Previous Article | Next Article ![]()
Journal of Bacteriology, September 1998, p. 4508-4515, Vol. 180, No. 17
School of Pharmacy1
and
Department of Biomolecular
Chemistry,2 University of Wisconsin,
Madison, Wisconsin
Received 18 May 1998/Accepted 25 June 1998
In Saccharomyces cerevisiae, the transition from the
G1 phase of the mitotic cycle into S phase is controlled by
a set of G1 cyclins that regulate the activity of the
protein kinase encoded by CDC28. Yeast cells regulate
progress through the G1/S boundary in response to
nutrients, moving quickly through G1 in glucose medium and
more slowly in poorer medium. We have examined connections between
glucose and the level of the message encoding Cln3, a G1
cyclin. We found that glucose positively regulates CLN3
mRNA levels through a set of repeated AAGAAAAA
(A2GA5) elements within the
CLN3 promoter. Mutations in these sequences reduce both
transcriptional activation and specific interaction between
CLN3 promoter elements and proteins in yeast extracts.
Creation of five point mutations, replacing the G's within these
repeats with T's, in the CLN3 promoter substantially reduces CLN3 expression in glucose medium and
inhibits the ability of the cells to maintain a constant size when
shifted into glucose.
Saccharomyces cerevisiae
cells coordinate growth and proliferation so that cells growing
under a variety of conditions are able to maintain an almost constant
average size. Cell growth and division are thus in some way tethered.
Were it not so, an increase in growth rate in the absence of a
corresponding increase in the rate of cell division would generate
larger cells. Conversely, a decrease in growth rate in the absence of
a corresponding lengthening of the cell cycle would produce very
small cells. Yeast cells adjust the length of the cell cycle in
different media by varying the length of the G1 phase
(11, 12). In rich media containing glucose, yeast cells grow
rapidly and have a short G1 phase, whereas in a poor carbon
source such as ethanol, yeast cells prolong the cell cycle by spending
more time in G1. As nutrients are depleted, G1
lengthens until the cells eventually arrest in G1
(25). While cell size clearly plays a role in governing the
length of G1, the effects of nutrients on cell cycle length
cannot be explained solely by a model in which nutrients affect the
time required to reach a threshold size for budding. This can be
inferred from the fact that G1 length is strongly
influenced by nutrients in mother cells, which have already reached
critical size (10b, 15, 16).
Progress through G1 requires the association of the Cdc28
kinase with one of three G1 cyclins, Cln1, Cln2, or Cln3.
Mutation in all three G1 cyclins or inactivation of Cdc28
leads to cell cycle arrest in late G1 (9).
Recent observations suggest that Cln3 is an upstream regulator of other
G1 cyclins (5, 23, 24). It has been shown that
transcriptional manipulation of CLN3 alters the duration of
G1: overexpression of CLN3 shortens G1, while deletion of CLN3 leads to a delay in
G1 (2, 18). Recently, work in several
laboratories has demonstrated nutrient regulation of Cln3/Cdc28 kinase
activity. Nutrients regulate Cln3 protein levels through effects on
transcription, translation, and protein stability (8, 10, 19,
20). CLN3 mRNA levels are high in log-phase cells
rapidly growing on glucose and decline as cells enter
oxidative growth in ethanol. Carbon source regulation of
CLN3 transcription involves a mechanism that is independent of growth and does not require the Ras-cyclic AMP pathway
(19). Changes in CLN3 mRNA seen in response to
different carbon sources are reflected in Cln3 protein levels and
Cln3/Cdc28 kinase activity (10).
Addition of glucose to post-log-phase cells can produce a 5- to 10-fold
increase in CLN3 mRNA levels within 5 min, indicating that
the cells are in some way responding to a glucose signal. Several
transcriptional responses to glucose have been studied, including the
induction of glycolytic enzymes, repression of genes necessary for
growth in nonfermentable carbon sources, and repression of genes
involved in respiration (13). Thinking that regulation of
CLN3 by glucose might involve a known glucose signalling
pathway, we have tested several mutations in glucose repression and
induction pathways for alterations in the regulation of
CLN3. These experiments have produced negative results:
CLN3 induction is normal in these mutants. This indicates
that the mechanism of glucose regulation of CLN3 is probably
distinct from previously characterized processes. In addition, although
the Mcm1 protein is thought to play a role in cell cycle-specific
variations in CLN3 transcript levels (17), we
have found that temperature-sensitive mcm1 mutants have
normal glucose induction of CLN3 at the restrictive
temperature (10a). This, taken together with the finding
that induction of CLN3 by glucose is cell cycle independent
(19), indicates that glucose induction of CLN3 is
also distinct from the cell cycle-dependent transcriptional regulation
reported by McInerny et al. (17).
