Previous Article | Next Article 
Journal of Bacteriology, August 1998, p. 4227-4232, Vol. 180, No. 16
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
DNA Bending by AraC: a Negative Mutant
Beatrice
Saviola,
Robert R.
Seabold, and
Robert F.
Schleif*
Department of Biology, Johns Hopkins
University, Baltimore, Maryland 21218
Received 4 March 1998/Accepted 17 June 1998
 |
ABSTRACT |
We sought a mutation in the DNA binding domain of the arabinose
operon regulatory protein, AraC, of Escherichia coli that allows the protein to bind DNA normally but not activate transcription. The mutation was isolated by mutagenizing a plasmid overproducing a
chimeric leucine zipper-AraC DNA binding domain and screening for
proteins that were trans dominant negative with regard to wild-type AraC protein. The mutant with the lowest transcription activation of the araBAD promoter was studied further. It
proved to alter a residue that had previously been demonstrated to
contact DNA. Because the overproduced mutant protein still bound DNA in vivo, it is deficient in transcription activation for some reason other
than absence of DNA binding. Using the phase-sensitive DNA bending
assay, we found that wild-type AraC bends DNA about 90° whereas the
mutant bends DNA by a smaller amount.
 |
INTRODUCTION |
The catabolite gene activator
protein (CAP) and the AraC protein together stimulate the activity of
the promoter of the araBAD operon,
pBAD, in Escherichia coli (9,
18, 28). At this promoter, the AraC protein binds adjacent to and
partially overlaps the RNA polymerase binding site while CAP binds
behind AraC and a blank turn of the DNA lies between the two proteins
(3, 6, 23, 24). The binding site for AraC is larger than the
binding sites of many proteins, as each of the monomers of the dimeric AraC protein contacts two adjacent major-groove regions. Thus, the
41-base binding site for AraC at pBAD comprises
bases
73 to
33 and the 22-base CAP binding site comprises bases
104 through
83 (Fig. 1).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Protein binding sites and likely interactions between
RNA polymerase and AraC and CAP at the ara pBAD
promoter. By analogy to other activators that bind in the 40 to 70
region, AraC likely interacts with the C-terminal domain of alpha,
which is consistent with in vitro data (31, 32). Further,
the interaction likely is not exclusively with the polymerase-proximal
subunit of AraC since the presence of RNA polymerase bound at
pBAD substantially alters the DNA contacts made
by the polymerase-distal subunit of AraC (31). Further, the
C-terminal domain of the alpha subunit of RNA polymerase likely
interacts with CAP since mutations in AR1 of CAP affect
pBAD activation (33).
|
|
At pBAD, both CAP and AraC likely interact
with RNA polymerase via contacts made by the C-terminal domain of
the alpha subunit of RNA polymerase. In the lac and
gal operons, CAP is known to utilize residues in the
area known as activation region 1 (AR1) or AR2 to contact the
C-terminal domain of alpha (1, 4, 7, 8, 13, 22, 35).
Mutations in AR1 of CAP also affect CAP's activation of
pBAD (33), suggesting the existence
of the same sort of CAP-alpha interactions. Further, RNA polymerase
with the C-terminal domain of alpha truncated cannot be activated by AraC at pBAD (32), suggesting but not
proving the existence of an AraC interaction with the C-terminal domain
of alpha. Two predictions follow from consideration of the information
just given. First, it should be possible to isolate mutations in AraC that interfere with the presumed AraC-RNA polymerase interactions. Second, the long distance along the DNA from the RNA polymerase binding
site to the CAP binding site would not greatly hinder CAP-alpha
interactions if the intervening DNA were substantially bent, suggesting
that AraC may generate a significant bend in the DNA.
Something is already known concerning the first expectation. Chimeric
AraC proteins consisting of the DNA binding domain of AraC dimerized by
a leucine zipper region from C/EBP are capable of fully activating
pBAD (5). This suggests that all of
the determinants of AraC required for activation lie in its DNA
binding domain. Accordingly, mutations have been sought in the
DNA binding domain that affect transcription activation but not DNA
binding (25). Although 11 different mutations in six
different sites were identified that produce an apparently
activation-negative, DNA binding-positive phenotype, all proved
to bind arabinose more weakly than the wild-type protein and not
to be defective in AraC-RNA polymerase interactions. In light of the
number of mutations isolated, it seems difficult to isolate AraC-RNA
polymerase interaction mutations by simple scoring of activation and
DNA binding properties.
