Previous Article | Next Article 
J Bacteriol, September 1998, p. 4547-4554, Vol. 180, No. 17
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification of the Gene Encoding the Alternative
Sigma Factor
B from Listeria monocytogenes
and Its Role in Osmotolerance
Lynne A.
Becker,
Mehmet
Sevket
Çetin,
Robert W.
Hutkins, and
Andrew K.
Benson*
Department of Food Science and Technology,
University of Nebraska, Lincoln, Nebraska 68583-0919
Received 4 May 1998/Accepted 6 July 1998
 |
ABSTRACT |
Listeria monocytogenes is well known for its robust
physiology, which permits growth at low temperatures under conditions of high osmolarity and low pH. Although studies have provided insight
into the mechanisms used by L. monocytogenes to allay the
physiological consequences of these adverse environments, little is
known about how these responses are coordinated. In the studies
presented here, we have cloned the sigB gene and several rsb genes from L. monocytogenes, encoding
homologs of the alternative sigma factor
B and the
RsbUVWX proteins, which govern transcription of a general stress
regulon in the related bacterium Bacillus subtilis. The L. monocytogenes and B. subtilis sigB and
rsb genes are similar in sequence and physical
organization; however, we observed that the activity of
B in L. monocytogenes was uniquely
responsive to osmotic upshifting, temperature downshifting, and the
presence of EDTA in the growth medium. The magnitude of the response
was greatest after an osmotic upshift, suggesting a role for
B in coordinating osmotic responses in L. monocytogenes. A null mutation in the sigB gene led
to substantial defects in the ability of L. monocytogenes
to use betaine and carnitine as osmoprotectants. Subsequent
measurements of betaine transport confirmed that the absence of
B reduced the ability of the cells to accumulate
betaine. Thus,
B coordinates responses to a variety of
physical and chemical signals, and its function facilitates the growth
of L. monocytogenes under conditions of high osmotic
strength.
 |
INTRODUCTION |
Listeria monocytogenes is
a ubiquitous gram-positive bacterium that occasionally causes outbreaks
and sporadic cases of food-borne illness. It is estimated that more
than 1,700 cases occur annually in the United States, with outcomes
ranging from flu-like illness to meningitis, meningoencephalitis,
septicemia, abortion, and death, particularly in pregnant women and
immunocompromised individuals (24, 41).
As an intracellular parasite that is transmitted primarily by
contaminated food, L. monocytogenes must reach and/or
maintain a cell density in the food environment that is necessary for
infection. This population must further mitigate the physiological
consequences of passage through the gastrointestinal tract and entry
into host cell phagosomes. Although genetic analysis of virulence has
provided many of the details of how virulence genes allow L. monocytogenes to elude potentially lethal outcomes of entry into
host cells (23, 40, 43), little is known about the role of
adaptive physiological responses in promoting the growth and survival
of this bacterium in the food, intestinal, and intracellular
environments.
L. monocytogenes is well known for its robust physiological
characteristics and is one of the few pathogenic bacteria capable of
growth at refrigeration temperatures, at low pHs, and/or under conditions of high osmolarity (21, 22, 32, 36, 55). These
characteristics play an integral role in its potential as a food-borne
pathogen, since they permit the growth of L. monocytogenes under conditions that prohibit the growth of many commensal organisms. Physiological studies have previously demonstrated that specific transport systems which mediate the uptake of osmoprotectants and
cryoprotectants facilitate growth under these environmental conditions
(9, 31, 32). A further role for adaptive physiological responses in pathogenesis has also been proposed on the basis of
genetic experiments demonstrating that genes participating in acid
tolerance (35) and stress-induced proteolysis
(42) are necessary for full virulence in the mouse model.
Thus, significant evidence is beginning to mount for a central role of
adaptive physiological responses of L. monocytogenes in
pathogenesis as well as in growth and survival in the environment.
To further our understanding of the connection between physiology and
the transmission of food-borne illness, we have begun an analysis of
genetic pathways that modulate adaptive responses in L. monocytogenes. One candidate for mediating such responses in
gram-positive organisms is
B, a secondary subunit of RNA
polymerase that is known to govern a large stress response regulon in
the related bacterium Bacillus subtilis. The
B regulon of B. subtilis comprises at least
40 genes (52) and includes the katE gene,
encoding a catalase (19, 20), the opuE gene,
encoding transport machinery for osmoprotectants (53), the
clpC gene, which is similar to stress-induced ATPase
subunits of ClpP-type proteases (33), the gtaB
gene, encoding a UDP-glucose pyrophosphorylase believed to participate
in trehalose biosynthesis (46), and several genes whose
functions cannot be inferred from their sequences (3, 11,
47).