We have therefore examined the CLN3 promoter in order to
identify regions that regulate transcription in response to glucose. Here we report the presence of repeated sequences within the
CLN3 promoter that are important for transcriptional
induction by glucose. Mutations in these sequences reduce both
transcriptional activation and specific interactions between
CLN3 promoter elements and proteins in yeast extracts.
Southwestern blots identify a 69-kDA protein that specifically binds to
these repeated sequences.
Strains and media.
The yeast strains used in this work were
DS10 (MATahis3-11,15 leu2-3,112 lys1 lys2 ura3-52
trp1 RNA preparation and Northern blotting.
Total yeast RNA was
isolated as described previously (6). The RNA samples were
separated by formaldehyde gel electrophoresis and transferred to a
GeneScreen Plus membrane (New England Nuclear). To ensure uniform
loading and transfer of RNA, ethidium bromide was added to the samples,
and the ethidium-stained rRNA was visualized on the blots under UV
illumination. Blots were also probed with a radiolabeled 0.6-kb
SacI fragment from U2 to confirm uniform loading.
Northern blots were probed with a 1.1-kb EcoRI fragment from
URA3 or a 1.8-kb BamHI fragment from
CLN3. All probes were radiolabeled to a specific activity of
109 cpm/µg by using [ CLN3 promoter-reporter fusion constructs.
A
series of CLN3 promoter fragments were generated by PCR and
restriction digests and then inserted into the multiple cloning site of
yeast 2µ plasmid pCA205 (a gift from Cathy Atchinson) upstream of
URA3, which served as a reporter gene. The URA3
coding region in pCA205 is preceded by only 24 bp of the untranslated URA3 sequence containing one transcriptional start site and
no known upstream activating sequences.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Transcriptional Regulation of CLN3
Expression by Glucose in Saccharomyces
cerevisiae
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
) and TG3 (isogenic to DS10 except for a CLN3
deletion [3]). These strains were transformed with
various plasmids as indicated. Cells were grown either in YEPD
containing 1% yeast extract, 2% Bacto Peptone, and 2% glucose or in
synthetic complete medium containing 6.7-g/liter yeast nitrogen base
(Difco) supplemented with adenine, uracil, amino acids, and 2% glucose
(21). Cell size measurements were performed with a Coulter
Counter Channelizer using a 70-µm aperture calibrated with latex
beads.
-32p]dCTP (3,000 µCi/nmol) and random priming.
726 to +18 fragment was amplified by PCR using a primer
(5'-TGCGACCGTGATGATACCGA-3') upstream of the SacI
site at
726 as an upstream primer and a primer
(5'-TAATTATGGGATCCTTCAATATGGCC-3') into which a
BamHI site (underlined) was introduced as the downstream primer. The product was then cut with BamHI and
SacI and inserted into the SacI/BamHI
sites of pCA205. A similar strategy was used to subclone the
549 to
+18 fragment into pCA205 by using the same downstream primer and an
upstream primer (5'-CTCACTGTAATGATCAAGTTAC-3') into which a
BclI site was introduced. After digestion with
BclI and BamHI, the PCR product was inserted into
the BamHI site of pCA205. The
726 to
143 fragment was
generated by using the primer described above upstream of the
SacI site and a downstream primer (5'-ATTGGAGATCTGAGATTGCG-3') with an introduced
BglII site. After digestion with SacI and
BglII, the PCR product was inserted into the
SacI/BamHI site of pCA205. The
726 to
250
fragment was amplified by using an upstream primer
(5'-GAGACACCTGCAGAGGCTACATTA-3') and a primer
(5'-GGTTTAAGTCTGCAGAGGAGACTAC-3') containing an artificial PstI site downstream. The PCR product was digested with
SalI (native site at
931) and PstI was then
inserted into pBSK+. Digestion with SacI (
726)
and PstI released the fragment from the plasmid for
subcloning into SacI- and PstI-digested pCA205. The plasmid containing the
726 to
414 fragment was produced by
deletion of the XhoI/BamHI segment from the
726
to +18 plasmid. After digestion, the ends were filled in with Klenow
and ligated. The plasmid carrying the
549 to
414 segment was
generated by digesting the
549 to +18 pCA205 plasmid with
XhoI and BamHI. Again, the ends were ligated
after Klenow filling. The
726 to
549 plasmid was made by using a
primer (5'-GAGACACCTGCAGAGGCTACATTA-3') upstream of the
naturally occurring SacI (
726) site and a downstream primer (5'-GTA ACT TGA TCA TTA CAG TGA G-3') flanking the naturally occurring BclI site. The fragment was cut with
SacI and BclI and inserted into the
SacI/BamHI site of pCA205. The plasmid containing the
626 to
570 promoter fragment was generated by annealing two
synthetic oligonucleotides
(5'-AATTCAAGAAAAAAAAAAAAGAAAAAGTGAAAAATTATCAGGCAAGAAAAAGAAATTAC-3' and
5'- GATCGTAATTTCTTTTTCTTGCCTGATAATTTTTCACTTTTTCTTTTTT TTTTTCTT-3')
such that the resulting four-base overhangs on the ends were compatible
with EcoRI and BamHI overhangs. This double-stranded oligonucleotide was then cloned into the
EcoRI/BamHI site of pCA205. The corresponding
plasmid with the
626 to
570 fragment carrying mutations in the
A2GA5 repeats was made in the same manner, by
using the following oligonucleotides (the substitutions are
underlined):
5'-AATTCAAAAAAAAAAAAAAAAAAAAAGTGAAAAATTATCAGGCAAAAAAAAAAAATTAC-3' and
5'- GATCGTAATTTTTTTTTTTTGCCTGATAATTTTTCACTTTTTTTTTTTTT TTTTTTT-3'.
