cell wall composition in a
phoR or phoP mutant strain showed that under
these conditions teichuronic acid synthesis was not induced but
teichoic acid was synthesized (18). The levels of
transcription of the tagA and tagD promoters were
dramatically decreased in the parent strain, but these promoters
continued to be expressed in either the phoP or
phoR strain under phosphate-limiting conditions (11,
17). Expression of the tuaA promoter from the parent
strain increased under phosphate starvation conditions (13,
21). There was no tuaA promoter activity in a
phoP mutant strain, but the promoter activity in a
phoR mutant strain was about 10% of that in the parent
strain. These data indicated that both PhoP and PhoR are required for
the activation of the tuaA transcription and for the
repression of the tagA and tagD promoter
transcription under phosphate-limiting conditions. Under
phosphate-replete conditions, PhoP and PhoR have no apparent role in
the regulation of the tuaA, tagA, and
tagD promoters. Binding of PhoP and PhoP~P to the
tuaA and tagA promoters (11, 13)
suggested that PhoP-PhoR played a direct role in this transcription
regulation. The observations that both PhoP and PhoP~P bound to the
tuaA promoter and that tuaA transcription
continued at low levels in the phoR mutant strain raised the
question of activation by unphosphorylated PhoP.
Here, we utilized an in vitro transcription system to analyze the roles
of PhoP and PhoP~P in the regulation of the tuaA, tagA, and tagD promoters in vitro. The results
indicated that PhoP~P is essential and sufficient to activate the
transcription of tuaA and repress the transcription of
tagA and tagD.
PhoP~P represses both the tagA operon and the
tagD operon.
Divergently transcribed tagA
and tagD have been cloned on plasmid pSE90 as described
previously (11). The transcription start sites of the
tagA and tagD operons have been identified (15). In this study, linear DNA fragments were used as
templates in in vitro transcription assays. All conditions for the in
vitro transcription were the same as those described previously
(19). The transcription reaction mixture (20-µl final
volume) consisted of 0.08 pmol of template, 5 pmol of PhoP and/or 5 pmol of PhoR, 50 nmol of ATP, and 0.4 pmol of purified B. subtilis RNA polymerase (19). The transcription buffer
contained 100 mM potassium glutamate, 10 mM Tris (pH 8.0), 0.1 mM EDTA,
50 mM KCl, 1 mM CaCl2, 5 mM MgCl2, 10 µg of
bovine serum albumin per ml, 1 mM dithiothreitol, and 5% glycerol.
Either PhoP alone, PhoP and PhoR together, or a PhoP-PhoR-ATP mixture
was preincubated with the template at 37°C for 10 min. The RNA
polymerase was then added to the reaction mixture, and incubation
continued at 37°C for 15 min. A single round of transcription was
initiated by the addition of 5 µl of a transcription buffer
containing ATP, GTP, and CTP at 100 µM each, 10 µM UTP, 5 µCi of
[
-32P]UTP (Amersham), and 50 µg of heparin per ml.
After incubation at 37°C for 15 min, reactions were stopped by the
addition of 10 µl of loading dye (7 M urea, 100 mM EDTA, 5%
glycerol, 0.05% xylene cyanol, and 0.05% [wt/vol] bromophenol
blue). Samples were analyzed on 8 M urea-6% polyacrylamide gels.
Dried gels were analyzed by a PhosphorImager.
A 503-bp DNA fragment, containing both tagA and
tagD promoters, was isolated from pSE90 digested by
EcoRI and BamHI and used as a template in in
vitro transcription assays (Fig. 1A and
B). The results showed that only one
transcript, with the expected size of 175 nucleotides (nt), generated
from the tagD promoter, was produced in the absence of PhoP
or in the presence of unphosphorylated PhoP (Fig. 1C, lanes 1 and 2).
It appeared that these two promoters compete for transcription reagents
and RNA polymerase in the reaction mixture, suggesting that
tagD had a stronger promoter than tagA. This is
consistent with in vivo data which showed that the level of
transcription of tagD was two- to threefold higher than that of tagA (11, 15, 17).
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Repression of tagA and tagD
transcription by PhoP~P. (A) Map of the plasmid containing
divergently transcribed tagA and tagD promoters.
The solid horizontal line represents the promoter sequences. The dashed
lines represent pCRII vector sequences. The arrows indicate the gene
transcription direction. +1 marks the transcriptional start sites.