The activity of
B is joined to several physical and
chemical signals through a postranslational mechanism that partitions
B between inactive complexes with an anti-sigma factor
protein, RsbW (for regulator of sigma B), and free
B,
which is capable of forming holoenzyme complexes with core RNA polymerase (6). At least two independent pathways exist
which can alter the affinity of RsbW for its antagonist, RsbV, or
B. First, it has been proposed that ATP stimulates the
formation of RsbW-
B complexes and activates a serine
kinase activity in RsbW that phosphorylates its antagonist, RsbV, into
an inactive state (2, 18, 58). Physical signals such as
temperature, pH, and osmolarity can also invoke
B
activity (7, 11-13, 51) by stimulating the function of the RsbV-phosphate phosphatase RsbU (29, 58). At least four
other Rsb proteins (RsbR, RsbS, RsbT, and RsbX) modulate the activity of RsbU and serve as distinct points of signal input into the system
(1, 29).
To examine how the
B regulon contributes to adaptive
responses of L. monocytogenes, we have cloned the genes
encoding homologs of
B and several of the Rsb proteins.
In this report, we demonstrate that the L. monocytogenes
rsbVW-sigB-rsbX transcription unit is structurally analogous to
its counterpart in B. subtilis and that its activity in
L. monocytogenes is responsive to several physical and
environmental signals. Genetic and physiological studies indicate that
B facilitates growth under conditions of high osmolarity
when betaine and carnitine are supplied as the primary osmoprotectants.
Thus, the
B regulon in L. monocytogenes
participates in responses to several physiological and chemical
insults, and it may serve as a primary osmosensor in this organism.
 |
MATERIALS AND METHODS |
Strains and plasmids.
L. monocytogenes Scott A
was obtained from R. Hutkins (University of Nebraska), and L. monocytogenes LO4035 was obtained from N. Freitag (Wayne State
University). L. monocytogenes cells were grown in brain
heart infusion (BHI) (Difco, Detroit, Mich.) at 30°C unless otherwise
specified. Where specified, kanamycin (30 µg/ml) or chloramphenicol
(6 µg/ml) was added. Escherichia coli DH5
and E. coli MC1061 were used as cloning hosts and were grown in Luria
broth with 150 µg of ampicillin/ml or 40 µg of kanamycin/ml where
appropriate.
Cloning of sigB from L. monocytogenes.
Preliminary Southern blot experiments using a 540-bp
EcoRI-PstI fragment of the B. subtilis
sigB gene (10) as a probe indicated that a single
3.8-kb EcoRI fragment of the L. monocytogenes
Scott A or LO4035 chromosome hybridized under conditions of moderate stringency (with 5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate] at 56°C). A plasmid minilibrary was therefore constructed by cloning 3- to 4-kb EcoRI fragments of L. monocytogenes chromosomal DNA into EcoRI-digested
pUC19. The resulting plasmid library was transformed into a DH5
strain, and approximately 200 colonies containing plasmids with inserts
were patched onto replica plates and transferred to nylon membranes.
The colonies were screened by colony hybridization with the 540-bp
EcoRI-PstI B. subtilis sigB probe
under the same hybridization conditions as those used for the Southern
blots. Two positive clones with identical restriction patterns were
obtained. One clone was designated pLM413 and was used for further
studies.
DNA sequence analysis.
Both strands of the 3.75-kb
EcoRI fragment of pLM413 were subjected to DNA sequence
analysis on an automated sequencer (LiCor, Inc.) by primer walking.
Sequence alignments were performed with the PILEUP and BESTFIT programs
from the Genetics Computer Group.
Preparation and analysis of RNA.
