Previous Article | Next Article 
Journal of Bacteriology, August 1998, p. 4166-4170, Vol. 180, No. 16
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Suppression of TGA Mutations in the Bacillus
subtilis spoIIR Gene by prfB Mutations
Margaret L.
Karow,1,
Elizabeth J.
Rogers,2
Paul S.
Lovett,2 and
Patrick J.
Piggot1,*
Department of Microbiology and Immunology,
Temple University School of Medicine, Philadelphia, Pennsylvania
19140,1 and
Department of Biological
Sciences, University of Maryland
Baltimore County, Catonsville,
Maryland 212282
Received 12 March 1998/Accepted 13 June 1998
 |
ABSTRACT |
An unexpectedly high proportion of TGA nonsense mutations was
obtained in a collection of chemically induced mutations in the spoIIR locus of Bacillus subtilis. Of 11 different mutations obtained, TGA mutations were found in four codons,
whereas only three codons yielded missense mutations. Six suppressors
of the TGA mutations were isolated, and five of the
suppressing mutations were mapped to the prfB gene encoding
protein release factor 2. These are the first mutations shown
to map to the B. subtilis prfB locus. The sequence of the
prfB gene was completed, and two revisions of the published
sequence were made. The five prfB mutations also
resulted in suppression of the catA86-TGA mutation to
between 19 and 54% of the expression of
catA86+, compared to the readthrough
level of 6% in the prfB+ strain. N-terminal
sequencing of suppressed catA86-TGA-specified protein demonstrated that the amino acid inserted at UGA because of the
prfB1 mutations was tryptophan.
 |
INTRODUCTION |
The genetic code shows small but
fundamental differences in various organisms, suggesting that the code
has evolved to meet special requirements of the host (reference
12 and references therein). Some of the variability
of the code is strikingly evident in the codon UGA (29). UGA
is one of the three translation termination codons. In
Escherichia coli, Salmonella typhimurium, and
Bacillus subtilis, UGA is encountered less frequently than
UAA and more frequently than UAG (4, 13). Although UGA is a
termination codon, in E. coli and S. typhimurium
UGA can be decoded at very low frequency; when this occurs, the amino
acid inserted is tryptophan (29). Thus, UGA is viewed as a
"leaky" termination codon (34). The extent of
readthrough of UGA in wild-type E. coli appears to be on the
order of 10
5 to 10
2 per termination at UGA,
and the readthrough efficiency of UGA seems to depend on the context in
which UGA is found (13, 29). Readthrough as Trp is distinct
from the special case of UGA coding for selenocysteine, where a codon
context of 40 nucleotides is involved (14).
Although UGA functions as a stop codon in B. subtilis, the
efficiency of UGA readthrough is quite high. With a catA86
reporter gene with UGA inserted into two different sites, the
efficiency of UGA readthrough was approximately 6% (26).
Similar UGA readthrough values were obtained with Staphylococcus
aureus as host (25, 26). Thus, in these very different
gram-positive species, UGA is substantially leakier than is observed in
the Enterobacteriaceae. N-terminal sequencing of the protein
specified by catA86 containing UGA at codon 7 demonstrated
that tryptophan was the inserted amino acid. Mycoplasma are
"wall-less" gram-positive bacteria, and in many
Mycoplasma species UGA is not a termination codon but rather directly encodes tryptophan (4, 7, 18). The very high level
of readthrough of UGA in B. subtilis and S. aureus suggested that it might be difficult to obtain TGA nonsense
mutations in most coding sequences within these organisms.
In the present study, we demonstrate the isolation of several mutations
in spoIIR which cause a defect in sporulation and result
from a change of a sense codon to UGA. The sporulation phenotype
associated with the TGA mutations allowed the isolation of second-site
mutations that suppress TGA nonsense mutations. We demonstrate here
that five of six such UGA suppressors result from mutations in the
structural gene (prfB) for release factor 2 (RF2).
 |
MATERIALS AND METHODS |
Media.