Restriction sites: B, BamHI; E, EcoRI; M,
MunI. (B) Diagram of templates containing tagA
and/or tagD promoters. The horizontal lines represent DNA
fragments used for templates. The arrows indicate the gene
transcription direction. Expected sizes of transcripts from the
promoters are indicated in parentheses. (C) In vitro transcription of
tagA and tagD promoters. Phosphorylation of PhoP
and in vitro transcription reactions were carried out as described in
the text. The results of coelectrophoresis of Perfect RNA marker
template mix (Novagen, Madison, Wis.) are not shown. P, PhoP; R, PhoR;
RNAP, purified B. subtilis RNA polymerase. , absent; +,
present.
|
|
pSE90 was digested with
BamHI and
MunI, resulting
in three DNA fragments: one, which contains the
tagA
promoter region, extending
from
82 to +122; a second, which contains
the
tagD promoter region,
extending from
124 to +206 (Fig.
1A and B); and the vector. A
transcript of the expected size, 122 nt,
was synthesized from
the
tagA promoter by
B. subtilis RNA polymerase, either in the
absence of PhoP (Fig.
1C,
lane 4), in the presence of PhoP (Fig.
1C, lane 5), or in the presence
of PhoP and PhoR without ATP (data
not shown). When PhoP was
phosphorylated by PhoR in the presence
of ATP, no transcript was
produced, indicating that PhoP~P repressed
the transcription of
tagA promoter (Fig.
1C, lane 6). Similar
results were
observed with the
tagD promoter (Fig.
1C, lanes 7
to 9). A
206-nt transcript was generated in the absence of PhoP
or in the
presence of unphosphorylated PhoP, while no transcript
was observed in
the presence of PhoP~P.
In vivo and in vitro data indicate that PhoP~P is a repressor of the
tagA and the
tagD promoters. Although the
mechanism of
PhoP~P repression is unknown, the pattern of PhoP~P
binding to
these promoters extends from the promoter region well into
the
coding region of the genes, suggesting that PhoP~P binding may
interfere with the transcription initiation and/or elongation.
In order
to explore the mechanism of the transcriptional repression,
we
performed in vitro transcription assays and varied the order
of
component addition. The templates used in this experiment were
DNA
fragments containing the
tagD promoter. The results showed
that PhoP~P repressed
tagD transcription in vitro only
when PhoP~P
was first preincubated with template DNA, before the
addition
of the RNA polymerase (Fig.
2,
lane 3). This was the order of
component addition used for the
reactions in Fig.
1C. No repression
was observed when PhoP~P, RNA
polymerase, and DNA were incubated
together (Fig.
2, lane 4), and
preincubation of the PhoP~P and
RNA polymerase, before addition of
DNA, decreased the repression
(Fig.
2, lane 5). Figure
2, lanes 1 and
2, shows the transcript
produced in the absence of PhoP and in the
presence of unphosphorylated
PhoP. Combined, these data suggested that
PhoP~P and the RNA polymerase
compete for the same binding site in
the
tagD promoter region
and that the binding of PhoP~P in
the promoter region may exclude
the RNA polymerase binding to the
promoter.
View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Dependence of tagD transcription on RNA
polymerase binding before PhoP~P. Reactions as described for Fig. 1
except that the order of component addition was different and some
reaction mixtures were preincubated. DNA, tagD template
(Fig. 1B); P, PhoP; R, PhoR; RNAP, purified B. subtilis RNA
polymerase. , absent; +, present;  , preincubation at 37°C for 10 min. A, DNA template; B, mixture of PhoP, PhoR, and ATP; C, RNA
polymerase. The order of component addition is indicated proceeding
from top to bottom above lanes 3 to 5.
|
|
It has been suggested that
tagA and
tagD are
possibly
A-dependent promoters (
16,
23). We
performed in vitro transcription
experiments using purified
B. subtilis RNA polymerase core enzyme
(
19) and/or
purified
A (provided by John Helmann, Cornell
University). The templates
used in this experiment were DNA fragments
containing either the
tagA or the
tagD promoter.
The reactions were performed in the
presence of either unphosphorylated
PhoP or PhoP~P. As shown in
Fig.
3, the
core enzyme alone was not able to transcribe either
the
tagA
or the
tagD promoter (lanes 3 and 8). However, the core
enzyme combined with
A produced the same transcripts as
the RNA polymerase holoenzyme
(Fig.
3, lane 1 compared to lane 5 and
lane 6 compared to lane
10). This transcript was not observed in the
presence of PhoP~P
(Fig.
3, lanes 2 and 7), and
A
alone did not transcribe either promoter (Fig.
