Department of Biochemistry and Molecular
Biology, Louisiana State University Medical Center, Shreveport,
Louisiana
 |
INTRODUCTION |
The gram-positive, spore-forming
bacterium Bacillus subtilis will activate one of several
developmental programs when it is confronted with a growth-restricting
environment. As is the case with many bacterial species faced with
nutritional stress, B. subtilis will produce several
extracellular degradative enzymes and antibiotics. More elaborate
responses include the establishment of motility and processes of
cellular specialization such as sporulation and genetic competence.
Molecular mechanisms exist which serve as switches that permit
the cell to choose an appropriate developmental path in response
to harsh environmental conditions (18). An example of such a
mechanism is the SinR-SinI pair, which participates in the
cell's decision to undergo either sporulation or competence and
motility (3, 17, 29, 42). The phosphorylation state of the
response regulator DegU is another determinant of whether cells produce
degradative enzymes such as proteases or undergo competence
establishment and become motile (26).
Although motility and genetic competence appear to be coregulated,
recent studies have shown that there likely exists another molecular switch governing the cell's decision to choose one or the
other of these pathways. Competence development is part of a
complex signal transduction network influenced by the nutritional state
of the environment and cell density (13, 18; Fig.
1). The key regulatory event in the
establishment of genetic competence is activation of transcription
factor ComK (46). ComK is required for transcription of the
late competence operons (13, 35, 46) that encode, among
other proteins, ComE (a DNA binding protein that functions in DNA
uptake); ComGA, -B, and -C, which form a type IV pilus bundle that is
thought to position ComE; and ComFA, an ATP-dependent helicase required
for DNA import (6, 7, 10, 11). ComK is negatively controlled
by MecA and ClpC by direct protein-protein interaction (24,
44). MecA-ClpC-dependent inhibition of ComK is overcome by ComS
(9, 21, 44), a small protein encoded by the srf
operon (8, 21, 36, 37, 45), which also encodes the enzyme
surfactin synthetase, a peptide synthetase catalyzing the synthesis of
the lipopeptide antibiotic surfactin (15, 32, 45, 47).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
ComK-dependent and -independent MecA control of
hag expression. High cell density and nutritional stress
stimulate expression of the comS gene. ComS interaction with
MecA-ClpC results in release of ComK, which activates
comF-flgM operon transcription, as well as the
expression of other late competence operons. Antisigma factor
FlgM negatively controls D, resulting in reduced
expression of hag and other genes of the
D-regulon. MecA affects the D protein
level, particularly in cells grown in medium that promotes competence
development.
|
|
The transcription of genes that function in motility, including those
that code for flagellum assembly, proteins functioning in
chemotaxis, and autolysins, requires the alternative RNA
polymerase sigma subunit
D (1, 20, 27, 31,
34, 41). FlgM functions as an antisigma factor that
negatively controls
D (4, 14). MecA
exerts opposite effects on competence development and motility
(40, 43). MecA negatively controls the establishment of
competence by interaction with ComK but is required for optimal expression of genes that are transcribed by the
D
form of RNA polymerase. Thus, MecA may serve as part of a molecular switch governing the cell's decision to become motile or undergo genetic competence. Two independent reports provide conflicting views
of how MecA-dependent positive control is exerted. Rashid et al.
presented data suggesting that MecA control is independent of ComK
(43), while Ogura and Tanaka proposed that ComK negatively controls
D-dependent transcription and that the positive
effect of MecA occurs solely through its interaction with ComK
(40).
This report includes data showing that there exist both
ComK-dependent and -independent mechanisms of MecA
control of flagellar gene expression and that ComK negatively
controls
D-dependent transcription by stimulating the
transcription of the flgM gene encoding the
D-specific antisigma factor. MecA inhibits ComK but also
affects the level of
D in a ComK-independent manner.
 |
MATERIALS AND METHODS |
Bacterial strains.
The B. subtilis strains used
in this study are listed in Table 1. All
of the strains constructed during this study are derivatives of
B. subtilis JH642 (from J. Hoch). DNA from HB1002 cells
bearing a hag-lacZ translational fusion
(5; from J. D. Helmann) was used to transform
JH642 competent cells with selection for erythromycin resistance
(Ermr) to create strain LAB2607. To create mecA
and comK mutant strains bearing a hag-lacZ
translational fusion (strains LAB2722 and LAB2723, respectively), DNA
from AG1312 (mecA::spc) (25) or
8G32 (comK::kan) (46) was used to
transform LAB2607 competent cells with selection for spectinomycin
(Spcr) or neomycin (Neor) resistance. A
mecA comK double mutant bearing a hag-lacZ
translational fusion (LAB2724) was constructed by transforming
LAB2607 competent cells with DNA from AG1312 and 8G32 with selection
for Spcr and screening for Neor.
The flgM
80 mutation is an in-frame deletion removing
codons 6 through 85 of the flgM gene (34). To
create a flgM
80 SP
c2
2 Tn917::
(Phag-cat-lacZ) kan
strain, the transducing lysate of HB4041 [ZB307A SP
c2
2
Tn917::
(Phag-cat-lacZ) kan,
obtained from J. D. Helmann (14)] was used to
lysogenize CB149 (flgM
80) (34) with selection
for chloramphenicol resistance (Cmr), creating strain
LAB2827. Phag-cat-lacZ is a transcriptional fusion
containing the promoter region of hag with the upstream UP
element deleted (14). The same lysate was used to transduce strains JH642, LAB2916, LAB2917, LAB2724, LAB2923, LAB2924, and LAB2925, thereby creating the wild type (LAB2819) and
mecA (LAB2920), comK (LAB2921), mecA
comK (LAB2922), mecA flgM
80 (LAB2926), comK flgM
80 (LAB2928), and mecA comK flgM
80
(LAB2929) mutant strains bearing the phage-borne hag-lacZ
transcriptional fusion, respectively. The presence of the
flgM
80 mutation was verified by PCR and agarose gel
electrophoresis of the flgM-specific PCR fragment. The
forward primer (UFlgM') used for PCR amplification was a 22-mer
with the sequence GCGAATTCAGATCACTCATCTT, and the reverse
primer (LFlgM') was a 24-mer with the sequence
GGGCTTTCTCCTTTTTTATTGCTT.