RNA samples were prepared
from 200 ml of mid-logarithmic-phase L. monocytogenes cells
(optical density at 600 nm [OD600], ~0.4) before and 20 min after the addition of either 4% NaCl, 1 mM EDTA, 2% ethanol,
0.15% H2O2, or glacial acetic acid to a pH of
5.3. Additional samples were prepared after an aliquot of the cells was
allowed to enter stationary phase (OD600, ~3.0) and after
mid-logarithmic-phase cells were shifted from 25 to 48°C for 20 min
or to 4°C for 24 h. After treatment, the cells were harvested by
centrifugation at 8,000 × g for 5 min at 4°C, and
the cell pellets were frozen at
70°C overnight. The cells were
subsequently resuspended in 5 ml of buffer D (4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5% Sarkosyl, 0.1 M
2-mercaptoethanol) and passed through a French pressure cell at 1,500 lb/in2. RNA was then extracted as described by Chomczynski
and Sacchi (15). The final RNA pellet was dissolved in
diethylpyrocarbonate-treated water, quantified spectrophotometerically,
and stored frozen at
70°C. The integrity and relative
concentrations of the RNA samples were also checked by agarose gel
electrophoresis and ethidium bromide staining.
Primer extension analysis of sigB transcripts.
For each reaction, 10 pmol of the oligonucleotide VPROM2 (5'
CGCTGTATAAGCATCGATCAC 3') was end labeled with 50 µCi of
[
-32P]ATP. The labeled primer was then mixed with 50 µg of RNA, heated to 70°C for 10 min, chilled on ice for 30 s,
and incubated at 42°C with 3 U of SUPERSCRIPT II RNase H-reverse
transcriptase (Life Technologies). After 50 min of extension, the
products were ethanol precipitated, washed in 70% ethanol, and dried.
The primer extension products were then dissolved in 90% formamide-10
mM EDTA and loaded onto a 6% denaturing polyacrylamide gel alongside a
sequencing ladder prepared by using the VPROM2 primer and the pLM413
template DNA.
Construction of the sigB::km
strain.
A null mutation in the L. monocytogenes sigB
gene (sigB::km) was generated by
cloning an aph3'5'' gene encoding kanamycin resistance from
pDG783 (26) into the unique StyI site of pLM413, which lies within the sigB coding region. The
aph3'5'' gene was removed from pDG783 as a
HindIII fragment and was subsequently blunt ended with
Klenow fragment prior to ligation to StyI-restricted pLM413
that had also been blunt ended with Klenow fragment. The resulting
plasmid was designated pLM425 and was restriction mapped to confirm
insertion of the aph3'5'' gene into the appropriate position. The entire EcoRI fragment of pLM425, containing
the rsbU, rsbV, rsbW,
sigB::km, and rsbX genes,
was then cloned into the EcoRI site of the
temperature-sensitive integration vector pKSV7, which carries a
chloramphenicol resistance gene (44). The resulting plasmid,
designated pKSV7K8, was restriction mapped to ensure its integrity.
To place the sigB::km allele onto the
L. monocytogenes chromosome by allelic exchange, we used
pKSV7K8 in an integration-excision procedure outlined by Smith and
Youngman (44). The plasmid was introduced into L. monocytogenes LO4035 cells by electroporation as described
elsewhere (14). After 2 h of recovery in BHI, the transformants were plated onto BHI containing 6 µg of
chloramphenicol/ml and were incubated at 30°C for 36 h. Two
chloramphenicol-resistant transformants were then chosen and grown for
three successive generations at the nonpermissive temperature for
plasmid replication (42°C) in BHI supplemented with 6 µg of
chloramphenicol/ml, followed by growth for three generations in BHI
alone at the permissive temperature for plasmid replication (30°C).
The cultures were then plated on BHI with 30 µg of kanamycin/ml and
were incubated at 42°C. Kanamycin-resistant colonies were then
patched to BHI-chloramphenicol plates to screen for loss of the
plasmid-linked chloramphenicol resistance determinant.
Kanamycin-resistant, chloramphenicol-sensitive colonies were
subsequently analyzed by Southern blot analysis to confirm that plasmid
excision had occurred, leaving the
sigB::km allele on the chromosome.