3, lanes 4 and
9). The
data indicate that the
tagA and
tagD promoters
are
A dependent and that PhoP~P is sufficient to
repress the transcription
of the
tagA and
tagD
operons in vitro. These results support the
theory that any repression
of
tag gene expression by a metabolite,
dependent on
teichuronic acid synthesis (
18), must require PhoP,
acting
through PhoP~P (
11).
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3.
Core enzyme plus A is sufficient for in
vitro transcription of the tagA and tagD
promoters. Reactions and sample analysis were as described for Fig. 1.
RNA markers are not shown. P, PhoP; R, PhoR; RNAP, purified B. subtilis RNA polymerase A holoenzyme; E, isolated
core enzyme; A, purified A. , absent;
+, present.
|
|
PhoP~P activates the transcription of tuaA
promoter.
It has been reported that both PhoP and PhoP~P bound
to the tuaA promoter (13). Therefore, low levels
of tuaA transcription from a tuaA-lacZ fusion in
the phoR mutant strain may have resulted from the activation
by unphosphorylated PhoP. To understand how PhoP and PhoP~P regulate
the tuaA promoter in vitro, we carried out in vitro
transcription experiments using a PCR product containing the
tuaA promoter region as a template. Primers FMH259 and
FMH260, described previously (13), were used to amplify a
245-bp DNA fragment containing the tuaA promoter from JH642
chromosomal DNA (Fig. 4A). A transcript
was produced in the presence of PhoP~P (Fig. 4B, lane 3) but not in
the absence of PhoP or in the presence of unphosphorylated PhoP (Fig.
4B, lanes 1 and 2), indicating that PhoP~P is essential for the
activation of the tuaA promoter transcription in vitro.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Activation of the tuaA transcription by
PhoP~P. (A) Physical map of the tuaA promoter region. The
horizontal line represents the DNA fragment used for template. The bent
arrow indicates the tuaA transcription direction. +1 marks
the transcriptional start site. The expected transcript size of the
promoter is indicated in parentheses. (B) In vitro transcription of
tuaA promoter. All reactions and sample analysis are as
described for Fig. 1. Abbreviations are the same as in the legend for
Fig. 1.
|
|
In order to determine if the in vivo and in vitro transcription start
sites for the
tuaA promoter were identical, we first
performed in vivo primer extension experiments as described previously
(
1). RNA was isolated from the wild-type strain, JH642,
grown
in low-phosphate defined medium (LPDM) (
7) or
Luria-Bertani
medium until late exponential phase. Primer FMH359
(5'
2452CCTCACGATTTGTTTGGGATG
2431-3') was
used for mapping the start site. The numbers at the 5'
and 3' ends of
the primer refer to numbers in the
cwlB gene with
the
GenBank database accession no.
M61747. A transcription
start site was
observed for RNA isolated in LPDM (Fig.
5, lane
1) but not in Luria-Bertani
medium (data not shown). The
tuaA transcriptional start site
was 3 bp downstream of the putative
tuaA transcriptional
start site previously indicated (
13). Therefore,
the size of
the in vitro transcript produced in the presence of
PhoP~P was 79 nt.
View larger version (75K):
[in this window]
[in a new window]
|
FIG. 5.
Primer extension analysis of the tuaA
promoter in vivo and in vitro. The end-labeled primer FMH359 was
annealed to RNA and then extended with avian myeloblastosis virus
reverse transcriptase. Lane 1, RNA isolated from late-exponential-phase
cells grown in LPDM; lane 2, RNA synthesized from the in vitro
transcription reaction mixture containing PhoP~P (products of the
primer extension reactions are marked by an arrow); lanes A, G, C, and
T are a sequencing ladder generated by annealing the same end-labeled
primer to a plasmid, pES69, containing the tuaA promoter
region (13) and extending it with Sequenase. The sequence of
the region is indicated on the left. The asterisk indicates the base to
which the primer extension product maps.
|
|
The start site of the in vitro-generated transcript was mapped to
determine if the in vitro transcription system was initiating
correctly
from the
tuaA promoter. RNA templates for primer extension
studies were prepared with the buffer and temperature used for
in vitro
transcription but with 10-fold-greater amounts of template
DNA, RNA
polymerase, and PhoP and/or PhoR (e.g., 0.8 pmol of template,
50 pmol
of PhoP or a mixture of 50 pmol of PhoP, 50 pmol of PhoR,
and 0.5 mmol
of ATP, and 4 pmol of RNA polymerase) in a 100-µl
volume. The
reaction mixture was incubated at 37°C for 15 min.