B. subtilis was grown in modified Schaeffer's
sporulation medium (2 × SG) without glucose and on Schaeffer's
sporulation agar (33). Addition of
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal) (100 µg/ml), chloramphenicol (4 µg/ml), neomycin (3 µg/ml), erythromycin (10 µg/ml), and lincomycin (1 µg/ml)
(resistances to the latter two are encoded by the erm gene
and the combination is referred to as Ermr) or of
spectinomycin (50 µg/ml) was done as required.
Strains and plasmids.
B. subtilis 168 strain BR151,
trpC2 metB10 lys-3, was used as the parent strain in all
experiments. E. coli DH5
(GIBCO/BRL) was used to maintain
plasmids. pPL708C2 contains a constitutively expressed version
of catA86, a gene that codes for chloramphenicol acetyltransferase (CAT). pPL708C2 UGA-7 contains TGA as replacement for
cat codon 7, which is Glu (GAA) in the wild-type gene
(26). Both plasmids were transformed into strain BR151 and
derivatives of BR151 containing prfB1 mutations to generate
strains containing either the wild-type cat gene (pPL708C2)
or the mutant cat gene (pPL708C2 UGA-7).
Isolation of prfB mutants.
prfB1 was
isolated from an ethyl methanesulfonate (EMS)-mutagenized
(9) culture of MLK940. MLK940 contained spoIIR152
with a TGA mutation and a cotE-lacZ fusion (to indicate
E activity) linked to a Camr determinant
(38). The prfB1 mutant was isolated and exhibited a LacZ+ phenotype on sporulation agar plates containing
X-Gal. The prfB2 suppressor strain and the prfB3,
-4, and -5 suppressor strains were isolated as
Spo+ colonies from UV-mutagenized derivatives of BR151
containing spoIIR151 and spoIIR74, respectively.
Cloning of the gene encoding prfB1.
A library of
Camr Tn10 insertions (31) made in
BR151 was transduced into MLK984 (a BR151 derivative containing
prfB1) by using transduction phage PBS-1 (17),
and colonies that were Camr and Spo+ at 42°C
were isolated. DNA from each Camr and Spo+
clone was isolated and transformed back into MLK984, and linkage of the
Tn10s was determined. One Tn10 that was 65%
cotransformed to prfB1 was cloned, along with its flanking
chromosomal DNA, to make pMLK252. This plasmid did not contain
prfB. It was used as a probe for a lambda DNA library. A
lambda clone that hybridized to pMLK252 and corrected the
prfB1 mutation was subcloned to yield pMLK262, carrying the
800-bp SacI-HindIII fragment of the
insert-phage junction ligated with
SacI-HindIII-digested pBluescript KS
(Stratagene). pMLK262 corrected the prfB1 mutation. The
adjacent 900-bp EcoRI-HindIII fragment was
cloned in pBluescript KS to make pMLK266.
PCR amplification and sequencing.
Both the spoIIR
and prfB mutant DNAs were PCR amplified with a GeneAmp kit
(Perkin-Elmer Cetus). The spoIIR gene primers were 5'CACCCTGCACGTTTATCCCAGGCTCTCC3' and
5'GCAGTTGATAAAACATCCGTTCACCCCG3', and the prfB
primers were 5'GTGGTTGATATCGGACGAAATGCCC3' and
5'GCAGCAGTGAAATCAAGGATATAAG3'. One primer in each reaction
was phosphorylated with dATP and T4 polynucleotide kinase, and after
amplification, the phosphorylated strand was degraded with lambda
exonuclease (5). The remaining strand was sequenced with
Sequenase 2.0 (Amersham) according to the manufacturer's instructions.
Other methods.
Sporulation frequency was determined as
heat-resistant spores per milliliter of culture 16 h after the
initiation of sporulation (27). CAT assays were performed by
the colorimetric procedure of Shaw (37). Protein was assayed
according to the method of Bradford (8).
CAT UGA-7 protein was affinity purified with chloramphenicol caproate
agarose (Sigma) and eluted with 10 mM chloramphenicol. The purified
protein was subjected to automated N-terminal sequencing by Edman
degradation. Typically, sequencing was allowed to proceed through 15 cycles (15 amino acid residues).