In the work reported here, we have addressed two questions raised by a
consideration of the above-mentioned facts. We developed and applied a
general scheme for the direct selection of mutants of AraC that bind
DNA normally but do not activate transcription, and we have measured
the amount of DNA bending produced by AraC.
 |
MATERIALS AND METHODS |
Strains, plasmids, and media.
The plasmid used for
overexpression of the leucine zipper dimerization domain-AraC DNA
binding domain protein was pSE380 (Invitrogen, San Diego, Calif.),
which was constructed by Bustos and Schleif (5). The AraC
DNA binding domain, amino acids 174 to 291, was cloned into the
BamHI and XbaI sites of pSE380, while DNA coding for amino acids 302 to 350 of the leucine zipper dimerization domain
from C/EBP was cloned into the NcoI and BamHI
sites. To mutagenize AraC, we transformed the plasmid containing the
DNA binding domain of AraC into competent mutator cells (endA1
gyrA96 thi-1 hsdR17 supE44 relA1 lac mutD5 mutS mutT
Tn10 Tetr), Epicurian coli XL1-red cells
(Stratagene), which have a 5,000-times-higher rate of mutation than
wild-type cells. Mutagenized plasmid DNA was isolated by miniprep, and
the DNA coding for the DNA binding domain of AraC was excised with
BamHI and XbaI, purified on a 0.8% agarose gel,
and ligated into plasmid DNA containing the leucine zipper dimerization
domain.
Transcription activation and repression by the mutagenized chimeric
protein were monitored in
E. coli SH288 (F'
araC102
araBAD+/
ara-leu-498 pC-lacZ
Str
r
lac-74 thi-1), which contains the
episome from F'102 in SH284
(
10). Reduced transcription
activation from
pBAD will result
in reduced
catabolism of arabinose, yielding red colonies on tetrazolium
arabinose
plates, whereas cells with wild-type transcription from
pBAD will appear white. Additionally, in the
same cells, AraC
unable to bind DNA and hence unable to repress
pC produces blue
colonies when grown on minimal
salts-0.4% glycerol-0.4% Casamino
Acids-10 µg of vitamin
B
1 per ml-0.002%
5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside
(X-Gal)
plates. If AraC can bind DNA and repress
pC, the
colonies
are white. The
trans-dominant negative phenotype
was assayed in
strain BS2 (F'
araC+
araBAD+/
ara-leu-498
lac-74 thi-1
[
I1-I1-pBAD-lacZ]
Str
r), which was constructed by the method of Simons et al.
(
29).
It carries a

phage with the
I1-I1 pBAD P5 promoter
(
24) fused
to the
lacZ gene. All mutants were
sequenced by double-stranded
sequencing (
17).
Enzyme assays.
The plasmid containing the mutagenized
chimeric AraC gene was transformed into SH288 for arabinose isomerase
assays (26). Cells were grown in minimal salts-0.4%
glycerol-10 µg of vitamin B1 per ml-0.4% Casamino
Acids until they reached an optical density at 600 nm
(OD600) of 0.4. A 3-ml volume of cells was centrifuged and
assayed as described by Schleif and Wensink (26). Repression and trans dominance were assayed through
-galactosidase
levels. Cells were grown in the same minimal medium used for the
arabinose isomerase assay until they reached an OD600 of
0.4. A 1-ml volume of cells was withdrawn and assayed as described by
Miller (21). The results reported are averages of two
independent assays.
DNA migration retardation assay.
The DNA migration
retardation assay was performed with wild-type and mutant chimeric AraC
proteins as previously described (11). Radiolabeled
pBAD DNA fragments were generated with PCR so
that an I1-I1 binding site for AraC
was located approximately 80 bp from each end of a 160-bp fragment.
This placement of the AraC binding site allows the maximum DNA bending
effect on electrophoretic mobility. To generate the DNA fragment by
PCR, 100 ng of a 32P-5'-end-labeled primer
(ATAATCACGGCAGAAAAGTCCA) at 106 cpm/ng was mixed
with 150 ng of an unlabeled primer (GTGCGCGTGCAGCCCTTATTGCCC) and template plasmid pES51 (12) containing the
I1-I2-pBAD promoter. The
PCR cycle parameters used were 95°C for 1 min, 55°C for 1 min, and
72°C for 1 min for 28 cycles.