Both plasmids were sequenced to ensure proper positioning of the
inserts. All plasmid constructs were sequenced to ensure that no
mutations were generated by PCR. Plasmid copy number varied by less
than 25% (data not shown).
Gel shift assays.
Yeast cells (DS10) were grown in YEPD
medium (500 ml) to an A660 of 6. The cells were
resuspended in fresh medium and, after incubation at 30°C for 30 min,
collected by centrifugation at 2,000 rpm for 20 min. Under these
conditions, transcription of CLN3 is high. The cells were
resuspended in protein extraction buffer containing 0.2 M Tris (pH
8.0), 0.4 M ammonium sulfate, 10 mM MgCl2, 1 mM EDTA, 10%
glycerol, 2 mM
-mercaptoethanol, 1-µg/ml pepstatin A, 0.2-mg/ml
phenylmethylsulfonyl fluoride, and 20-µg/ml aprotinin. Frozen cell
pellets were prepared by immediately dripping the cell suspension into
liquid nitrogen. Cell disruption was performed by extensive chopping of
the cell pellets in a household mini-chopper. A fine powder was
obtained and allowed to thaw on ice. Cellular debris were removed by
centrifugation at 20,000 rpm for 20 min at 4°C. The supernatant was
precipitated with 0.534 volume of 3.8 M ammonium sulfate for 30 min at
4°C. The precipitated proteins were collected by centrifugation at
20,000 rpm for 20 min. Pellets were resuspended in 500 µl of protein
buffer (20 mM HEPES [pH 8.0], 100 mM KCl, 1 mM MgCl2, 0.2 mM dithiothreitol [DTT], 5% glycerol, 0.5 mg of phenylmethylsulfonyl
fluoride) and dialyzed for 3 h against two 500-ml changes of the
same buffer. Insoluble materials were removed by 5 min of
centrifugation at 14,000 rpm in a microcentrifuge at 4°C. The
supernatant was immediately frozen on dry ice and stored at
70°C.
Protein concentration was determined by using a Bio-Rad kit.
726 to
549
fragment from the corresponding pCA205 construct released with
EcoRI and SalI. The second probe (
622 to
603)
was a double-stranded synthetic oligonucleotide made by annealing the
oligonucleotides (5'-GGGCAAGAAAAAAAAAAAGAAAAAG-3' and
5'-GGGCTTTTTCTTTTTTTTTCTTG-3') corresponding to the region
from
622 to
603 and producing non-CLN3 GGG overhangs
for fill-in labeling with Klenow. Both probes were radiolabeled with
[
-32P]dCTP and Klenow fragment. Competition studies
were performed with a molar excess of the unlabeled probe fragment or
other double-stranded oligonucleotides, as indicated.
Southwestern blotting.