To create an insertion mutation at the site of PD-1 of the
comF-flgM operon (34), a DNA fragment
extending from 539 bp upstream to 329 bp downstream of the
PD-1 transcription start site was synthesized by PCR
amplification. The forward primer used to amplify the fragment
was a 30-mer with the sequence ACGCGGATCCTCA
ATCTGTTCATGCCGTAT, and the reverse primer was a 30-mer
with the sequence TAAACTGCAGGGTATGCCAAATTAG GAAGA. The primers contained restriction sites for
BamHI and PstI, respectively. These sites
(underlined) were used to insert the cleaved PCR fragment into
BamHI-PstI-cleaved plasmid pMMN13
(36), a pGEM4 derivative carrying a cat gene.
The resulting plasmid was then introduced into wild-type
strain JH642 by transformation with selection for Cmr. The
lysate of the SP
c2
2
Tn917::
(Phag-cat-lacZ) kan
strain was then used to lysogenize one of the transformants with
selection for Neor.
Transformation and transduction.
Competent B. subtilis cells were prepared as previously described
(12). Specialized transduction with SP
was done as
described by Zuber and Losick (48).
Media.
B. subtilis cells were routinely cultivated in
2XYT medium (36) to obtain cells for the preparation of DNA
or to induce antibiotic resistance in transformed cells. 2XYT and
one-step competence medium (CM) (12, 38) were used to
culture cells for assays of lacZ fusion-encoded
-galactosidase activity. Escherichia coli cells were
propagated in 2XYT medium to obtain cells for plasmid isolation. The
antibiotic concentrations used for selection of drug-resistant
organisms were as follows: chloramphenicol, 5 µg/ml; erythromycin in
combination with lincomycin, 1 and 25 µg/ml, respectively; neomycin,
5 µg/ml; spectinomycin, 75 µg/ml; ampicillin, 25 µg/ml. The
antibiotic concentrations used to induce drug resistance were as
follows: chloramphenicol, 0.5 µg/ml; erythromycin, 0.1 µg/ml.
Culture conditions and
-galactosidase assay.
Cells
precultured in Difco sporulation (DSM) agar plates or 2XYT broth at
37°C overnight were used to inoculate CM or 2XYT broth. Cultures were
grown in 300-ml baffled sidearm flasks (MRA, Clearwater, Fla.) at
37°C in a shaking water bath. Samples were collected and assayed for
-galactosidase activity by the methods described previously
(37, 49).
Protein extraction and Western immunoblot analysis.
Samples
were harvested at T0 (at the end of exponential
growth) and T2 (2 h after the end of exponential
growth) by centrifugation at 4°C. The cells were washed once in
phosphate-buffered saline, centrifuged again, and stored at
70°C.
The thawed pellets were resuspended in 20 mM Tris-HCl (pH 7.5)-5 mM
EDTA-1 mM dithiothreitol-1.5 mM phenylmethylsulfonyl fluoride. Whole
cell extracts were prepared with a French press, diluted in sodium
dodecyl sulfate (SDS) sample buffer, and boiled for 5 min. Samples with
the same protein concentrations, as determined with a Bio-Rad protein
assay kit, were applied to an SDS-12% polyacrylamide gel. After
electrophoresis, the proteins were electrotransferred to nitrocellulose
and probed with anti-
D antibodies (obtained from J. D. Helmann), followed by a secondary rabbit antibody conjugated with
alkaline phosphatase as recommended by the manufacturer (GIBCO Bethesda
Research Laboratories). The intensity of each band was determined with
the NIH-Image computer program.
Construction of the flgM'-lacZ fusion.
The same
PCR product as described in the construction of the
comF-flgM insertion mutation was cleaved with
PstI followed by T4 DNA polymerase to render the ends flush.
The blunt-ended PCR fragment was digested with BamHI. The
digested PCR fragment was then inserted in front of a promoterless
lacZ gene in plasmid pTKlac (23), which was cut
with HindIII, treated with T4 DNA polymerase to fill in
the HindIII ends, and then cleaved with BamHI. The resulting plasmid (pJL011) was then introduced
into JH642 competent cells by transformation. To examine the effects of
mutations in comK, sigD, or both comK
and sigD on the expression of flgM'-lacZ,
comK mutant, sigD mutant, or comK sigD
double mutant cells bearing flgM'-lacZ were constructed by
transformation with DNA from the three mutant strains, using the
wild-type strain carrying flgM'-lacZ as the recipient. In
the case of the sigD mutation, the cat insertion
marker had to be replaced with the erm marker of plasmid
pCm::Er of strain ECE72 (Bacillus subtilis Genetic Stock
Center, Columbus, Ohio), which was used to transform CB100 cells with
selection for Ermr and screening for Cms.
Reverse transcription-PCR (RT-PCR).