Crude cell lysates were prepared from cells overexpressing parental or
mutant chimeric AraC proteins. Cells were grown to
an OD
600
of 0.7 in YT broth (
26). A 3-ml culture volume was
centrifuged and resuspended in 0.5 ml of 100 mM potassium phosphate
(pH
7.4)-50 mM KCl-10% glycerol-1 mM dithioerythritol-0.1 mM
ZnCl
2-1
mM EDTA. The resuspended cells were lysed by
sonication and centrifuged
at 8,500 ×
g for 10 min.
The supernatant was removed, and 170
µl of glycerol was added to 500 µl of the supernatant. The lysates
were then stored at

70°C
for up to 2 weeks. Binding reactions
were carried out with
10 mM Tris-acetate (pH 7.4)-1 mM EDTA-50
mM KCl-1 mM
dithiothreitol- 5% glycerol-50 ng of calf thymus DNA/µl.
Protein from the lysates was added so that just 100% of 1 ng of
I1-I2-
32P-end-labeled
DNA was bound. Samples were equilibrated for 20
min and loaded onto a
nondenaturing 6% polyacrylamide gel cross-linked
with 0.1%
methylene-bisacrylamide.
DNA for phase-sensitive bending assay.
AraC protein was
purified to homogeneity by Jeff Withey (27). Operator DNA
constructs were prepared by using standard molecular biological
techniques (19). The operator construct series was amplified
by PCR from plasmid DNA templates by using oligonucleotides with the
sequences CATCAGGAATTCGATCAG and GTAGTCGAATTCATGATG, the last 12 bases of each being complementary to the template. Each member of each series was constructed as a series of four overlapping oligonucleotides that were fused by using PCR ligation, cut
with EcoRI, and then inserted into the EcoRI site
of pUC19. The sequence of I1-O2 is
TAGCATTTTTATCCATATCTAGAAACCAATTGTCCATA, in which the half-sites have been underlined. The complete
sequence of the I1-O2 zero-base
insert DNA used in the bending assay is GAATTCGATCAGACATTGTCTAGACGATCAGAC ATTGTGCACATCGATACGTAGTACGCGTAAAAACGCGCAAAAA-X-T CATATAGCATTTTTATCCATAAGAAGAAACCAATTGTCCATAAGATC TCAGACAGTAGAGTCGACACGATCAGACATTGGATCCTCAGACATG AGCTCGCATCATGAATTC,
where the X marks a sequence of varying length, as described
below, and the position of the operator is underlined. The
I1-I1 and
I1-I2 operator series were
constructed similarly, differing only in the sequence of the second
half-site. The following sequences substituted for the bases underlined
above to make the different operators were
TAGCATTTTTATCCATAAGATTAGCATTTTTATCCATA (I1-I1) and
TAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGA
(I1-I2). Series members having
extra bases between the reference bend and the operator were also made
from four overlapping oligonucleotides. The additions for rotating the
reference bend were made at the position marked by the X in
the insert sequence above, where X was CCGCG, CCGCGG,
CCCGCGG, CAGCGCGG, CAGCCGCGG, CAGCCCGCGG, or CAGCACCGCGG for the
constructs with zero through six bases added, respectively. The
constructs used for determination of the constant k were
made in the same way. The sequences for the bent portions of those
constructs (shown in boldface type), which substitute for the
underlined sequence in the above insert were
TAGCATTTTTATCCATAAGATTAGCGATCCTACCTGA for one
bend, TAGCATTTTTATCCATTTTTATCCATA for
two bends, and TAGCATTTTTATCCATTTTT TAGCATTTTTATCCATA for three bends. The operator
synthesis PCR was performed with one 32P-labeled primer and
the other primer in excess to minimize the amount of labeled
single-stranded product.
Phase-sensitive bending assay.
The bending assay was
performed essentially as previously described (36), except
that the binding conditions were as follows. All assay binding
reactions were performed with 20-µl volumes. The buffer used for the
binding reaction contained 150 mM KCl, 10 mM Tris-acetate (pH 7.4), 1 mM EDTA, 5% glycerol, 1 mM dithioerythritol, and 0.05% (vol/vol)
Nonidet P-40. Arabinose, if present, was at 1% (wt/vol). AraC protein
was diluted immediately prior to use by slowly adding binding buffer to
an aliquot of protein stock solution. AraC was added to a final
concentration between 1 and 100 nM. DNA fragments were added to
concentrations between 1 and 10 nM. Samples were incubated at 37°C
for 20 min, a time sufficient to ensure that the reactions would reach
equilibrium. Electrophoresis through rinsed, presoaked 6% (wt/vol)
acrylamide-0.1% (wt/vol) bisacrylamide gels containing 10 mM
Tris-acetate and 1 mM K-EDTA was carried out at 5 V/cm for 6 h in
a horizontal apparatus with a connected recirculating pump maintaining
the buffer temperature at 20°C. For the bending assays in the
presence of arabinose, the running buffer included 1% (wt/vol)
arabinose. Gels were vacuum dried, and the radioactive bands were
visualized and quantitated by using a Molecular Dynamics PhosphorImager
PC.