The protocol described by Bassel-Duby
et al. (1) was used with minor modifications. Protein
extracts (50 µg) were separated by electrophoresis on a sodium
dodecyl sulfate-7.5% polyacrylamide gel and transferred to
nitrocellulose. To confirm uniform loading, the blot was stained with
Ponceau S. The air-dried nitrocellulose paper was immersed in binding
buffer containing 25 mM HEPES (pH 8.00), 60 mM KCl, 1 mM EDTA, 1 mM
DTT, and 6 M guanidine hydrochloride and gently shaken for 10 min at
4°C. To renature the proteins, guanidine hydrochloride was gradually
removed by repeating the same procedure eight times, each time with a
concentration of guanidine hydrochloride twofold lower than that used
in the previous wash. After the final wash without guanidine
hydrochloride, the nitrocellulose was incubated for 1 h (room
temperature) in 1× binding buffer containing 5% nonfat milk and
5-µg/ml salmon sperm DNA. The filter was then incubated in binding
buffer with 0.25% nonfat milk and 106 cpm of the
radiolabeled probe per ml either with or without competitor, as
indicated. The probe for the Southwestern experiments was the
726 to
549 fragment described above for the gel shift experiments. Binding
was carried out overnight. The filter was washed four times for 7 min
each with 1× binding buffer at room temperature. The blot was analyzed
by using a Molecular Dynamics PhosphorImager.
Site-directed mutagenesis.
A PCR-based mutagenesis strategy,
using Pfu DNA polymerase to minimize errors, was used to
generate a CLN3 promoter fragment corresponding to positions
931 to
414 in which the G's at positions
620,
608,
583,
577, and
455 were replaced with A's. CEN-based plasmid pKL001
(14), containing an epitope-tagged copy of the CLN3 gene driven by the normal CLN3 promoter,
served as a template. First, a PCR fragment was made by using an
upstream oligonucleotide flanking the XhoI site in plasmid
pKL001 (5'-GGTACCGGGCCCCCCCTCGAGGTCGAC-3'; the
XhoI site is underlined) and a downstream primer (
627 to
569) with four of the
mutations (5'-GCAGGCTTGGTAATTTATTTATTGCCTGATAATTTTTCACTTTTTA TTTTTTTTTTATTGAAAG-3'; mutated bases are in boldface underlined). The product (positions
931
to
569) obtained with this first PCR step was then gel purified and
used as the upstream primer in a second PCR with an oligonucleotide (5'-GATTAAAAGCTCGAGGAAAGTACAGATATACAAATTATAAATAGGTAGGAGGAATAAAAAAAAAAG-3') in which the C at position
455 was replaced with a T
(underlined) as a downstream primer. The final PCR product was digested
with XhoI and used to replace the corresponding
XhoI fragment in pKL001, replacing the wild-type region of
the CLN3 promoter between positions
931 and
414, with a
fragment containing the mutations. The resulting plasmid, pKL001
G,
was sequenced to confirm the presence of the mutations and the
orientation of the fragment. pKL001
G and the original wild-type
pKL001 plasmid were transformed into TG3 cells carrying a deletion in
CLN3 so that the only copy of CLN3 in the cell
was that which was carried on the single-copy plasmid.
Immunoprecipitation-Western blotting. Immunoprecipitation-Western blotting using epitope-tagged protein Cln3 was done as described by Tyers et al. (24). For each immunoprecipitation assay point, 5 mg of extract protein was used. Monoclonal antibody 12CA5 was used in the immunoprecipitations and as the primary antibody after blotting. An ECL detection kit (Amersham) was used to develop the Western blots.
| |
RESULTS |
|---|
|
|
|---|
To identify elements within the CLN3 promoter that are involved in glucose regulation of transcription, we tested the ability of CLN3 promoter fragments to drive the expression of URA3 as a reporter gene. Fragments of various lengths from the region of the CLN3 gene 5' of the open reading frame, as indicated in Fig. 1, were inserted into the polylinker of 2µ vector pCA205, a gift from Cathy Atchinson. This places the sequences to be tested upstream of a URA3 gene that contains the URA3 coding region with only a minimal portion of the promoter, 24 bp in length. To test the constructs, yeast cells carrying the plasmids were grown to post-log phase in selective media. Glucose was added back to the cells, and the ability of the promoter fragments to enhance transcription of URA3 was assessed with Northern blots.
|
As shown in Fig. 1, the vector alone with no CLN3 insert
expresses some of the URA3 message, which is driven by
a cryptic promoter within 2µ sequences upstream of
the polylinker (data not shown). It is important to note that
this basal level of transcription is glucose independent. Insertion of
a fragment (
726 to +18) corresponding to the 726 bp immediately
upstream of the CLN3 coding sequence caused URA3
transcription to become strongly glucose dependent. In this construct,
transcription was initiated from the normal CLN3
transcriptional start site, as evidenced by primer extension mapping
(data not shown) and the fact that the message decreases in size with
3' deletion of the insert (Fig. 1). In the control plasmid,
transcriptional initiation takes place within 2µ sequences
approximately 350 bp upstream of the URA3 ATG. The addition of the full-length CLN3 promoter places the
CLN3 initiation site (at
364) approximately the same
distance from the ATG. For this reason, the control message and that
produced by the
726 to +18 construct are approximately the same size.