ATP, GTP, CTP, and
UTP (250 µM each) were added to a final volume
of 125 µl. Heparin
(50 µg per ml) was added to a final volume
of 150 µl after 30 min.
After incubation for 15 min, reactions
were stopped by the addition of
5 U of RNase-free DNase I (Boehringer
Mannheim), and incubation was
continued for 20 min. RNA transcripts
from the in vitro transcription
reaction, which was carried out
with a mixture containing either PhoP
or PhoP~P, were extracted
with phenol. The primer extension reaction
mixtures were the same
as for in vivo primer extension. A
transcriptional start site
observed in products of reactions carried
out with PhoP~P (Fig.
5, lane 2) corresponded to the start site for
tuaA transcription
in vivo, indicating that PhoP~P
stimulated the transcription of
the
tuaA promoter in vitro.
There were no products from the reaction
with unphosphorylated PhoP
(data not shown).
Previous in vitro transcription data showed that PhoP~P is an
activator of the Pho regulon genes
phoA and
pstS
and that the
RNA polymerase
A holoenzyme and PhoP~P
are sufficient for the transcription of
both genes in vitro
(
19). The results of the present study show
that PhoP~P is
sufficient to repress both
tagA and
tagD operons
and is essential for the activation of the
tuaA operon in
vitro.
These data suggest that the minor level of transcription from
the
tuaA promoter in a
phoR mutant strain is not
due to unphosphorylated
PhoP but depends on low levels of PhoP~P.
This conclusion suggests
that PhoP can be phosphorylated by other
kinases or small phosphodonors,
albeit PhoP cannot be phosphorylated by
small phosphodonors in
vitro (
12). It is interesting that
among the Pho promoters analyzed
to date, the only ones having
measurable activity in a
phoR mutant
strain are the
tuaA promoter and the promoter for the
pstS
operon,
the operon encoding components for the high-affinity
P
i transport
system. Whether this is due to promoter
strength or promoters
with higher affinity for PhoP~P, it does
indicate that the cell's
first responses to a phosphate deficiency are
to take up the remaining
P
i from the environment and to
start making an anionic cell wall
polymer which does not contain
phosphate.
| |
ACKNOWLEDGMENTS |
This work was supported by National Institutes of Health grant
GM33471 to F.M.H.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: University of
Illinois at Chicago, Laboratory for Molecular Biology (M/C567), 900 S. Ashland Ave., Chicago, IL 60607. Phone: (312) 996-5469. Fax: (312) 413-2691. E-mail: Hulett{at}uic.edu.
| |
REFERENCES |
| 1.
|
Chesnut, R. S.,
C. Bookstein, and F. M. Hulett.
1991.
Separate promoters direct expression of phoAIII, a member of the Bacillus subtilis alkaline phosphatase multigene family, during phosphate starvation and sporulation.
Mol. Microbiol.
5:2181-2190[Medline].
|
| 2.
|
Eder, S.,
L. Shi,
K. Jensen,
K. Yamane, and F. M. Hulett.
1996.
A Bacillus subtilis secreted phosphodiesterase/alkaline phosphatase is the product of a Pho regulon gene, phoD.
Microbiology
142:2041-2047[Abstract/Free Full Text].
|
| 3.
|
Ellwood, D. C., and D. W. Temoest.
1969.
Control of teichoic acid and teichuronic acid biosyntheses in chemostat cultures of Bacillus subtilis var. Niger.
Biochem. J.
111:1-5[Medline].
|
| 4.
|
Ellwood, D. C., and D. W. Temoest.
1972.
Effect of environment on bacterial wall content and composition.
Adv. Microb. Physiol.
7:83-117.
|
| 5.
|
Hulett, F. M.
1995.
Complex phosphate regulation by sequential switches in Bacillus subtilis, p. 289-302.
In
J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. American Society for Microbiology, Washington, D.C.
|
| 6.
|
Hulett, F. M.
1996.
The signal-transduction network for Pho regulation in Bacillus subtilis.
Mol. Microbiol.
19:933-939[Medline].
|
| 7.
|
Hulett, F. M.,
C. Bookstein, and K. Jensen.
1990.
Evidence for two structural genes for alkaline phosphatase in Bacillus subtilis.
J. Bacteriol.
172:735-740[Abstract/Free Full Text].
|
| 8.
|
Hulett, F. M.,
J. Lee,
L. Shi,
G. Sun,
R. Chesnut,
E. Sharkova,
M. F. Duggan, and N. Kapp.
1994.