The constant
k was determined by applying the equation given
in Results to the results of the phase-sensitive assay of migration
of
a standard bend series comprising one, two, and three phased
A
5 tracts, which were assumed to bend the DNA by 18, 36, and 54°
(
16).
 |
RESULTS |
Isolation of the mutant.
AraC mutants defective in the ability
to make specific interactions with RNA polymerase should be able to
bind DNA normally and repress pBAD and
pC by looping but not be able to
activate transcription from pBAD. The failure of
a previous screen (25) to yield such mutants could be the
result of a weak phenotype of the mutation, redundant interaction sites
on AraC, or an absence altogether of specific interaction sites. We
therefore developed a particularly powerful screen for mutants
defective in transcription activation but not defective in DNA binding.
We employed an overproducing plasmid encoding a chimeric protein
consisting of the DNA binding and transcription activation domain of
AraC fused to the leucine zipper dimerization domain of C/EBP
(5). Candidates having mutations in this gene were scored in
the presence of wild-type AraC encoded by a chromosomal gene. The
desired activation-defective mutants should dimerize, although not with
wild-type AraC, and bind to the araI site at ara
pBAD, where they will neither activate transcription
nor allow wild-type AraC to activate transcription. No other
plausible mutant types should display this
trans-dominant negative phenotype.
To limit the screen, only the DNA coding for the DNA binding domain of
the chimeric AraC was mutagenized. Fifty thousand plasmid-transformed
colonies were screened for defective activation of
pBAD and normal
repression of
pC. As described in Materials and Methods,
reduced
transcription activation from
pBAD
will result in reduced catabolism
of arabinose, thus giving red
colonies on arabinose tetrazolium
indicator plates. Cells possessing an
ara pC-lacZ fusion and containing
AraC capable
of repressing
pC produce white colonies on X-Gal
indicator plates, whereas cells containing AraC defective in DNA
binding and therefore defective in
pC repression
produce blue
colonies. One hundred candidates passing the first
induction and
repression screens were retransformed and also tested for
their
trans-dominant phenotype from the
I1-I1-pBAD
(
24) promoter in
the presence of wild-type AraC. The mutant
with the strongest
phenotype, H213Y, activated the
pBAD promoter less than 10% as
well as the
parental chimeric protein but could repress transcription
from
pC very well (Table
1). It was characterized more fully.
Measurement of the mutant's
trans-dominant negative
behavior with regard to wild-type AraC showed the dominant negative
effect
to be strong. Activation of
I1-I1-pBAD-lacZ by
wild-type AraC
was 660 Miller units, whereas activation was decreased
to 20 Miller
units in the presence of chimeric AraC carrying the H213Y
mutation.
We also tested the activation effect of the H213Y chimeric
AraC
on the
pFGH promoter and found it to be
nearly as active as the
parental protein (Table
1). The fact that the
mutant protein
induces
pFGH as well as the wild
type does suggests that its transcription
activation defect at
pBAD results from something other than
modification
of a region used for contact with RNA polymerase.
DNA bending by wild-type and mutant AraC.
Before examining the
DNA bending properties of the mutant, it was necessary to learn the DNA
bending properties of wild-type AraC. The direction and amount of
bending in a DNA molecule or protein-DNA complex can be measured
approximately by gel electrophoresis methods that rely on the fact that
bent DNA migrates through a gel more slowly than straight DNA (14,
15, 30, 36). The phase-sensitive bending assay designed by Zinkel
and Crothers (36) seems particularly well suited to
careful measurement of DNA bending. It compares the
amount of migration retardation among a series of protein-bound DNA
fragments. The fragments differ from each other as the distance of a
reference bend from the protein binding site is increased incrementally
by the insertion of one, two, etc., bases, thereby rotating the
reference bend with respect to the protein-derived bend. When the
reference and protein-derived bends are in phase, the bending angles
sum and the DNA fragment migrates most slowly, and when the bends are
out of phase, a portion of the total amount of bending is negated and
the fragment migrates more rapidly. The resulting data allow
approximate determination of the direction of the protein-induced bend
and its magnitude.