As 3' deletions are made from the CLN3 promoter segment, the
CLN3 initiation site moves closer to the ATG, leading to
progressively smaller messages.
While the region extending 726 bp upstream from the CLN3
translational start produced strong glucose induction of the reporter gene, 5' deletion of 177 bp from this fragment, leaving the region from
549 to +18 driving the promoter, led to loss of the glucose response.
In contrast, truncation of the promoter from the 3' end produced
relatively little effect on the URA3 transcript level, such
that the
726 to
549 element alone remained strongly glucose inducible. However, while the
726 to
549 fragment confers
glucose-dependent transcription, there is a decrease in the
URA3 message when driven by the
726 to
549 fragment
compared to the
726 to
414 fragment. This may suggest that removal
of the region between
549 to
414 caused loss of some
glucose-responsive elements. On the other hand, the difference in
transcriptional activity between the two fragments could also be due to
the fact that the
726 to
549 element lacks the CLN3 TATA
box. Further analysis of the
549 to
414 element shows that although
this region may play a role in the strong glucose response manifested
by the
726 to
414 fragment, it cannot enhance transcription on its
own (Fig. 1).
Several of the inserts appeared to block basal expression of the
URA3 message, compared to the control without an insert. This may be due to inhibitory sequences or transcriptional termination of this message somewhere within the insert. Our interest is in sequences that are able to alter transcription in response to glucose;
therefore, we have not investigated this further. Additionally, some of
the inserts appeared to allow continued expression of the basal
transcript. For example, the
726 to
549 fragment produced a
prominent glucose-inducible band with a transcriptional start site
mapping to within the short URA3 untranslated sequence (not shown), as well as a less prominent band that seems to correspond to
the message produced in the absence of an insert. For our purposes, we
have concentrated on the more prominent lower bands that are clearly
glucose inducible and have not included the less prominent upper bands
in the quantitation.
A closer examination of the
726 to
414 element shows the presence
of four repeats of the eight-base sequence AAGAAAAA
(A2GA5), three in the forward direction
at positions
622,
610, and
585 and one inverted in the
antiparallel direction at position
460. In addition, there is a
similar sequence, AAGAAATT, at position
579. To
investigate the significance of these repeated sequences for the
transcriptional activity of the
726 to
414 fragment, smaller
constructs containing these sequences were tested for the ability to
enhance transcription upon addition of glucose. We found that a 57-bp
oligonucleotide corresponding to the region of the CLN3
promoter from
626 to
570 is sufficient to produce a substantial
glucose response (Fig. 2). This fragment
contains three complete sets of the repeated sequence
A2GA5 and AAGAAATT. Interestingly,
when the G's in these four repeated sequences are mutated to A's,
this fragment loses its transcriptional activity, as shown for two
independent yeast transformants carrying this construct in the last
four lanes of Fig. 2. This indicates that the repeated sequences play
an important role in driving glucose-dependent transcription.
|
Looking for factors that mediate the glucose response, we used gel
shift assays to determine whether yeast nuclear extracts contain a
protein that will bind specifically to the DNA elements that drive
glucose-dependent transcription. For this experiment, we used a DNA
fragment corresponding to the sequence from
726 to
549 as a labeled
probe. We found that this labeled fragment can form complexes with
proteins in the yeast extract that can be specifically competed with a
molar excess of the same fragment (Fig.
3). Shorter double-stranded
oligonucleotides corresponding to positions
626 to
570 and
591 to
551, which contain four and two sets of the repeated sequence
A2GA5, respectively, also competed, but less
effectively. We cannot tell from these experiments whether the less
complete competition with the shorter oligonucleotides represents
decreased affinity due to the absence of interactions with sites that
are present on the longer probe or the presence of multiple proteins,
some of which bind to sites on the probe that are not represented in
the shorter fragments and therefore not competed. However, it is clear
that competition with the shorter fragments was dependent on the
A2GA5 repeats. Again, mutation of G's
in the repeated sequences to A's diminished the ability of these
fragments to compete with the labeled fragment (competing oligonucleotides containing the mutations are indicated by
asterisks).
|
We found that a double-stranded oligonucleotide corresponding to the
region between positions
622 and
603 with the sequence CCCAAGAAAAAAAAAAAGAAAAAGGG,
containing two of the A2GA5 repeats (underlined), was also able to produce a DNA-protein complex (Fig. 4). In this experiment, two bands are
evident, the lower labeled complex can be competed away with a molar
excess of the unlabeled fragment, but this competition is abolished if
T's are substituted for the G's in the two
A2GA5 repeats. The upper band is less prominent and appears to be less specific in that it is competed by both oligonucleotides. These results indicate that the repeated sequences that are necessary for glucose induction are also important for the
formation of specific DNA-protein complexes.
|
Because addition of glucose to the starved cells produced a large increase in the CLN3 message, we searched for differences between DNA-protein complexes formed with extracts from post-log-phase cells and complexes formed with extracts from log-phase cells. We have been unable to identify any consistent difference in gel shift patterns between log-phase and post-log-phase extracts by using a variety of labeled probes (data not shown).