Wild-type and
comK mutant cells grown in CM were harvested at
T0.5 to isolate RNA. Isolation of RNA was
performed as previously described (39). To ensure that no
contaminating DNA was present in the RNA preparation, about 4 to 5 µg
of the RNA sample (in 15 µl) was incubated at 37°C for 1 h
with 30 U of RNase-free DNase and 0.5 µl (20 U) of RNase inhibitor
(Promega) in a 50-µl volume. DNase-treated RNA samples still
containing contaminating DNA were treated again as described above
until no DNA contamination was detected by PCR. The treated RNA samples
were recovered by using RNaid in accordance with the protocol
recommended by the manufacturer (Bio 101, Inc.). PCR was performed to
check for contaminating DNA (for the locations of the primers used, see
Fig. 8). The nucleotide sequences of the downstream and upstream
primers are as follows, respectively:
5'-GCACCTTTCACAAGGGTATGCAAATTAG-3' (primer 1 [see Fig. 8])
and 5'-ACGCGGATCCTCAATCTGTTCATGCCGTAT-3' (primer 2 [see Fig. 8]).
RT was conducted as described previously (2). The purified
RNA was used as a template to synthesize cDNA strands by using avian
myeloblastosis virus reverse transcriptase (Promega) and the antisense
downstream primer shown above that was designed to anneal to
orf139 mRNA. The resulting cDNA was then used as a template
to create an amplified RT-PCR fragment by using Vent polymerase (New
England BioLabs). The downstream and upstream primers were the same as
those used as mentioned above to check for contaminating DNA,
while another upstream primer with the nucleotide sequence
5'-ATGGGAGAACTGGCTAATTGTCCGAAATGCA-3' (primer 3 [see Fig.
8]), which starts at the translational initiation codon of
orf139, was used to detect both the readthrough
comF-flgM operon transcript and the transcript
initiating at the PD-1 promoter. The resulting RT-PCR
products were identified by agarose gel electrophoresis (1%, wt/vol),
while the PCR product from a template of chromosomal DNA from wild-type
B. subtilis JH642 was applied as a positive control.
 |
RESULTS |
mecA, comK, and comS affect the
expression of hag-lacZ.
To reexamine the roles of MecA and
ComK in the regulation of the
D regulon, the
mecA and comK mutations were introduced by
transformation into cells bearing a translational hag-lacZ
fusion plasmid integrated at the hag locus (14).
A fusion-bearing strain containing both of the mecA and
comK mutations was also constructed. Expression of
hag in the three mutant strains was examined in cultures
grown in 2XYT and in CM. Rich medium conditions, such as those existing in 2XYT, promote expression of genes of the
D regulon
but do not promote competence due to the Mec-dependent inhibition of
ComK. This inhibition is relieved in CM by the comS gene
product. High levels of hag-lacZ activity were observed in wild-type cells grown in 2XYT, with expression increasing as the culture reached the end of exponential growth (Fig.
2A). A mecA mutation
resulted in substantially lower hag-lacZ activity throughout the growth curve. The comK mutation did not change the level
of expression from that observed in wild-type cells, but introduction of a mecA mutation into the comK background
resulted in a modest but reproducible decrease in expression. MecA
positively influences hag-lacZ expression primarily by
inhibiting ComK activity but may play some additional role in
hag expression.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of hag-lacZ in the wild type and
mecA, comK, and mecA comK, and
srf (comS) mutants. Cells of each strain were
grown in 2XYT (A) or CM (B and C), and samples were collected at the
indicated times. hag-directed -galactosidase activity was
determined as described in Materials and Methods and in accordance with
published protocols. Symbols: , LAB2723 (comK hag-lacZ);
, LAB2607 (hag-lacZ); , LAB2724 (comK mecA
hag-lacZ); , LAB2722 (mecA hag-lacZ); , LAB2944
(hag-lacZ srf).
|
|
In cells grown in CM, ComK levels are higher due to reversal of
Mec-dependent inhibition by ComS (19, 28, 44). Thus, comK more profoundly influences hag-lacZ
expression. As shown in Fig. 2B, the expression of hag-lacZ
in a comK mutant is significantly higher than in wild-type
cells. As in 2XYT medium, mecA cells exhibit low levels of
hag-lacZ activity. This repression of hag is only
partially reversed by the comK mutation. The repression of
hag expression caused by a mecA null mutation is,
in part, comK dependent, but MecA plays some other role in
the positive control of hag.
As further evidence for MecA-ComK-dependent control of hag
expression and the involvement of the so-called early com
regulators, the expression of hag-lacZ in an srf
deletion mutant lacking the comS gene was examined (Fig.
2C). Significantly higher levels of hag-lacZ expression were
observed in comS mutant cells grown in CM than in wild-type
cells, in accordance with the observed comK-dependent
control of hag. If ComS served to release ComK from
MecA-ClpC-dependent inhibition, then it, too, would be expected to
exert a negative influence on hag expression.
mecA and comK mutations have little effect
on
D levels in rich medium, but mecA mutant
cells grown in CM contain a reduced concentration of
D.
How do MecA and ComK exert their effects on the
regulation of hag? As had been shown previously,
expression of the class III flagellar regulon genes, such as
hag, requires the
D form of RNA polymerase
(31, 33). It was conceivable, therefore, that competence
regulatory factors regulate the expression of the sigD
gene. Cells of the wild-type and comK, mecA,
and comK mecA mutant strains bearing a translational
hag-lacZ fusion (5) were grown in 2XYT medium
and, in a separate experiment, CM. Samples were collected at
T0 and T2 (0 and 2 h
after the end of the exponential growth phase, respectively) for the
measurement of
D protein levels by immunoblot
analysis, while hag expression was quantified by measuring
hag-directed
-galactosidase activity. There was
little significant change in the level of protein
observed in the four 2XYT cultures, as shown by a computer-aided scan
of the developed immunoblot (Fig. 3A and
B). This is in contrast to the level of
hag-lacZ expression observed in the cell culture samples. In
the mecA and comK mutant cells, there was a
significant difference in the level of hag-lacZ expression
(Fig. 3C) but virtually identical concentrations of
D protein. This suggested that ComK might affect the
activity of
D rather than the
D
concentration.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
Level of D protein in the wild type (wt)
and mecA, comK, and mecA comK mutants
grown in rich medium. Cells precultured in 2XYT liquid medium were
grown in 2XYT medium at 37°C. Samples were harvested at
T0 and T2 (at the end of
exponential growth and 2 h after the end of exponential growth,
respectively). Cell extracts with equal protein concentrations were
applied to SDS-12% polyacrylamide gels and subjected to
electrophoresis. The resolved protein was electrotransferred to
nitrocellulose and analyzed by the Western blotting procedures
described in Materials and Methods. (A). Lane MW contained molecular
size markers. The other lanes contained samples from cultures of
LAB2607 (wild type), LAB2722 (mecA), LAB2723
(comK), and LAB2724 (mecA comK) cells collected
at T0 and T2 of the
growth curve. (B) Western blot band intensity determined by scanning of
the image of the stained blot and quantification by the NIH-Image
computer program. The values presented are percentages of the level of
protein in the wild-type strain at T2. The
standard deviation was calculated from three independent experiments.