We measured the bending produced by AraC in three different operator
construct series. The normal
araI site from which AraC
activates transcription from
pBAD consists of
the polymerase-distal
I1 half-site and the
polymerase-proximal
I2 half-site. In the
absence of arabinose, dimeric AraC loops between the
I1 half-site
and the
O2
half-site located 212 bp upstream. To examine the possibility
that the intrinsic bend of any of these sites is significantly
different from that of the others or determine whether AraC bends
each
half-site similarly, we examined the bending produced by
three series
of constructs. Each series contained centrally placed
two-half-site
operators in which the first half-site was
araI1 and the second was either the
araI1,
araI2, or
araO2
half-site,
therefore making the operators
I1-I1,
I1-I2, and
I1-O2. Each series
member contained
a reference bend, the operator, and an intervening
segment whose length
increased within each series to increase
the distance, and therefore
the angle of rotation, of the reference
bend with respect to the
operator. The operators were positioned
such that the portions of their
major grooves that are contacted
by AraC were in helical phase with the
reference bend so that
the reference bend was toward the major grooves
when no additional
bases were inserted. We used two phased
A
5 tracts to provide an
about 36° reference bend
(
16).
Figure
2 shows the results of the
phase-sensitive bending assay for the
I1-I1,
I1-I2, and
I1-O2 operator constructs with
arabinose
present in the binding reaction mixture and running
buffer. Identical
data were produced in the absence of arabinose
(data not shown).
For each construct, the bend angle

was calculated
from the following
equation (
14):
where
Aph (amplitude of phasing) is the
difference in the
Rf values of the maximally and
minimally retarded DNA species when
their mean is taken to be an
Rf of 1.0,

is the angle of the
directed
reference bend, in this case 36°, and
k is an empirical
constant, determined in our case to be 0.7 by using known bends.
We
used a series of one, two, and three phased A
5 tracts to
determine
k. All three AraC-bound operators,
I1-I1,
I1-I2, and
I1-O2, were
found to be bent about
90° toward AraC, both in the presence and
in the absence of
arabinose.

View larger version (14K):
[in this window]
[in a new window]

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
(Left) Representation of the DNA fragments used in the
phase-sensitive DNA bending assay. The top pair shows bends in phase
and out of phase, and the bottom three show the structures of the three
araI sites used. The shaded region is the area in which
bases were added to shift the phase of the reference bend with respect
to the araI sites. The reference bend was generated by two
in-phase A5 tracts. (Right) Phase-sensitive bend assays of
I1-I1,
I1-I2, and
I1-O2 sites. The distances of
migration, in millimeters, are given next to the minimally and
maximally retarded species for each construct.
|
|
We attempted to use the phase-sensitive assay to measure the DNA
bending generated by the parental and mutant chimeric proteins
(Fig.
3). For unknown reasons, the chimeric
proteins exacerbate
the tendency of the DNA used in the assay to form
indistinct bands.
Therefore, we present the data which show that the
mutant chimera
bends DNA less than the parental chimera but refrained
from attempting
to determine actual bending angles. The top part
of Fig.
4 shows
the results of a simple
DNA migration retardation assay in which
the binding site was located
near the middle of a 160-bp DNA fragment.
The mutant chimeric
protein retarded migration substantially less
than the parental
chimeric protein did. The bottom part of Fig.
4 shows that AraC
containing the H213Y mutation also retarded
the DNA less than wild-type
AraC did.

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 3.
Phase-sensitive bending assay of the parental C/EBP-AraC
chimera and the H213Y chimera performed with crude cell lysates.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Migration retardation assay of DNA bending by the
chimeric proteins and by AraC using DNA containing the
I1-I2 binding site in the
middle of a 160-bp fragment. The protein sources were 1 µl of a
lysate containing either parental or H213Y chimeric AraC and 1 µl of
purified wild-type (WT) AraC at 0.4 mg/ml.
|
|
 |
DISCUSSION |
We used a simple screen to identify mutations within AraC
specifically defective in transcription activation. It utilizes a
chimeric protein composed of the DNA binding and transcription activation domain of AraC fused to the leucine zipper dimerization domain of C/EBP. Mutations in the chimeric protein that are defective in transcription activation but not defective in DNA binding should be
trans dominant negative with regard to wild-type AraC
protein. We identified a number of mutants with the desired
characteristics and studied the one with the strongest phenotype,
H213Y, more carefully.