We used Southwestern blotting with a labeled
double-stranded oligonucleotide probe corresponding to the region
between
626 and
570 to estimate the sizes of proteins that bind to
the A2GA5 repeats. This probe identified two
bands that were competed away by excess unlabeled probe. One of these
bands, with an apparent molecular mass of 69 kDA was competed with a
15-fold excess of the short oligonucleotide, corresponding to the
region between positions
622 and
603
(CCCAAGAAAAAAAAAAAGAAAAAGGG), used
in Fig. 4, containing just the two A2GA5
repeats (underlined). Competition was diminished when the unlabeled
oligonucleotide was mutated to replace the G's in the
A2GA5 sequences with T's (Fig.
5). In other experiments using a shorter
double-stranded oligonucleotide as a probe, corresponding to the region
between positions
591 and
551, the upper 69-kDa band was labeled,
but not the lower one, suggesting that the lower band requires
sequences that are in the larger probe but are not found in the smaller
for binding (Fig. 5B).
|
To confirm the importance of the A2GA5 repeats
in the normal transcriptional regulation of CLN3 by glucose,
we mutated five repeated A2GA5 sequences in the
CLN3 promoter, replacing the central G's in the
A2GA5 repeats with T's at positions
620,
608,
583,
577, and
455. A restriction fragment containing the
mutated promoter sequences was then used to replace the corresponding fragment from the normal CLN3 promoter in plasmid pKL001.
pKL001 is a CEN-based plasmid that contains an epitope-tagged
CLN3 coding sequence driven by the CLN3 promoter
(14). This plasmid was transformed into a cln3
strain to provide the only copy of CLN3 in the cell. We then
compared the expression of CLN3 in cells carrying the mutant
promoter (TKL1) with that in cells carrying the parent plasmid
containing the wild-type promoter (TKL2). We found that mutations of
the repeated sequences produced a substantial reduction in the ability
of glucose to induce CLN3 mRNA levels (Fig.
6A). This decreased CLN3 mRNA
was also reflected in lower Cln3 protein levels, as shown by the
immunoprecipitation-Western blot in Fig. 6A. Cln3 protein levels are
difficult to measure in cells that are not overexpressing the protein.
While it is clear that the mutant promoter produces less Cln3 protein
in vivo, it is difficult to estimate the magnitude of this difference
because Cln3 protein levels were close to the limit of detection.
|
The induction of CLN3 mRNA by glucose suggests that cells increase CLN3 expression in order to accelerate progress through the cell cycle. This would allow the cells to keep up with the increase in cellular growth rate that glucose produces and maintain a relatively constant cell size. We found that while the mutations in the CLN3 promoter produced little noticeable effect on post-log-phase cells, in glucose, the mutant cells were approximately twice as large as those expressing CLN3 at normal levels from the wild-type promoter (Fig. 6B). This is consistent with the lower Cln3 levels and a decreased ability to accelerate movement through the cell cycle in response to glucose.
| |
DISCUSSION |
|---|
|
|
|---|
We have previously demonstrated that CLN3 mRNA levels
are regulated by carbon source and that glucose induction of
CLN3 transcription does not depend on either cellular growth
or progression through the cell cycle (19). By using
CLN3 promoter-reporter fusion constructs, we have identified
a region between positions
762 and
414 in the CLN3
promoter that can confer glucose regulation on a heterologous reporter
gene. This region within the CLN3 promoter contains five
copies, four exact and one partial, of the sequence AAGAAAAA.
Small double-stranded oligonucleotides containing these repeated
sequences are able to drive glucose-dependent expression of the
reporter gene. Mutations in these elements substantially reduce
transcriptional induction of both a URA3 reporter and the CLN3 gene by glucose. Mobility shift assays demonstrate
specific binding of proteins from yeast extracts to DNA fragments
containing the repeats. Protein binding to the labeled oligonucleotide
can be competed with a molar excess of unlabeled oligonucleotides containing the above repeated sequences, but mutation of the central G's within the repeats decreases the ability of the unlabeled DNA to
compete. These results indicate the importance of the repeated elements
for both induction of transcription and DNA-protein interactions. Southwestern blotting revealed a protein with an apparent size of 69 kDa that binds specifically to these sequences in a manner that depends
on the intact repeats, as well as a smaller protein that binds in a
manner that is not affected by changes in the repeats.