Sequential action of two-component genetic switches regulates the PHO regulon in Bacillus subtilis.
J. Bacteriol.
176:1348-1358[Abstract/Free Full Text].
|
| 9.
|
Hulett, F. M.,
G. Sun, and W. Liu.
1994.
The Pho regulon of Bacillus subtilis is regulated by sequential action of two genetic switches, p. 50-54.
In
A. Torriani-Gorini, E. Yagil, and S. Silver (ed.), Phosphate in microorganisms: cellular and molecular biology. American Society for Microbiology, Washington, D. C.
|
| 10.
|
Lang, W. K.,
K. Glassey, and A. R. Archibald.
1982.
Influence of phosphate supply on teichoic acid and teichuronic acid content of Bacillus subtilis cell walls.
J. Bacteriol.
151:367-375[Abstract/Free Full Text].
|
| 11.
|
Liu, W.,
S. Eder, and F. M. Hulett.
1998.
Analysis of Bacillus subtilis tagAB and tagDEF expression during phosphate starvation identifies a repressor role for PhoP~P.
J. Bacteriol.
180:753-758[Abstract/Free Full Text].
|
| 12.
|
Liu, W., and F. M. Hulett.
1997.
Bacillus subtilis PhoP binds to the phoB tandem promoter exclusively within the phosphate starvation-inducible promoter.
J. Bacteriol.
179:6302-6310[Abstract/Free Full Text].
|
| 13.
| Liu, W., and F. M. Hulett. Comparison of PhoP
binding to the tuaA promoter with PhoP binding to other Pho
regulon promoters establishes a Bacillus subtilis Pho box.
Microbiology, in press.
|
| 14.
|
Liu, W.,
Y. Qi, and F. M. Hulett.
1998.
Sites internal to the coding regions of phoA and pstS bind PhoP and are required for full promoter activity.
Mol. Microbiol.
28:119-130[Medline].
|
| 15.
|
Mauël, C.,
A. Bauduret,
C. Chervet,
S. Beggah, and D. Karamata.
1995.
In Bacillus subtilis 168, teichoic acid of the cross-wall may be different from that of the cylinder: a hypothesis based on transcription analysis of tag genes.
Microbiology
141:2379-2389[Abstract/Free Full Text].
|
| 16.
|
Mauël, C.,
M. Young, and D. Karamata.
1991.
Genes concerned with synthesis of poly(glycerol phosphate), the essential teichoic acid in Bacillus subtilis strain 168, are organized in two divergent transcription units.
J. Gen. Microbiol.
137:929-941[Medline].
|
| 17.
|
Mauël, C.,
M. Young,
A. Monsutti-Grecescu,
S. A. Marriott, and D. Karamata.
1994.
Analysis of Bacillus subtilis tag gene expression using transcription fusion.
Microbiology
140:2279-2288[Abstract/Free Full Text].
|
| 18.
|
Muller, J. P.,
Z. An,
T. Merad,
I. C. Hancock, and C. R. Harwood.
1997.
Influence of Bacillus subtilis phoR on cell wall anionic polymers.
Microbiology
143:947-956[Abstract/Free Full Text].
|
| 19.
|
Qi, Y., and F. M. Hulett.
1998.
PhoP~P and RNA polymerase A holoenzyme are sufficient for transcription of Pho regulon promoters in Bacillus subtilis: PhoP~P activator sites within the coding region stimulate transcription in vitro.
Mol. Microbiol.
28:1187-1198[Medline].
|
| 20.
|
Qi, Y.,
Y. Kobayashi, and F. M. Hulett.
1997.
The pst operon of Bacillus subtilis has a phosphate-regulated promoter and is involved in phosphate transport but not in regulation of the Pho regulon.
J. Bacteriol.
179:2534-2539[Abstract/Free Full Text].
|
| 21.
|
Soldo, B.,
V. Lazarevic,
M. Pagnl,
C. Mauël, and D. Karamata.
1995.
Transcriptional regulation of teichuronic acid expression, p. 77.
In
Abstracts for the 8th International Conference on Bacilli.Stanford, Calif.
|
| 22.
|
Sun, G.,
B. M. Birkey, and F. M. Hulett.
1996.
Three two-component signal-transduction systems interact for Pho regulation in Bacillus subtilis.
Mol. Microbiol.
19:941-948[Medline].
|
| 23.
|
Wagner, P. M., and G. C. Stewart.
1991.
Role and expression of the Bacillus subtilis rodC operon.