The H213Y mutation was previously isolated in a screen for mutants with
reduced ability to activate pBAD (3).
Because its alteration was found to lie within a potential recognition
helix in AraC, the mutant protein was used in a missing-contact
experiment and found to have lost contact with three bases in each of
the half-sites of araI. This raises the question of why the
mutant protein is defective in transcription activation. It certainly binds DNA because it is trans dominant negative. Although it
is possible that the amino acid residues that directly contact DNA also
contact RNA polymerase to help activate transcription, this possibility seems somewhat unlikely. We therefore considered the possibility that the protein is defective in DNA bending and that a
change in bending interferes with the formation of some of the protein-protein contacts required for activation at
pBAD. Consequently, we first measured the DNA
bending produced by AraC protein at araI and at two closely
related sites.
AraC bends DNA substantially, approximately 90°. H213Y AraC and
the H213Y AraC-C/EBP chimeric protein bend DNA less. The reduced bending is shown both in the phase-sensitive assay and by the migration
rate reduction induced by the mutant proteins when the AraC binding
site is in the middle of the DNA fragment. The possibility that the
H213Y chimera retards DNA less than the parental protein does because
it is a monomer in vivo is not plausible. The mutation lies in a
domain of the protein that does not contain determinants for
dimerization. Additionally, H213Y chimeric AraC represses transcription of the promoter pC, whereas
the monomeric DNA binding domain is incapable of repressing
pC (34). It does not seem likely that
the mutation could alter the structure of the DNA binding domain in
such a way that migration retardation is altered in a phase-specific
way in the phase-sensitive assay, as well as in the simple-bend assay,
particularly in light of the fact that the residue that is altered
apparently directly contacts DNA.
In contrast to its behavior at the pBAD
promoter, the H213Y AraC-C/EBP chimera activated the
pFGH promoter nearly as well as the parental
chimeric protein did. Examination of the pBAD and pFGH promoter structures reveals why this
might be the case (Fig. 5). At
pBAD, AraC binds between RNA polymerase and CAP
and the bending produced by AraC likely facilitates the formation of an
RNA polymerase interaction with the rear subunit of AraC (31), as well as an RNA polymerase-CAP interaction
(33). At pFGH, it is CAP that binds
between RNA polymerase and AraC. As a result, DNA bending by AraC may
be unnecessary for transcription activation at
pFGH because no polymerase contacts are likely
to be made beyond the downstream face of AraC.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Protein binding sites and likely RNA polymerase
interactions with CAP and AraC at the ara pFGH
promoter. At pFGH, the direct-repeat half-sites
for AraC binding are reversed from their direction at
pBAD.
|
|
We do not understand why the H213Y mutation has a significantly
stronger effect in the context of the C/EBP-AraC chimera than when the
mutation is in AraC itself. When present in the chimera, the mutation
reduces activation by a factor of more than 10, but when in intact
AraC, the mutation reduces activation by a factor of about 2. It is
possible that a site that can function in activation lies within the
dimerization domain of AraC. Another possibility is that the DNA
bending produced by AraC is different from that produced by the
chimeric protein.
Mutations changing the degree of DNA bending have been isolated in
several other proteins. In FIS protein, the mutation R71A results in a
reduced ability to bend the DNA, and yet the protein binds DNA with
close to wild-type affinity (2). A mutant form of the phage
29 P4 protein also results in reduced DNA bending with retention of
nearly normal DNA binding affinity (20). These mutants may
be defective in transcription activation because other required
protein-protein interactions cannot form due to insufficient DNA
bending. Many other studies have implicated DNA bending in the
activation of promoter activity, but in such work, as was the case
here, it is most difficult to determine the underlying relevant
mechanism, whether it is DNA bending per se, the creation of a binding
site for another protein, the creation or improvement of a binding site
for the C-terminal domain of the RNA polymerase alpha subunit, or the
facilitation of the formation of a multiprotein complex.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant GM18277 to R.F.S.