(C) Levels of hag-directed -galactosidase in cultures
used to obtain extracts for Western blot analysis.
|
|
In CM, the mecA mutation modestly influenced the level of
D protein. While wild-type and comK mutant
cells contain similar concentrations of
D protein,
mecA and mecA comK mutant cells show reduced
levels of
D (Fig. 4). The
ComK-independent positive control of hag expression exerted
by MecA could be directed, at least in part, at the concentration of
D protein.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 4.
Levels of D protein in the wild type (WT)
and mecA, comK, and mecA comK mutants
grown in CM. Cells precultured in DSM agar plates were grown in CM at
37°C. Samples were harvested at the same time points as in Fig. 3.
Analysis of the protein extracts was conducted as described in the
legend to Fig. 3. (A) Western blot of extracts of LAB2607 (wild type
[WT]), LAB2722 (mecA), LAB2723 (comK), and
LAB2724 (mecA comK) cell samples collected at
T0 and T2 of the growth
curve. (B) Western blot band intensity determined and presented as
described in the legend to Fig. 3.
|
|
A comF-flgM insertion mutation results in heightened
expression of hag-lacZ.
Because a mutation in
comK appeared to affect the activity of
D, it
was possible that the
D-specific antisigma factor FlgM
was involved. It was noticed that the flgM operon,
consisting of four genes in the order orf139 flgM orf160
fliK (31, 34), resides immediately downstream of
comF, a late competence operon, transcription of
which requires ComK (30, 46). We reasoned that
comF and flgM could lie in the same transcription
unit and that ComK functions in the negative control of hag
by stimulating the transcription of flgM, thereby increasing
the level of the
D-specific antisigma factor. To test
this hypothesis, a plasmid insertion mutation was constructed to
separate upstream ComK-dependent transcription from
D-dependent flgM operon
transcription. If comK functioned in the negative control of
hag by activating comF-flgM transcription, then
the disruption of ComK-dependent transcription of flgM by the plasmid insertion would confer the same phenotype, with respect to
hag expression, as a comK mutation. An
868-bp fragment encompassing the 3' end of comFC, the
PD-1 promoter, and the 5' end of orf139 (Fig. 4)
was generated by PCR. The PD-1 promoter is utilized by the
D form of RNA polymerase and is located between the
putative transcriptional terminator of the comF
operon and the start codon of orf139. The fragment
was inserted into integration vector pMMN13. The resulting plasmid,
pJL010, was used to transform cells of strain JH642. The transformant
obtained had undergone a Campbell-type recombination event,
yielding a strain bearing an integrated plasmid at the comF-flgM junction (Fig. 5).
This strain was lysogenized with SP
Phag-lacZ to yield
strain LAB2932. The Phag-lacZ fusion is a transcriptional
fusion between a promoterless lacZ gene and a derivative of
the hag promoter that lacks the upstream UP element; hence,
the levels of hag-directed
-galactosidase activity
are lower in strains bearing this fusion than in those carrying the translational fusion. The patterns of hag-lacZ
expression in the comK and comF-flgM insertion
mutants are nearly identical, with higher levels of expression in the
stationary phase in CM than that observed in wild-type cells (Fig.
6).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Structure of the comF-flgM operon and
construction of a comF-flgM::pJL010 insertion mutant.
(A) flgM is located within an operon containing the
promoter PD-1, immediately downstream of the
comF operon. comF is a B. subtilis late competence operon. Transcription of
comF is driven by a single A-type promoter,
utilization of which is dependent on ComK. The flgM
operon contains orf139, flgM,
orf160, and flgK. (B) The mutant was constructed
by insertion of a plasmid (pJL010) carrying comFC and
orf139 fragments by a single-recombination mechanism into
the region containing the junction between the comF and
flgM operons.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Expression of hag-lacZ in wild-type and
comK and comF-flgM::pJL010 mutant cells grown
in CM. Cells were precultured on DSM agar plates and then grown in CM
liquid at 37°C. hag-directed -galactosidase ( -gal)
specific activity of samples collected at the indicated time points was
determined as described in Materials and Methods and in the legend to
Fig. 3. Symbols: , LAB2819 (SP hag-lacZ); , LAB2921
(SP hag-lacZ comK); , LAB3932 (SP hag-lacZ
comF-flgM::pJL010).
|
|
Table 2 summarizes the effects of
flgM
80 in wild-type and comK and
mecA mutant genetic background cells grown in CM.
flgM
80 in combination with a comK mutation
does not result in hag-lacZ expression higher than that
observed in the flgM mutant. As with the comK
mutation, the flgM deletion did not show complete
suppression of mecA. The flgM
80 comK mecA
triple mutant showed a level of hag-lacZ expression
similar to that of a flgM
80 mecA mutant. That the
suppression of mecA by flgM and comK
mutations is not significantly higher than that of each mutation alone
suggests that comK and flgM operate within a
common genetic pathway, consistent with the hypothesis that
comK regulates flgM expression. The incomplete suppression of mecA caused by a flgM mutation
indicates that the comK-independent function of
mecA in regulating hag expression does not
involve FlgM.