Nucleotide sequence accession number.
The complete
nucleotide sequence of the prfB gene is available from
GenBank under accession no. AF013188.
 |
RESULTS AND DISCUSSION |
TGA nonsense mutations in spoIIR.
The spoIIR
gene is required for the coordination of transcriptional events during
sporulation. Sporulation is a developmental process requiring the
concerted efforts of two cells, the mother cell and the
forespore (also called the prespore). These two cells express
separate genetic programs that are sequentially controlled by a set of
sigma factors that are coordinated by cell-cell signaling (15). The SpoIIR protein is produced by the forespore
with sigma factor F and initiates transcriptional events in
the mother cell by activating
E (20, 24).
Previously, we obtained the four mutations that defined the
spoIIR locus by EMS mutagenesis of an appropriately marked
strain
(
20). In order to obtain further mutations in
spoIIR, we utilized
directed mutagenesis of transforming DNA
(
3). We obtained two
spoIIR mutants by nitrous
acid mutagenesis and nine by methoxyamine
mutagenesis (
11).
DNA sequence analysis indicated that we had
obtained, in total, 10 distinct point mutations in
spoIIR, of
which 6 were nonsense
mutations, including TGA mutations in four
separate codons (Table
1). Three of the mutations obtained by
the directed mutagenesis were identical to three of the mutations
obtained by mutagenesis of bacteria with EMS. The SpoIIR protein
is
predicted to contain 224 residues, including a 23-residue leader
sequence that is thought to be cleaved during protein secretion
(
20). In only 3 of 224 residues were missense mutations
obtained,
and in 2 of these residues mutations were obtained more than
once
(Table
1). In contrast, of the four codons that could yield TGA
by a single-base transition, three did so; the fourth codon,
W218,
encoded the residue that is only seven residues from the C
terminus,
and a nonsense mutation there may have no phenotype. An
additional
TGA mutation resulted from a transversion of
GGA which encoded
G144. Of the nine codons that could
yield TAA or TAG by a single-base
transition, two did so. There
were thus two surprises from this
analysis: the disproportionate
number of nonsense mutations and
the occurrence of TGA mutations. The
disproportionate number of
isolated nonsense mutations may indicate
that most amino acid
substitutions in
spoIIR cause no
phenotypic change. We are aware
of only one other report of a TGA
(opal) nonsense mutation in
B. subtilis
(
22).
Previously, we had supposed that high readthrough levels of UGA
nonsense codons in wild-type
B. subtilis curtailed the
ability
to isolate such mutants (
26). For example, there
is sufficient
readthrough of the
catA86 UGA-7 mutation that
the mutant
catA86 gene confers Cam
r to the
bacterium. However, the wild-type level of UGA readthrough
in
the
spoIIR mutants must not be sufficient to produce enough
SpoIIR to support sporulation, and thus we were able to
identify
several mutants with TGA nonsense mutations of this gene.
Isolation and characterization of UGA suppressor mutants.
In
order to determine how SpoIIR acts, we attempted to identify
second-site suppressor mutants of spoIIR. To do so, we
screened EMS-mutagenized (9) colonies of our original four
spoIIR mutants (20) for the activation of
E by using a lacZ fusion to a
E-directed gene, cotE, that was present in
each of the strains. After mutagenesis, the bacteria were plated
on Schaeffer's sporulation agar containing X-Gal, and colonies
exhibiting
-galactosidase activity were isolated. Only one of the
spoIIR mutants, spoIIR4 (20), produced
a
-galactosidase-positive colony that was neither a revertant nor an
up mutant of the endogenous
-galactosidase gene. The
spoIIR4 mutant had a TGA mutation at codon 152 (Table 1)
(this mutation is hereafter referred to as spoIIR152). As shown below, the suppressor mutation was found to be a UGA suppressor and to map in prfB. For clarity, the name prfB is
used here and throughout, even though the evidence placing the mutation
in prfB is presented later. This suppressor mutation has
been named prfB1.