J. Bacteriol.
173:4341-4346[Abstract/Free Full Text].
|
| 24.
|
Ward, J. B.
1981.
Teichoic and teichuronic acids: biosynthesis, assembly, and location.
Microbiol. Rev.
45:211-243[Free Full Text].
|
Journal of Bacteriology, August 1998, p. 4007-4010, Vol. 180, No. 15
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fiedler, T., Mix, M., Meyer, U., Mikkat, S., Glocker, M. O., Bahl, H., Fischer, R.-J.
(2008). The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation. J. Bacteriol.
190: 6559-6567
[Abstract]
[Full Text]
-
Eldakak, A., Hulett, F. M.
(2007). Cys303 in the Histidine Kinase PhoR Is Crucial for the Phosphotransfer Reaction in the PhoPR Two-Component System in Bacillus subtilis. J. Bacteriol.
189: 410-421
[Abstract]
[Full Text]
-
Allenby, N. E. E., O'Connor, N., Pragai, Z., Ward, A. C., Wipat, A., Harwood, C. R.
(2005). Genome-Wide Transcriptional Analysis of the Phosphate Starvation Stimulon of Bacillus subtilis. J. Bacteriol.
187: 8063-8080
[Abstract]
[Full Text]
-
Schertzer, J. W., Bhavsar, A. P., Brown, E. D.
(2005). Two Conserved Histidine Residues Are Critical to the Function of the TagF-like Family of Enzymes. J. Biol. Chem.
280: 36683-36690
[Abstract]
[Full Text]
-
Minnig, K., Lazarevic, V., Soldo, B., Mauel, C.
(2005). Analysis of teichoic acid biosynthesis regulation reveals that the extracytoplasmic function sigma factor {sigma}M is induced by phosphate depletion in Bacillus subtilis W23. Microbiology
151: 3041-3049
[Abstract]
[Full Text]
-
Abdel-Fattah, W. R., Chen, Y., Eldakak, A., Hulett, F. M.
(2005). Bacillus subtilis Phosphorylated PhoP: Direct Activation of the E{sigma}A- and Repression of the E{sigma}E-Responsive phoB-PS+V Promoters during Pho Response. J. Bacteriol.
187: 5166-5178
[Abstract]
[Full Text]
-
Paul, S., Birkey, S., Liu, W., Hulett, F. M.
(2004). Autoinduction of Bacillus subtilis phoPR Operon Transcription Results from Enhanced Transcription from E{sigma}A- and E{sigma}E-Responsive Promoters by Phosphorylated PhoP. J. Bacteriol.
186: 4262-4275
[Abstract]
[Full Text]
-
Neuhaus, F. C., Baddiley, J.
(2003). A Continuum of Anionic Charge: Structures and Functions of D-Alanyl-Teichoic Acids in Gram-Positive Bacteria. Microbiol. Mol. Biol. Rev.
67: 686-723
[Abstract]
[Full Text]
-
Chen, Y., Birck, C., Samama, J.-P., Hulett, F. M.
(2003). Residue R113 Is Essential for PhoP Dimerization and Function: a Residue Buried in the Asymmetric PhoP Dimer Interface Determined in the PhoPN Three-Dimensional Crystal Structure. J. Bacteriol.
185: 262-273
[Abstract]
[Full Text]
-
Paul, S., Zhang, X., Hulett, F. M.
(2001). Two ResD-Controlled Promoters Regulate ctaA Expression in Bacillus subtilis. J. Bacteriol.
183: 3237-3246
[Abstract]
[Full Text]
-
Dubail, I., Berche, P., The European Listeria Genome Consortium, , Charbit, A.
(2000). Listeriolysin O as a Reporter To Identify Constitutive and In Vivo-Inducible Promoters in the Pathogen Listeria monocytogenes. Infect. Immun.
68: 3242-3250
[Abstract]
[Full Text]
-
Lahooti, M., Harwood, C. R.
(1999). Transcriptional analysis of the Bacillus subtilis teichuronic acid operon. Microbiology
145: 3409-3417
[Abstract]
[Full Text]
-
Jongbloed, J. D. H., Martin, U., Antelmann, H., Hecker, M., Tjalsma, H., Venema, G., Bron, S., van Dijl, J. M., Muller, J.
(2000). TatC Is a Specificity Determinant for Protein Secretion via the Twin-arginine Translocation Pathway. J. Biol. Chem.
275: 41350-41357
[Abstract]
[Full Text]
Top
Abstract
Text