Expression of the flgM operon is dependent on
both sigD and comK.
The phenotype of the
comF-flgM insertion mutation suggested that the
transcription of the flgM operon was controlled by
comK. To test this prediction, a flgM
operon-lacZ transcriptional fusion was constructed
by inserting the same comFC-orf139 PCR fragment used to make
the insertion mutation upstream of a promoterless lacZ gene.
The construction was introduced into JH642 competent cells, in which
the plasmid would insert by a single recombination event into the
putative comF-flgM operon. Mutant derivatives of the
fusion-bearing strains were constructed by transformation with
sigD and comK mutant DNA, thereby creating
sigD, comK, and sigD comK mutants all
carrying the flgM operon-lacZ fusion.
Optimal expression of the lacZ fusion was dependent on both
the comK and sigD genes (Fig.
7), with the double mutant comK sigD cells exhibiting nearly undetectable levels of
lacZ expression, supporting the hypothesis that
flgM operon transcription is positively controlled
by ComK.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 7.
flgM operon (orf139)-lacZ
fusion expression in comK and sigD mutant cells.
Cells of the wild-type and the comK, sigD, and
comK sigD mutant strains bearing plasmid pJL011
[flgM (orf139)-lacZ] integrated at
the flgM locus were grown in CM. Samples were collected at
30-min intervals for assay of -galactosidase activity. Symbols: ,
LAB2995 [flgM (orf139)-lacZ]; ,
LAB2997 [sigD flgM (orf139)-lacZ];
, LAB2996 [comK flgM
(orf139)-lacZ]; , LAB2998 [sigD comK
flgM (orf139)-lacZ].
|
|
RT-PCR was employed to determine if ComK-dependent
readthrough transcription from comF into the
flgM operon could be detected. RNA was purified from
both wild-type (JH642) and comK mutant (LAB2917) cells at 30 min after the end of exponential growth. Two different RT-PCRs
were assembled. Both utilized an oligonucleotide corresponding to a
sequence within the orf139 open reading frame to prime
reverse transcriptase-catalyzed cDNA synthesis from flgM
operon RNA. In one reaction, amplification was carried out by
using a primer hybridizing to comFC sequences within the
cDNA to obtain an RT-PCR product of 885 bp derived from the
comF-flgM readthrough transcript. The other
reaction utilized a primer hybridizing to the region of the
cDNA corresponding to the amino-terminal coding end of orf139, the first gene of the flgM
operon. Amplification of the cDNA yields an RT-PCR product of
270 bp derived from both the readthrough transcript and the RNA
synthesized from the PD-1 promoter. Control reaction
mixtures containing RNA, primer, and DNA polymerase were included to
determine if contaminating DNA remained in the RNA after DNase
treatment.
As shown in Fig. 8, an RT-PCR
product corresponding to a readthrough comF-flgM
operon transcript could be detected in wild-type cells
(lane 9) but not in the comK mutant cells (lane 5), whereas the 270-bp product is observed in reaction mixtures containing either comK mutant or wild-type cellular RNA (lanes 6 and
10). The results described above confirm that comF-flgM
transcription is comK dependent. More of the RT-PCR product
was detected in the reaction mixture producing the 270-bp fragment than
in that producing the 885-bp product derived from the
comK-dependent transcript. This might be due to the
possibility that the RNA was harvested before the time in the growth
curve when the ComK concentration and, hence, ComK-dependent
transcription, was at a maximum.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
RT-PCR products from comF-flgM and
flgM operon transcripts. At the top is a diagram of
the comFC-orf139 region of the comF-flgM
operon. PD1 indicates the location of the
flgM promoter utilized by the D form of RNA
polymerase. The arrows indicate the oligonucleotide primers (numbered 1 through 3) used to prime RT and to amplify cDNA and PCR products. The
bottom panel is a photograph of an ethidium bromide-stained 1% agarose
gel on which the PCR and RT-PCR products were resolved. In lanes 1 and
2, the template for PCR was JH642 chromosomal DNA. In lanes 3 to 6, the
template for PCR and RT-PCR was RNA from strain LAB2917
(comK::neo). In lanes 7 to 10, the template
for PCR and RT-PCR was from JH642 (wild-type) cells. MW, molecular
weight markers. Lanes: 1, PCR product of primers 1 and 2 (no reverse
transcriptase); 2, PCR product of primers 1 and 3; 3, PCR using primers
1 and 2; 4, PCR using primers 1 and 3; 5, RT-PCR using primers 1 and 2;
6, RT-PCR using primers 1 and 3; 7, PCR using primers 1 and 2;
8, PCR using primers 1 and 3; 9, RT-PCR using primers 1 and 2; 10, PCR
using primers 1 and 3.
|
|
 |
DISCUSSION |
The mecA gene product is required for the optimum
expression of genes that constitute the
D regulon. It
participates in both comK-dependent and
comK-independent mechanisms of regulation. The expression of
hag is reduced in mecA mutants grown in both 2XYT
and CM. A mutation in comK has no effect on the level of
hag expression in 2XYT, a rich medium that does not promote
competence, but when a comK mutation is introduced into a
mecA mutant, nearly complete suppression of the
mecA mutation is observed. This indicates that in medium
that does not promote competence, the major function of MecA in
stimulating hag expression is to inhibit ComK. In CM,
comK mutant cells exhibit heightened hag
expression which is above that observed in wild-type cells. In this
medium, as opposed to 2XYT, active ComK is produced and wild-type
cells show a level of hag expression lower than that
observed in 2XYT-grown cells, in which ComK is absent. A mutation in mecA causes a dramatic reduction of
hag expression in CM, and it is incompletely suppressed by a
comK mutation. In CM, MecA functions to inhibit ComK but
also stimulates hag expression through a ComK-independent
mechanism. The comS mutation has nearly the same effect a
comK mutation has in CM; both cause higher-level expression
of hag, supporting the conclusion that MecA stimulates hag expression, in part, by negatively controlling ComK.