We thank Jeff Withey and Beth MacDougall-Shackleton for their
assistance and Richard Gourse for activating us to examine the bending
of H213Y after the principal investigator had rejected the idea.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, Johns Hopkins University, 3400 N. Charles Street, Baltimore, MD 21218. Phone: (410) 516-5206. Fax: (410) 516-5213. E-mail: bob{at}gene.bio.jhu.edu.
 |
REFERENCES |
| 1.
|
Bell, A.,
K. Gaston,
R. Williams,
K. Chapman,
A. Kolb,
H. Buc,
S. Minchin,
J. Williams, and S. Busby.
1990.
Mutations that alter the ability of the Escherichia coli cyclic AMP receptor protein to activate transcription.
Nucleic Acids Res.
18:7243-7250[Abstract/Free Full Text].
|
| 2.
|
Bokal, A. J.,
W. Ross,
T. Gaal,
R. C. Johnson, and R. L. Gourse.
1997.
Molecular anatomy of a transcription activation patch: FIS-RNA polymerase interactions at the Escherichia coli rrnB P1 promoter.
EMBO J.
16:154-162[Medline].
|
| 3.
|
Brunelle, A., and R. Schleif.
1989.
Determining residue-base interactions between AraC protein and araI DNA.
J. Mol. Biol.
209:607-622[Medline].
|
| 4.
|
Busby, S., and R. Ebright.
1997.
Transcription activation at class II CAP-dependent promoters.
Mol. Microbiol.
23:853-859[Medline].
|
| 5.
|
Bustos, S. A., and R. F. Schleif.
1993.
Functional domains of the AraC protein.
Proc. Natl. Acad. Sci. USA
90:5638-5642[Abstract/Free Full Text].
|
| 6.
|
Carra, J., and R. Schleif.
1993.
Variation of half-site organization and DNA looping by AraC protein.
EMBO J.
12:35-44[Medline].
|
| 7.
|
Ebright, R. H.
1993.
Transcription activation at class I CAP-dependent promoters.
Mol. Microbiol.
8:797-802[Medline].
|
| 8.
|
Eschenlauer, A. C., and W. S. Reznikoff.
1991.
Escherichia coli catabolite gene activator protein mutants defective in positive control of lac operon transcription.
J. Bacteriol.
173:5024-5029[Abstract/Free Full Text].
|
| 9.
|
Greenblatt, J., and R. Schleif.
1971.
Arabinose C protein: regulation of the arabinose operon in vitro.
Nat. New Biol.
233:166-170[Medline].
|
| 10.
|
Hahn, S., and R. F. Schleif.
1983.
In vivo regulation of the Escherichia coli araC promoter.
J. Bacteriol.
155:593-600[Abstract/Free Full Text].
|
| 11.
|
Hendrickson, W., and R. F. Schleif.
1984.
Regulation of the Escherichia coli L-arabinose operon studied by gel electrophoresis DNA binding assay.
J. Mol. Biol.
178:611-628[Medline].
|
| 12.
|
Huo, L.,
K. Martin, and R. F. Schleif.
1988.
Alternate DNA loops regulate the arabinose operon in Escherichia coli.
Proc. Natl. Acad. Sci. USA
85:5444-5448[Abstract/Free Full Text].
|
| 13.
|
Igarashi, K., and A. Ishihama.
1991.
Bipartite functional map of the E. coli RNA polymerase alpha subunit: involvement of the C-terminal region in transcription activation by cAMP-CRP.
Cell
65:1015-1022[Medline].
|
| 14.
|
Kerppola, T. K., and T. Curran.
1991.
DNA bending by Fos and Jun: the flexible hinge model.
Science
254:1210-1214[Abstract/Free Full Text].
|
| 15.
|
Koo, H. S., and D. M. Crothers.
1986.
DNA bending at adenine-thymine tracts.
Nature
320:501-506[Medline].
|
| 16.
|
Koo, H.-S.,
J. Drak,
J. Rice, and D. M. Crothers.
1990.
Determination of the extent of DNA bending by an adenine-thymine tract.
Biochemistry
29:4227-4234[Medline].
|
| 17.
|
Kraft, R.,
J. Tardiff,
K. S. Krauter, and L. A. Leinwand.
1988.
Using mini-prep plasmid DNA for sequencing double stranded templates with Sequenase.
BioTechniques
6:544-546[Medline].
|
| 18.
|
Lee, N.,
G. Wilcox,
W. Gielow,
J. Arnold,
P. Cleary, and E. Englesberg.
1974.
In vitro activation of the transcription of araBAD operon by araC activator.