We have found no evidence to indicate that glucose regulates the binding of proteins to elements of the CLN3 promoter that confer glucose responsiveness. This suggests that glucose regulation of CLN3 involves a process that is more complex than the simple regulated binding of a transactivator, or repressor protein, to the CLN3 promoter. One important step in learning how glucose affects CLN3 expression would be to identify the protein(s) that binds to the glucose-responsive elements in the CLN3 promoter. It would be interesting to know how these proteins are affected by glucose. Another important question is whether these factors are specific to CLN3 expression or are part of a common pathway that coordinates the expression of a large group of genes in response to glucose. In this regard, a database search yielded only a few yeast promoters carrying these repeated elements. These genes did not fall into any obvious group in terms of function, nor do they all appear to be transcriptionally regulated by glucose. Therefore, we cannot say whether the features that regulate transcription of CLN3 are important in regulating other genes.
Mutation of only five bases, confined to A2GA5 repeats within the CLN3 promoter, produces cells that do not properly increase Cln3 levels in response to glucose. This decrease response clearly has functional significance, because in glucose medium, these cells become approximately twice as large as the controls that express CLN3 from the wild-type promoter. We were unable to detect an appreciable amount of Cln3 protein in the TKL1 cells; however, we believe that Cln3 protein is being expressed in these cells, because they appear smaller than cells with CLN3 completely deleted. The single-copy plasmid produced Cln3 protein levels that were, in our study, close to the limit of detection. We propose that TKL1 cells have some level of functional Cln3 protein that is too low to give a signal in our experiments. While it is clear that these elements contribute to the response to glucose, it is equally clear that these elements alone do not, by themselves, account for the cell cycle shortening that glucose produces. First of all, while mutation of the five A2GA5 repeats decreased the ability of glucose to increase CLN3 mRNA levels, this did not completely abolish the response. This may be because other elements or mechanisms that do not involve these repeated sequences remain able to increase CLN3 transcript levels in response to glucose. It is also possible that the remaining response stems from the presence of additional imperfect copies of the repeated sequence. While we have focused on the 8-bp A2GA5 sequences, there are a total of 13 copies of the shorter 6-bp sequence AAGAAA within the 1,000 bases upstream of the CLN3 coding sequence. It is possible that these also contribute to the glucose response. Secondly, Cln3 protein levels are regulated on a variety of levels in addition to transcription in response to nutrient signals. These mechanisms include posttranscriptional regulation by rich medium (20), the Ras-cyclic AMP pathway (10), protein synthesis rates (10), and nitrogen limitation (8). Finally, the CLN3 gene is believed to act in a redundant pathway, in that deletion of CLN3 is only lethal in combination with loss of other genes, most notably, BCK2 (4, 7). It seems likely that nutrients will regulate other cell cycle components in addition to CLN3.
The closest mammalian homologs to Cln3 appear to be the D-type cyclins. Both D-type cyclins and CLN3 have similarities in expression, being less affected by cell cycle position than other cyclins, and both types of cyclin appear to function in the process of ending G1. The D cyclins serve to link mitogenic signals from the cellular environment to the process of exiting G1 (22). As with the D cyclins, Cln3 levels appear to be regulated by environmental signals, in this case originating from nutrient resources. The transcriptional regulation of CLN3 that we describe appears to be but one of the multiple layers of control that allow yeast cells to modulate G1 length.
| |
ACKNOWLEDGMENTS |
|---|
We thank Fred Cross for providing plasmids.
This work was supported by Public Health Service grant GM42406 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: School of Pharmacy, University of Wisconsin, 425 N. Charter Street, Madison, WI 53706. Phone: (608) 262-1795. Fax: (608) 262 3397. E-mail: wheidema{at}facstaff.wisc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bassel-Duby, R.,
M. D. Hernandez,
M. A. Gonzalez,
J. K. Krueger, and R. S. Williams.
1992.
A 40-kilodalton protein binds specifically to an upstream sequence element essential for muscle-specific transcription of the human myoglobin promoter.
Mol. Cell. Biol.
12:5024-5032 |
| 2. |
Cross, F. R.
1988.
DAF1, a mutant gene affecting size control, pheremone arrest, and cell cycle kinetics of Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:4675-4684 |
| 3. |
Cross, F. R.
1990.
Cell cycle arrest caused by CLN gene deficiency in Saccharomyces cerevisiae resembles START-I arrest and is independent of the mating-pheremone signalling pathway.
Mol. Cell. Biol.