E transcriptional activity
during sporulation was increased in the presence of prfB1
over that of the spoIIR152 strain, although it remained
approximately one-third that of the spoIIR+
strain (Fig. 1). The presence of the
suppressor mutation also increased the sporulation frequency of the
spoIIR152 mutant approximately 450-fold (Table
2). We obtained no suppressors of the
spoIIR152 mutation that did not need spoIIR for
E activation.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Restoration of E activity to
spoIIR bacteria by prfB1. -Galactosidase
activity from the E-controlled p1 promoter of
cotE fused to lacZ in the following BR151
derivatives: , spoIIR+; ,
spoIIR152; , spoIIR152 prfB1; ,
spoIIR+ prfB1; and , endogenous
-galactosidase activity of the parent strain BR151 that does not
contain the lacZ fusion. ONPG,
o-nitrophenyl- -D-galactopyranoside.
|
|
The
prfB1 mutation on its own impaired sporulation, and
interestingly, this effect was much greater at higher temperatures.
prfB1 bacteria produced 8.2 × 10
6
heat-resistant spores per ml of culture at 37°C and only 180
spores
per ml at 42°C, whereas the wild-type strain produced about
2 × 10
8 spores per ml at both temperatures (Table
3). The sporulation
of
prfB1
bacteria appears to be blocked at an early stage of sporulation.
There
was no detectable formation of the asymmetric septum, one
of the
earliest sporulation-specific morphological markers (
32).
In
contrast to the sporulation phenotypes, there was only a slight
effect
on the growth rate of
prfB1 at 42°C, with a growth rate
(mass doublings/hour) of 1.34 for the
prfB1 strain compared
to
1.52 for the
prfB+ parent. At 37°C, the
growth rates were similar for the two strains,
1.32 for the
prfB1 strain and 1.31 for the
prfB+
parent.
The
spoIIR152 mutant and strains containing TGA
mutations affecting codons 74 and 151 were used in a second type
of screen
in which suppressors that exhibited a Spo
+
phenotype after UV mutagenesis were isolated. In this screen,
the
spoIIR152 mutant did not yield any Spo
+ colonies
that contained extragenic suppressors, although five
intragenic
revertants were isolated from the 5 × 10
7 colonies
that were screened. With
spoIIR151, we isolated one
Spo
+ extragenic suppressor, and with
spoIIR74 we
isolated four. The
spoIIR151 suppressor and three of the
four
spoIIR74 suppressors
were found to map in
prfB (data not shown). The location of the
fourth
spoIIR74 suppressor was not determined. We have named
the
spoIIR151 suppressor mutation
prfB2 and the
three
spoIIR74 mutations
prfB3, -
4,
and -
5. In the presence of these suppressors, sporulation
of
the
spoIIR mutants was increased 70- to 450-fold (Table
2).
Thus,
spoIIR152 strains with the new
prfB
mutations sporulated
at a frequency similar to or less than that of the
spoIIR152 strain
with
prfB1. This indicates that
the Spo
+ phenotype used to isolate these suppressors did
not closely reflect
the activity of the suppressors and also
indicates the fact that
spoIIR74 and
spoIIR151
were leakier than
spoIIR152. None of these
Spo
+
suppressors exhibited the strong Ts

sporulation phenotype
exhibited by
prfB1 (Table
2 and
3).
Mapping and cloning of the gene affected by prfB1.
By
utilizing the Ts
sporulation phenotype of
prfB1, a Tn10 insert was identified that was 65%
linked to prfB1 by transformation. The Tn10 and
its flanking chromosomal DNA were cloned and used to probe the ordered
YAC library of B. subtilis (6). The DNA hybridized to one YAC clone, 10-119, which carries DNA of the 305° region of the chromosome.
The wild-type gene was isolated from a
B. subtilis
lambda library by using the Tn
10-flanking region as a
probe. A subclone
(pMLK262, from a lambda clone) rescued the
prfB1 phenotype, and
the insert in pMLK262 was
sequenced. Comparison of the resulting
sequence with those in GenBank
(
1,
16) indicated that pMLK262
carried a region internal
to the
prfB gene encoding RF2. This
region was
originally cloned and sequenced by Sadaie et al. (
35)
as
part of the operon carrying the
B. subtilis secA gene
(GenBank
accession no.