Proc. Natl. Acad. Sci. USA
71:634-638[Abstract/Free Full Text].
|
| 19.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 20.
|
Mencia, M.,
M. Monsalve,
M. Salas, and F. Rojo.
1996.
Transcriptional activator of the phage phi29 late promoter: mapping of residues involved in interaction with RNA polymerase and in DNA bending.
Mol. Microbiol.
20:273-282[Medline].
|
| 21.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 22.
|
Niu, W.,
Y. Kim,
G. Tau,
T. Heyduk, and R. H. Ebright.
1996.
Transcription activation at class II CAP-dependent promoters: two interactions between CAP and RNA polymerase.
Cell
87:1123-1134[Medline].
|
| 23.
|
Ogden, S.,
D. Haggerty,
C. Stoner,
D. Kolodrubetz, and R. Schleif.
1980.
The Escherichia coli L-arabinose operon: binding sites of the regulatory proteins and a mechanism of positive and negative regulation.
Proc. Natl. Acad. Sci. USA
77:3346-3350[Abstract/Free Full Text].
|
| 24.
|
Reeder, T., and R. Schleif.
1993.
AraC protein can activate transcription from only one position and when pointed in only one direction.
J. Mol. Biol.
231:205-218[Medline].
|
| 25.
|
Saviola, B.,
R. Seabold, and R. Schleif.
1998.
Arm-domain interactions in AraC.
J. Mol. Biol.
278:539-548[Medline].
|
| 26.
|
Schleif, R., and P. Wensink.
1981.
Practical methods in molecular biology.
Springer-Verlag, New York, N.Y.
|
| 27.
|
Schleif, R. F., and M. A. Favreau.
1982.
Hyperproduction of AraC protein from Escherichia coli.
Biochemistry
21:778-782[Medline].
|
| 28.
|
Sheppard, D. E., and E. Englesberg.
1967.
Further evidence for positive control of the L-arabinose system by gene araC.
J. Mol. Biol.
25:443-454[Medline].
|
| 29.
|
Simons, R. W.,
F. Houman, and N. Kleckner.
1987.
Improved single and multicopy lac-based cloning vectors for protein and operon fusions.
Gene
53:85-96[Medline].
|
| 30.
|
Thompson, J. F., and A. Landy.
1988.
Empirical estimation of protein-induced DNA bending angles: applications to lambda site-specific recombination complexes.
Nucleic Acids Res.
16:9687-9705[Abstract/Free Full Text].
|
| 31.
|
Zhang, X.,
T. Reeder, and R. Schleif.
1996.
Transcription activation parameters at ara pBAD.
J. Mol. Biol.
258:14-24[Medline].
|
| 32.
|
Zhang, X.
1997.
Ph.D. dissertation.
Johns Hopkins University, Baltimore, Md.
|
| 33.
|
Zhang, X., and R. Schleif.
1998.
Catabolite gene activator protein mutations affecting activity of the araBAD promoter.
J. Bacteriol.
180:195-200[Abstract/Free Full Text].
|
| 34.
| Zhang, X., and R. Schleif. Unpublished data.
|
| 35.
|
Zhou, Y.,
X. Zhang, and R. H. Ebright.
1993.
Identification of the activating region of catabolite gene activator protein (CAP): isolation and characterization of mutants of CAP specifically defective in transcription activation.
Proc. Natl. Acad. Sci. USA
90:6081-6085[Abstract/Free Full Text].
|
| 36.
|
Zinkel, S. A., and D. M. Crothers.
1987.
DNA bend direction by phase sensitive detection.
Nature
328:178-181[Medline].
|
Journal of Bacteriology, August 1998, p. 4227-4232, Vol. 180, No. 16
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Porter, M. E., Dorman, C. J.
(2002). In Vivo DNA-Binding and Oligomerization Properties of the Shigella flexneri AraC-Like Transcriptional Regulator VirF as Identified by Random and Site-Specific Mutagenesis. J. Bacteriol.
184: 531-539
[Abstract]
[Full Text]
-
Egland, K. A., Greenberg, E. P.
(2000). Conversion of the Vibrio fischeri Transcriptional Activator, LuxR, to a Repressor. J. Bacteriol.
182: 805-811
[Abstract]
[Full Text]
-
Luo, Z.-Q., Farrand, S. K.
(1999). Signal-dependent DNA binding and functional domains of the quorum-sensing activator TraR as identified by repressor activity. Proc. Natl. Acad. Sci. USA
96: 9009-9014
[Abstract]
[Full Text]