10:6482-6490 |
| 4. | Di Como, C. J., H. Chang, and K. T. Arndt. 1995. Activation of CLN1 and CLN2 G1 cyclin gene expression by BCK2. Mol. Cell. Biol. 15:1835-1846[Abstract]. |
| 5. | Dirick, L., T. Bohm, and K. Nasmyth. 1995. Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae. EMBO J. 14:4803-4813[Medline]. |
| 6. |
Ellwood, M. S., and E. A. Craig.
1984.
Differential regulation of the 70K heat shock gene and related genes in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:1454-1459 |
| 7. |
Epstein, C. B., and F. R. Cross.
1994.
Genes that can bypass the CLN requirement for Saccharomyces cerevisiae cell cycle START.
Mol. Cell. Biol.
14:2041-2047 |
| 8. | Gallego, C., E. Gari, N. Colomina, E. Herrero, and M. Aldea. 1997. The Cln3 cyclin is down-regulated by translational repression and degradation during the G1 arrest caused by nitrogen deprivation in budding yeast. EMBO J. 16:7196-7206[Medline]. |
| 9. |
Hadwiger, J. A.,
C. Wittenberg,
H. E. Richardson,
M. de Barros Lopes, and S. I. Reed.
1989.
A family of cyclin homologs that control G1 in yeast.
Proc. Natl. Acad. Sci. USA
86:6255-6259 |
| 10. | Hall, D. D., D. D. Markwardt, F. Parviz, and W. Heideman. Regulation of the Cln3-Cdc28 kinase by cAMP in Saccharomyces cerevisiae. EMBO J., in press. |
| 10a. | Heideman, W. Unpublished data. |
| 10b. | Heideman, W., and D. D. Hall. Unpublished data. |
| 11. | Jagadish, M. N., and B. L. A. Carter. 1977. Genetic control of cell division in yeast cultured at different growth rates. Nature 269:145-147[Medline]. |
| 12. | Johnston, G. C., J. R. Pringle, and L. H. Hartwell. 1977. Coordination of growth with cell division in the yeast Saccharomyces cerevisiae. Exp. Cell Res. 105:79-98[Medline]. |
| 13. | Johnston, M., and M. Carlson. 1992. Regulation of carbon and phosphate utilization, p. 193-281. In Broach, Pringle, and Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces: gene expression, vol. II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 14. | Levine, K., K. Huang, and F. R. Cross. 1996. Saccharomyces cerevisiae G1 cyclins differ in their intrinsic functional specificities. Mol. Cell. Biol. 16:6794-6803[Abstract]. |
| 15. | Lord, P., and A. Wheals. 1981. Variability in individual cell cycles of Saccharomyces cerevisiae. J. Cell Sci. 50:361-376[Abstract]. |
| 16. | Lord, P., and A. Wheals. 1983. Rate of cell cycle initiation of yeast cells when cell size is not a rate-determining factor. J. Cell Sci. 59:183-201[Abstract]. |
| 17. |
McInerny, C. J.,
J. F. Partridge,
G. E. Mikesell,
D. P. Creemer, and L. L. Breeden.
1997.
A novel MCM1-dependent element in the SWI4, CLN3, CDC6, and CDC47 promoters activates M/G(1)-specific transcription.
Genes Dev.
11:1277-1288 |
| 18. | Nash, R., G. Tokiwa, S. Anand, K. Erickson, and A. B. Futcher. 1988. The WHI+ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog. EMBO J. 7:4335-4346[Medline]. |
| 19. |
Parviz, F., and W. Heideman.
1998.
Regulation of CLN3 mRNA levels by nutrients in Saccharomyces cerevisiae.
J. Bacteriol.
180:225-230 |
| 20. |
Polymenis, M., and E. V. Schmidt.
1997.
Coupling cell division to cell growth by translational control of the G1 cyclin CLN3 in yeast.
Genes Dev.
11:2522-2531 |
| 21. | Sherman, F. 1991. Getting started with yeast. Methods Enzymol. 194:3-21[Medline]. |
| 22. |
Sherr, C.
1996.
Cancer cell cycles.
Science
274:1672-1677 |
| 23. |
Stuart, D., and C. Wittenberg.
1995.
CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells.
Genes Dev.
9:2780-2794 |
| 24. | Tyers, M., G. Tokiwa, and B. Futcher. 1993. Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. EMBO J. 12:1955-1968[Medline]. |
| 25. |
Werner-Washburne, M.,
E. Braun,
G. C. Johnston, and R. A. Singer.
1993.
Stationary phase in the yeast Saccharomyces cerevisiae.
Microbiol. Rev.
57:383-401 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»