D90218). Pel et al. (
30) later
recognized that
the gene encoded
prfB and that it contained
a region similar to
the frameshift site found in most
prfB
genes, thus extending the
predicted open reading frame 5' to include
codons for an additional
27 amino acids. The published sequence did not
include the 3'
end of the
prfB gene. We sequenced the
complete
prfB gene and
found that it is followed by a
sequence similar to that of Rho-independent
terminators, indicating
this is most likely the end of the operon.
Two parts of the sequence
that differed from the published sequence
were found. One is an extra G
after base pair 3137 (following
the numbering of Sadaie et al.
[
35]) that extends the open reading
frame 5'
to include 12 more codons, extending the encoded protein
to a length
similar to that of
E. coli,
S. typhimurium,
Streptomyces coelicolor, and
Haemophilus
influenzae (Fig.
2). The new
suggested
AUG initiation codon is preceded by a good ribosome-binding
site
with a

G for binding equal to

17.2 kcal/mol. The other
difference
is a loss of a G (residue 4176 [
35]),
changing the reading frame
such that the downstream encoded protein is
now also similar to
other RF2 sequences (Fig.
2).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of RF2 amino acid sequences. The amino acid
sequences of RF2 from B. subtilis (Bs) (this work and
reference 35), S. coelicolor (Sc)
(28), E. coli (Ec) (10), S. typhimurium (St) (21), and H. influenzae
(Hi) (GenBank accession no. P43918) are shown. Amino acids that are
identical in all five sequences are shown in bold type; the overall
identity is 35%. The asterisks with numbers located above the B. subtilis sequences identify the amino acids changed in
prfB1, -3, and -5. The frameshift
region found in all of the sequences except that of S. coelicolor is marked with a dashed line above the B. subtilis amino acid sequence.
|
|
Sequencing of the prfB mutants.
To determine the
nature of the prfB mutations, the mutant prfB
genes were amplified by PCR and the products were sequenced. The
prfB1 mutant contained a transversion of T to A,
changing Tyr (TAT) 325 to Asn (AAT). Both prfB2 and
prfB4 affected the proposed ribosome-binding site, with
prfB2 containing a T-to-C transition at
13 (with +1 as the
A of the ATG translation initiation codon) and prfB4
containing a G-to-A transition at
12. The prfB3 mutant
contained a G-to-A transition that altered the second amino acid
residue of the protein, changing it from Glu (GAA) to Lys (AAA). The
prfB5 mutant contained a G-to-C transversion, changing residue 21 from Arg (AGG) to Thr (ACG). Thus, three of the
mutations likely impair the formation of RF2, prfB2,
and prfB4 by weakening the ribosome-binding site and
prfB5 by affecting frame shifting. Such impaired RF2
formation would be expected to increase UGA suppression
(14).
Nonsense suppression during vegetative growth of the
prfB mutants.
To determine if these suppressors could
act under conditions of vegetative growth as well as to quantify
misreading by the prfB mutants, we used a TGA nonsense
mutation that had been constructed in codon 7 of the CAT gene
catA86. This mutant, named UGA-7, is carried on pPL708C2
UGA-7 (26) and was introduced into the prfB1 strain MLK1013 and its parent strain BR151. In the presence of prfB1, the level of CAT activity from UGA-7-containing
bacteria grown at 37°C was increased 6.6-fold over that from the
isogenic prfB+ strain (Table
4). Analysis of the other prfB
suppressor mutants indicated that they too increased the level of UGA
readthrough from 3.8- to 7.1-fold. This analysis was complicated by
an unexpected effect of some of the suppressor mutations on the
constitutive expression of wild-type catA86 from pPL708C2.