The examination of
D protein levels revealed no change
in sigD expression in the comK mecA mutant and
wild-type cells grown in 2XYT. In CM, little, if any, difference in the
D protein level was observed between wild-type
and comK mutant cells. This suggested that
D
activity was altered in the comK mutant. A likely target for MecA-ComK-dependent control was FlgM, the
D-specific
antisigma factor. It was noticed that the flgM
operon was located downstream from the comF
operon, the transcription of which had been shown to
require ComK (46). Optimal flgM transcription might require readthrough from the comF
operon, although a sequence resembling a factor-independent
terminator was identified at the end of comFC
(34). This hypothesis was tested by creating an insertion mutation that separated comF from the
flgM operon by introducing a plasmid bearing the
comFC-orf139 intergenic region by homologous
recombination. The insertion mutation produced the same phenotype with
respect to hag-lacZ expression as the comK mutation. These results strongly suggest that flgM
transcription is dependent, in part, on ComK and that this is the basis
of ComK-dependent negative control of hag and other genes of
the
D regulon that had been shown to require MecA for
their expression. This hypothesis was further supported by data showing
that flgM operon expression was positively
controlled by comK and by RT-PCR data indicating the
presence of a comF-flgM operon transcript. This
mechanism of control operates in cells grown in CM and 2XYT, but
Western blot analysis of
D protein levels in cells grown
in CM showed that MecA also affects sigD expression, by
affecting either the transcription or translation of sigD or
the stability of the
D protein.
Rashid et al. reported that the MecA-ClpC-dependent control of
hag was independent of comK (43) when
cells were grown in a rich medium that does not promote competence.
However, our results not only implicate comK in the negative
control of hag but also provide a reasonable explanation for
the role of comK, i.e., to activate transcription of the
flgM operon. Ogura and Tanaka showed that MecA
stimulated
D-transcribed gene degR by
inhibiting ComK (40), but their experiments did not examine
the effect of mecA and comK mutations in cells grown in medium that promoted competence, a condition in which MecA
exerts positive control of hag independently of comK.
The ComS-MecA-ComK system can be viewed as a molecular switch that is
thrown in the direction favoring competence at high cell density, when
the ComS peptide is present in abundance (Fig. 1). At a low cell
density, when the ComS concentration is low, the switch is thrown in
the other direction, that favoring motility, chemotaxis, and production
of autolysins, all processes requiring the
D form of RNA
polymerase. The activation of late competence operons when
motility genes are down regulated is reminiscent of the opposing controls associated with toxin-coregulated pilus (TCP) production and
motility in the intestinal pathogen Vibrio cholerae
(16). The expression of motility genes is repressed when
tcp is expressed, a situation reflecting the
motility-dependent penetration of the intestinal mucous layer followed
by the TCP-dependent attachment of vibrios to the cells lining the
intestine. Both the TCP protein and the B. subtilis late Com
products encoded by the comG operon are of the type
IV pilus family (10, 22). It is possible that the
transcriptional control mechanisms activating tcp expression directly or indirectly down regulate motility gene expression, perhaps
through a mechanism involving flgM and a
D
homolog. Why might there be mechanisms of control that favor type IV
pilus production while suppressing the expression of motility functions? One possibility is that the two structures, the type IV
pilus and the flagellum, are not compatible within the
bacterial cell wall. Another explanation is based on the
conditions under which the two structures are utilized. The function of
the pilus, whether used in genetic exchange or in cell-cell contact, is
associated with conditions of high local cell density that are
conducive to cell-cell interaction, whether for genetic exchange or for coordination of the activity of a concentrated population of bacteria. Motility might be expected to be characteristic of bacteria
encountering stress in a low cell density environment since individual
bacteria are less likely to impact their immediate environment for the purpose of responding appropriately to stressful conditions and to
utilize their mechanism of genetic exchange. Hence, their ability to
relocate to a less stressful environment or one inhabited by a large
population of their own species would necessitate flagellum formation.
This work was supported by grant GM45898 from the National Institutes
of Health.
| 1.
|
Arnosti, D. N., and M. J. Chamberlin.
1989.
Secondary sigma factor controls transcription of flagellar and chemotaxis genes in Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:830-834[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. O. Moore,
J. A. Smith,
J. G. Seidman, and K. Struhl.
1998.
PCR amplification of RNA under optimal conditions, p. 15.4.1-15.4.2.
In
F. M. Ausubel, et al. (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 3.
|
Bai, U.,
I. Mandic-Mulec, and I. Smith.
1993.
SinI modulates the activity of SinR, a developmental switch protein of Bacillus subtilis, by protein-protein interaction.
Genes Dev.
7:139-148[Abstract/Free Full Text].
|
| 4.
|
Caramori, T.,
D. Barilla,
C. Nessi,
L. Sacchi, and A. Galizzi.
1996.
Role of FlgM in D-dependent gene expression in Bacillus subtilis.
J. Bacteriol.
178:3113-3118[Abstract/Free Full Text].
|
| 5.
|
Chen, L., and J. D. Helmann.
1994.
The Bacillus subtilis D-dependent operon encoding the flagellar proteins FliD, FliS, and FliT.
J. Bacteriol.
176:3093-3101[Abstract/Free Full Text].
|
| 6.
|
Chung, Y. S., and D. Dubnau.