When this is taken into consideration, the prfB mutants
increased CAT activity to 19 to 54% of that of the wild type from the
readthrough level of 6% of that of the wild type. These results
indicate that the suppressors were not acting specifically during
sporulation and could also suppress TGA mutations during vegetative
growth. The high level of UGA readthrough did not affect the growth
rate, even though UGA is used as a stop codon for about 20% of
B. subtilis genes (36). We also tested the
effects of the prfB1 mutation on readthrough of a UAA codon
at position 7 and found no suppression (data not shown), indicating
that suppression is limited to UGA codons. To explore the nature of
this suppression, we sequenced purified intact protein (UGA-7) from the
prfB1 pPL708C2 UGA-7 strain. The sole residue at position 7 was identified as tryptophan, indicating that tRNATrp was
decoding the UGA codon in the suppressor mutant. The three spoIIR UGA mutants that were analyzed (Table 2) were codon
changes from UGG, encoding Trp. Thus, if suppression at these UGA
codons occurs also by insertions of tryptophan, it would lead not only to the elongation of the protein to its full length but also to the
synthesis of a wild-type SpoIIR protein.
The nucleotide 3' to the UGA triplet affects the extent of
readthrough in
E. coli in the order A>G>C>U
(
23) and may explain
the leakiness of
catA86-UGA7 where the sequence is UGAA (
2).
The corresponding sequences for
spoIIR74,
spoIIR151, and
spoIIR152 are UGAG, UGAU,
and UGAU, respectively; the position 3' to UGA
might also explain, at
least partly, why the
spoIIR74 mutant exhibits
a leakier
sporulation phenotype than the
spoIIR151 and
spoIIR152 mutants as well as the relatively tight phenotype
the
spoIIR mutants
display compared to
catA86-UGA7.
To our knowledge, these are the first examples of mutations mapping in
a release factor gene in gram-positive bacteria. Identification
of
UGA-suppressor mutations mapping in
prfB provides the first
experimental support for the supposition that
prfB codes for
RF2.
The finding that the majority of the UGA-suppressor mutations
obtained (five of six) mapped in
prfB and not in a
trn gene was
surprising. It contrasts with results for
Enterobacteriaceae when
nearly all nonsense suppressors are
altered tRNAs (
13,
19).
It suggests subtle differences in
translational machinery between
B. subtilis and
Enterobacteriaceae.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grants AI09111
(to M.L.K.), GM42925 (to P.S.L.), and GM43577 (to P.J.P.) from the
National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Temple University School of Medicine, 3400 N. Broad St., Philadelphia, PA 19140. Phone: (215) 707-7927. Fax: (215)
707-7788. E-mail: piggotp{at}astro.ocis.temple.edu.
Present address: Regeneron Pharmaceuticals, Tarrytown,
NY 10591.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Ambulos, N. P.,
S. Mongkolsuk, and P. S. Lovett.
1985.
A transcription termination signal immediately precedes the coding sequence for the chloramphenicol-inducible plasmid gene cat-86.
Mol. Gen. Genet.
199:70-75[Medline].
|
| 3.
|
Anagnostopoulos, C., and I. P. Crawford.
1961.
Transformation studies on the linkage of markers in the tryptophan pathway in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
47:378-390[Free Full Text].
|
| 4.
|
Andersson, S. G. E., and C. G. Kurland.
1990.
Codon preferences in free-living microorganisms.
Microbiol. Rev.
54:198-210[Abstract/Free Full Text].
|
| 5.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1989.
Current protocols in molecular biology.
John Wiley and Sons, New York, N.Y.
|
| 6.
|
Azevado, V.,
E. Alvarez,
E. Zumstein,
G. Damiani,
V. Sgaramella,
S. D. Ehrlich, and P. Serror.
1993.
An ordered collection of Bacillus subtilis DNA segments cloned in yeast artificial chromosomes.
Proc. Natl. Acad. Sci. USA
90:6047-6051[Abstract/Free Full Text].
|
| 7.
|
Blanchard, A.
1990.
Ureaplasma urealyticum urease genes; use of a UGA tryptophan codon.
Mol. Microbiol.
4:669-670[Medline].
|
| 8.
|
Bradford, M. M.
1976.
A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 9.
|
Corran, J.
1968.
The induction of supersuppressor mutants of Bacillus subtilis by ethyl methanesulphonate and the posttreatment modification of mutation yield.
Mol. Gen. Genet.
103:42-57[Medline].
|
| 10.
|
Craigen, W. J.,
R. G. Cook,
W. P. Tate, and C. T. Caskey.
1985.
Bacterial peptide chain release factors: conserved primary structure and possible regulation of release factor 2.
Proc. Natl. Acad. Sci. USA
82:3616-3620[Abstract/Free Full Text].
|
| 11.
|
Cutting, S. M., and P. B. Vander Horn.
1990.
Genetic analysis, p. 27-74.
In
C. R. Harwood, and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley and Sons, Chichester, England.
|
| 12.
|
Di Giulio, M.
1997.
The origin of the genetic code.
Trends Biochem. Sci.
22:49-50.
|
| 13.
|
Eggertsson, G., and D. Söll.
1988.
Transfer ribonucleic acid-mediated suppression of termination codons in Escherichia coli.
Microbiol. Rev.
52:354-374[Free Full Text].
|
| 14.
|
Engelberg-Kulka, H., and R. Schoulaker-Schwarz.
1996.
Suppression of termination codons, p. 909-921.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella. Cellular and molecular biology, 2nd ed., vol. I. American Society for Microbiology, Washington, D.C.
|
| 15.
|
Errington, J.
1993.
Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis.
Microbiol. Rev.
57:1-33[Abstract/Free Full Text].
|
| 16.
|
Gish, W., and D. J. States.
1993.
Identification of protein coding regions by database search.
Nat. Genet.
3:266-272[Medline].
|
| 17.
|
Hoch, J. A.
1991.
Genetic analysis in Bacillus subtilis.
Methods Enzymol.
204:305-320[Medline].
|
| 18.
|
Inamine, J. M.,
K.-C. Ho,
S. Loechel, and P.-C. Hu.
1990.
Evidence that UGA is read as a tryptophan codon rather than as a stop codon by Mycoplasma pneumoniae, Mycoplasma genitalium, and Mycoplasma gallisepticum.
J. Bacteriol.
172:504-506[Abstract/Free Full Text].
|
| 19.
|
Johnston, H. M., and J. R. Roth.
1980.
UGA suppressor that maps within a cluster of ribosomal protein genes.
J. Bacteriol.
144:300-305[Abstract/Free Full Text].
|
| 20.
|
Karow, M. L.,
P. Glaser, and P. J. Piggot.
1995.
Identification of a gene, spoIIR, that links the activation of E to the transcriptional activity of F during sporulation in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
92:2012-2016[Abstract/Free Full Text].
|
| 21.
|
Kawakami, K., and Y. Nakamura.
1990.
Autogenous suppression of an opal mutation in the gene encoding peptide chain release factor 2.
Proc. Natl. Acad. Sci. USA
87:8432-8436[Abstract/Free Full Text].
|
| 22.
|
Kong, L.,
K. J. Siranosian,
A. D. Grossman, and D. Dubnau.
1993.
Sequence and properties of mecA, a negative regulator of genetic competence in Bacillus subtilis.
Mol. Microbiol.
9:365-373[Medline].
|
| 23.
|
Kopelowitz, J.,
C. Hampe,
R. Goldman,
M. Reches, and H. Engelberg-Kulka.
1992.
Influence of codon context on UGA suppression and readthrough.
J. Mol. Biol.
225:261-269[Medline].
|
| 24.
|
Londono-Vallejo, A., and P. Stragier.
1995.
Cell-cell signaling pathway activating a developmental transcription factor in Bacillus subtilis.
Genes Dev.
9:503-508[Abstract/Free Full Text].
|
| 25.
| Lovett, P. S. Unpublished results.
|
| 26.
|
Lovett, P. S.,
N. P. Ambulos, Jr.,
W. Mulbry,
N. Noguchi, and E. J. Rogers.
1991.
UGA can be decoded as tryptophan at low efficiency in Bacillus subtilis.
J. Bacteriol.
173:1810-1812[Abstract/Free Full Text].
|
| 27.
|
Nicholson, W. L., and P. Setlow.