1998.
All seven comG open reading frames are required for DNA binding during transformation of competent Bacillus subtilis.
J. Bacteriol.
180:41-45[Abstract/Free Full Text].
|
| 7.
|
Chung, Y. S., and D. Dubnau.
1995.
ComC is required for the processing and translocation of ComGC, a pilin-like competence protein of Bacillus subtilis.
Mol. Microbiol.
15:543-551[Medline].
|
| 8.
|
Cosmina, P.,
F. Rodriguez,
F. de Ferra,
G. Grandi,
M. Perego,
G. Venema, and D. van Sinderen.
1993.
Sequence and analysis of the genetic locus responsible for surfactin synthesis in Bacillus subtilis.
Mol. Microbiol.
8:821-831[Medline].
|
| 9.
|
D'Souza, C.,
M. M. Nakano, and P. Zuber.
1994.
Identification of comS, a gene of the srfA operon that regulates the establishment of genetic competence in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
91:9397-9401[Abstract/Free Full Text].
|
| 10.
|
Dubnau, D.
1997.
Binding and transport of transforming DNA by Bacillus subtilis: the role of type-IV pilin-like proteins a review.
Gene
192:191-198[Medline].
|
| 11.
|
Dubnau, D.
1993.
Genetic exchange and homologous recombination, p. 555-584.
In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.
|
| 12.
|
Dubnau, D., and R. Davidoff-Abelson.
1971.
Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor-recipient complex.
J. Mol. Biol.
56:209-221[Medline].
|
| 13.
|
Dubnau, D.,
J. Hahn,
M. Roggiani,
R. Piazza, and Y. Weinrauch.
1994.
Two-component regulators and genetic competence in Bacillus subtilis.
Res. Microbiol.
145:403-411[Medline].
|
| 14.
|
Fredrick, K., and J. D. Helmann.
1996.
FlgM is a primary regulator of D activity, and its absence restores motility to a sinR mutant.
J. Bacteriol.
178:7010-7013[Abstract/Free Full Text].
|
| 15.
|
Galli, G.,
F. Rodriguez,
P. Cosmina,
C. Pratesi,
R. Nogarotto,
F. de Ferra, and G. Grandi.
1994.
Characterization of the surfactin synthetase multienzyme complex.
Biochim. Biophys. Acta
1205:19-28[Medline].
|
| 16.
|
Gardel, C. L., and J. J. Mekalanos.
1996.
Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression.
Infect. Immun.
64:2246-2255[Abstract].
|
| 17.
|
Gaur, N. K.,
J. Oppenheim, and I. Smith.
1991.
The Bacillus subtilis sin gene, a regulator of alternate developmental processes, codes for a DNA-binding protein.
J. Bacteriol.
173:678-686[Abstract/Free Full Text].
|
| 18.
|
Grossman, A. D.
1995.
Genetic networks controlling the initiation of sporulation and the development of genetic competence in Bacillus subtilis.
Annu. Rev. Genet.
29:477-508[Medline].
|
| 19.
|
Hahn, J.,
A. Luttinger, and D. Dubnau.
1996.
Regulatory inputs for the synthesis of ComK, the competence transcription factor of Bacillus subtilis.
Mol. Microbiol.
21:763-775[Medline].
|
| 20.
|
Haldenwang, W. G.
1995.
The sigma factors of Bacillus subtilis.
Microbiol. Rev.
59:1-30[Abstract/Free Full Text].
|
| 21.
|
Hamoen, L. W.,
H. Eshuis,
J. Jongbloed, and G. Venema.
1995.
A small gene, designated comS, located within the coding region of the fourth amino acid-activating domain of srfA, is required for competence development in Bacillus subtilis.
Mol. Microbiol.
15:55-63[Medline].
|
| 22.
|
Kaufman, M. R.,
C. E. Shaw,
I. D. Jones, and R. K. Taylor.
1993.
Biogenesis and regulation of the Vibrio cholerae toxin-coregulated pilus: analogies to other virulence factor systems.
Gene
126:43-49[Medline].
|
| 23.
|
Kenney, T. J., and C. P. Moran, Jr.
1991.
Genetic evidence for interaction of A with two promoters in Bacillus subtilis.
J. Bacteriol.
173:3282-3290[Abstract/Free Full Text].
|
| 24.
|
Kong, L., and D. Dubnau.
1994.
Regulation of competence-specific gene expression by Mec-mediated protein-protein interaction in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
91:5793-5797[Abstract/Free Full Text].
|
| 25.
|
Kong, L.,
K. J. Siranosian,
A. D. Grossman, and D. Dubnau.
1993.
Sequence and properties of mecA: a negative regulator of genetic competence in Bacillus subtilis.
Mol. Microbiol.
9:365-373[Medline].
|
| 26.
|
Kunst, F.,
T. Msadek, and G. Rapoport.
1994.
Signal transduction network controlling degradative enzyme synthesis and competence in Bacillus subtilis, p. 1-20.
In
P. J. Piggot, C. P. Moran, Jr., and P. Youngman (ed.), Regulation of bacterial differentiation. American Society for Microbiology, Washington, D.C.
|
| 27.
|
Kuroda, A., and J. Sekiguchi.
1993.
High-level transcription of the major Bacillus subtilis autolysin operon depends on expression of the sigma D gene and is affected by a sin (flaD) mutation.
J. Bacteriol.
175:795-801[Abstract/Free Full Text].
|
| 28.
|
Lazazzera, B. A., and A. D. Grossman.
1997.
A regulatory switch involving a Clp ATPase.
Bioessays
19:455-458[Medline].
|
| 29.
|
Liu, L.,
M. M. Nakano,
O. H. Lee, and P. Zuber.
1996.
Plasmid-amplified comS enhances genetic competence and suppresses sinR in Bacillus subtilis.