1990.
Sporulation, germination, and outgrowth, p. 391-450.
In
C. R. Harwood, and S. M. Cutting (ed.), Molecular biology methods for Bacillus. John Wiley and Sons, Chichester, England.
|
| 28.
|
Ogawara, H.,
H. Urabe,
R. Ohtaki, and Y. Nakamura.
1995.
Properties of peptide chain release factor 2 from Streptomyces coelicolor A3(2): conserved primary structure but no frameshift regulation.
J. Bacteriol.
177:5342-5345[Abstract/Free Full Text].
|
| 29.
|
Parker, J.
1989.
Errors and alternative in reading the universal genetic code.
Microbiol. Rev.
53:273-298[Free Full Text].
|
| 30.
|
Pel, H. J.,
M. Rep, and L. A. Grivell.
1992.
Sequence comparison of new prokaryotic and mitochondrial members of the polypeptide chain release factor family predicts a five-domain model for release factor structure.
Nucleic Acids Res.
20:4423-4428[Abstract/Free Full Text].
|
| 31.
|
Petit, M.-A.,
C. Bruand,
L. Janniere, and S. D. Ehrlich.
1990.
Tn10-derived transposons active in Bacillus subtilis.
J. Bacteriol.
172:6736-6740[Abstract/Free Full Text].
|
| 32.
|
Piggot, P. J., and J. G. Coote.
1976.
Genetic aspects of bacterial endospore formation.
Bacteriol. Rev.
40:908-962[Free Full Text].
|
| 33.
|
Piggot, P. J., and C. A. M. Curtis.
1987.
Analysis of the regulation of gene expression during Bacillus subtilis sporulation by manipulation of the copy number of spo-lacZ fusions.
J. Bacteriol.
169:1260-1266[Abstract/Free Full Text].
|
| 34.
|
Roth, J. R.
1970.
UGA nonsense mutations in Salmonella typhimurium.
J. Bacteriol.
102:467-475[Abstract/Free Full Text].
|
| 35.
|
Sadaie, Y.,
H. Takamatsu,
K. Nakamura, and K. Yamane.
1991.
Sequencing reveals similarity of the wild-type div+ gene of Bacillus subtilis to the Escherichia coli secA gene.
Gene
98:101-105[Medline].
|
| 36.
|
Sharp, P. M.,
D. G. Higgins,
D. C. Shields,
K. M. Devine, and J. A. Hoch.
1990.
Bacillus subtilis gene sequences, p. 89-98.
In
M. M. Zukowski, A. T. Ganesan, and J. A. Hoch (ed.), Genetics and biotechnology of bacilli, vol. 3. Academic Press, San Diego, Calif.
|
| 37.
|
Shaw, W. V.
1975.
Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria.
Methods Enzymol.
43:737-755[Medline].
|
| 38.
|
Zhang, L.,
M. L. Higgins,
P. J. Piggot, and M. L. Karow.
1996.
Analysis of the role of prespore gene expression in the compartmentalization of mother cell-specific gene expression during sporulation of Bacillus subtilis.
J. Bacteriol.
178:2813-2817[Abstract/Free Full Text].
|
Journal of Bacteriology, August 1998, p. 4166-4170, Vol. 180, No. 16
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Teng, S., Gao, L., Paajanen, V., Pu, J., Fan, Z.
(2009). Readthrough of nonsense mutation W822X in the SCN5A gene can effectively restore expression of cardiac Na+ channels. Cardiovasc Res
83: 473-480
[Abstract]
[Full Text]
-
Sievers, J., Errington, J.
(2000). Analysis of the Essential Cell Division Gene ftsL of Bacillus subtilis by Mutagenesis and Heterologous Complementation. J. Bacteriol.
182: 5572-5579
[Abstract]
[Full Text]
-
Kannan, T. R., Baseman, J. B.
(2000). Expression of UGA-Containing Mycoplasma Genes in Bacillus subtilis. J. Bacteriol.
182: 2664-2667
[Abstract]
[Full Text]