J. Bacteriol.
178:5144-5152[Abstract/Free Full Text].
|
| 30.
|
Londono-Vallejo, J. A., and D. Dubnau.
1993.
comF, a Bacillus subtilis late competence locus, encodes a protein similar to ATP-dependent RNA/DNA helicases.
Mol. Microbiol.
9:119-131[Medline].
|
| 31.
|
Márquez, L. M.,
J. D. Helmann,
E. Ferrari,
H. M. Parker,
G. W. Ordal, and M. J. Chamberlin.
1990.
Studies of D-dependent functions in Bacillus subtilis.
J. Bacteriol.
172:3435-3443[Abstract/Free Full Text].
|
| 32.
|
Menkhaus, M.,
C. Ullrich,
B. Kluge,
J. Vater,
D. Vollenbroich, and R. M. Kamp.
1993.
Structural and functional organization of the surfactin synthetase multienzyme system.
J. Biol. Chem.
268:7678-7684[Abstract/Free Full Text].
|
| 33.
|
Mirel, D. B., and M. J. Chamberlin.
1989.
The Bacillus subtilis flagellin gene (hag) is transcribed by the 28 form of RNA polymerase.
J. Bacteriol.
171:3095-3101[Abstract/Free Full Text].
|
| 34.
|
Mirel, D. B.,
P. Lauer, and M. J. Chamberlin.
1994.
Identification of flagellar synthesis regulatory and structural genes in a D-dependent operon of Bacillus subtilis.
J. Bacteriol.
176:4492-4500[Abstract/Free Full Text].
|
| 35.
|
Mohan, S., and D. Dubnau.
1990.
Transcriptional regulation of comC: evidence for a competence-specific transcription factor in Bacillus subtilis.
J. Bacteriol.
172:4064-4071[Abstract/Free Full Text].
|
| 36.
|
Nakano, M. M.,
R. Magnuson,
A. Myers,
J. Curry,
A. D. Grossman, and P. Zuber.
1991.
srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis.
J. Bacteriol.
173:1770-1778[Abstract/Free Full Text].
|
| 37.
|
Nakano, M. M.,
M. A. Marahiel, and P. Zuber.
1988.
Identification of a genetic locus required for biosynthesis of the lipopeptide antibiotic surfactin in Bacillus subtilis.
J. Bacteriol.
170:5662-5668[Abstract/Free Full Text].
|
| 38.
|
Nakano, M. M., and P. Zuber.
1991.
The primary role of comA in the establishment of the competent state in Bacillus subtilis is to activate the expression of srfA.
J. Bacteriol.
173:7269-7274[Abstract/Free Full Text].
|
| 39.
|
Nakano, M. M.,
L. Xia, and P. Zuber.
1991.
The transcription initiation region of the srfA operon which is controlled by the comP-comA signal transduction system in Bacillus subtilis.
J. Bacteriol.
173:5487-5493[Abstract/Free Full Text].
|
| 40.
|
Ogura, M., and T. Tanaka.
1997.
Bacillus subtilis ComK negatively regulates degR gene expression.
Mol. Gen. Genet.
254:157-165[Medline].
|
| 41.
|
Ordal, G. W.,
L. Marquez-Magana, and M. J. Chamberlin.
1993.
Motility and chemotaxis, p. 765-784.
In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.
|
| 42.
|
Rashid, M. H., and J. Sekiguchi.
1996.
flaD (sinR) mutations affect SigD-dependent functions at multiple points in Bacillus subtilis.
J. Bacteriol.
178:6640-6643[Abstract/Free Full Text].
|
| 43.
|
Rashid, M. H.,
A. Tamakoshi, and J. Sekiguchi.
1996.
Effects of mecA and mecB (clpC) mutations on expression of sigD, which encodes an alternative sigma factor, and autolysin operons and on flagellin synthesis in Bacillus subtilis.
J. Bacteriol.
178:4861-4869[Abstract/Free Full Text].
|
| 44.
|
Turgay, K.,
L. W. Hamoen,
G. Venema, and D. Dubnau.
1997.
Biochemical characterization of a molecular switch involving the heat shock protein ClpC, which controls the activity of ComK, the competence transcription factor of Bacillus subtilis.
Genes Dev.
11:119-128[Abstract/Free Full Text].
|
| 45.
|
van Sinderen, D.,
G. Galli,
P. Cosmina,
F. de Ferra,
S. Withoff,
G. Venema, and G. Grandi.
1993.
Characterization of the srfA locus of Bacillus subtilis: only the valine-activating domain of srfA is involved in the establishment of genetic competence.
Mol. Microbiol.
8:833-841[Medline].
|
| 46.
|
van Sinderen, D.,
A. Luttinger,
L. Kong,
D. Dubnau,
G. Venema, and L. Hamoen.
1995.
comK encodes the competence transcription factor, the key regulatory protein for competence development in Bacillus subtilis.
Mol. Microbiol.
15:455-462[Medline].
|
| 47.
|
Vollenbroich, D.,
N. Mehta,
P. Zuber,
J. Vater, and R. M. Kamp.
1994.
Analysis of surfactin synthetase subunits in srfA mutants of Bacillus subtilis OKB105.
J. Bacteriol.
176:395-400[Abstract/Free Full Text].
|
| 48.
|
Zuber, P., and R. Losick.
1987.
Role of AbrB in the Spo0A- and Spo0B-dependent utilization of a sporulation promoter in Bacillus subtilis.
J. Bacteriol.
169:2223-2230[Abstract/Free Full Text].
|
| 49.
|
Zuber, P., and R. Losick.
1983.
Use of a lacZ fusion to study the role of the spo0 genes of Bacillus subtilis in developmental regulation.
Cell
35:275-283[Medline].
|