Because insertion of the kanamycin resistance cassette into
sigB is likely to be polar on downstream
rsbX
expression, we compared
the phenotype of the
sigB::
km strain to that of an
rsbX mutant
in order to determine if the polarity could
contribute to the
phenotypic characteristics of the
sigB::
km strain. The
rsbX
gene
was inactivated by integration of a pKSV7 derivative carrying
an
internal fragment of the
L. monocytogenes rsbX gene.
Transformation
of
L. monocytogenes LO4035 with this plasmid
insertionally inactivates
rsbX and subsequently gives rise
to pinpoint colonies after 2
days of incubation. Transfer of the
colonies to fresh medium consistently
gave rise to flares of apparently
faster-growing cells that maintained
a large-colony phenotype upon
subsequent passage. These observations
are consistent with the
phenotype of
rsbX mutants of
B. subtilis,
which
grow poorly, due to the derepression of
B activity, and
which acquire suppressor mutations that give rise
to cells with normal
growth rates (
5,
11,
50). The fact
that insertion of the
kanamycin resistance gene into the
sigB gene of
L. monocytogenes gives rise to normal-sized colonies indicates
that
any polar effects on
rsbX are epistatic to inactivation of
sigB and are therefore negligible with regard to the
phenotype
of the
sigB mutant.
Growth in DM.
To assess the ability of the wild-type and
sigB::km strains to use betaine and
carnitine as osmoprotectants, the cells were grown in a defined medium
(DM) derived from formulations described by Pine et al. (39)
and Beumer et al. (9). DM contains, per liter, 15 g of
KH2PO4, 1 g of
(NH4)2SO4, 0.2 g of
MgSO4 · 7H2O, 0.02 g of
CaCl2, 10 g of glucose, 0.088 g of ferric ammonium
citrate, 0.1 g each of L-leucine,
L-isoleucine, L-valine,
L-methionine, and L-cysteine, 0.6 g of
L-glutamine, 0.5 mg each of riboflavin and biotin, 1.0 mg
of thiamine, and 0.005 mg of thioctic acid. After stock solutions of
the components were combined, the pH was adjusted to 6.7 with potassium
hydroxide and was filter sterilized. Cultures were grown in DM for
18 h at 30°C and were subsequently inoculated at 2% (vol/vol)
in 250-ml baffled culture flasks containing DM with or without 3%
NaCl, or DM with 3% NaCl that was supplemented either with 1 mM
glycine betaine or with 1 mM carnitine. The cultures were incubated
with shaking at 30°C, and growth was monitored by spectrophotometric
measurements of OD600 over the course of several days.
Betaine uptake.
To measure the ability of LO4035 and LMA2B
to accumulate betaine, log-phase cells grown in BHI at 30°C were
harvested by centrifugation, washed twice, and resuspended in 50 mM
potassium phosphate buffer (pH 6.8) to an OD600 of ca. 1.0. The cells were energized by the addition of glucose (final
concentration, 5 mM), and where indicated, 3% NaCl (514 mM) was also
added. After 20 min of incubation at room temperature, the assays were
initiated by the addition of [14C]betaine (final
concentration, 1 mM; 65 µCi/mmol; American Radiolabeled Chemicals,
Inc., St. Louis, Mo.). The mixtures were incubated at room temperature,
and 1-ml samples were removed and centrifuged through silicon oil as
described previously (16). Radioactivity was measured by
scintillation counting. The results are reported as the averages of
duplicate samples. Independent experiments were conducted on successive
days to confirm these results. The protein concentrations of cell
suspensions were derived from a standard curve relating OD to protein
concentration (54).
Nucleotide sequence accession number.
The sequence of the
3.75-kb EcoRI fragment of pLM413 has been deposited in
GenBank under accession no. AFO74855.
 |
RESULTS |
Cloning and sequence analysis of the sigB operon from
L. monocytogenes.
DNA sequence analysis of the cloned
fragment revealed that five putative coding regions were present,
including one with homology to the 3' end of rsbU, as well
as the entire coding regions of the rsbV, rsbW,
sigB, and rsbX homologs (Fig.
1). The contiguous arrangement of these
genes is similar to that observed in B. subtilis and
Staphylococcus aureus (28, 34, 56, 57).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Similarity of the structure and organization of RsbU,
RsbV, RsbW, B, and RsbX proteins with their B. subtilis and S. aureus homologs. The percent similarity
scores of pairwise alignments of the primary amino acid sequences of
the L. monocytogenes proteins with the B. subtilis and S. aureus proteins are shown between the
blocks representing the respective genes. Coding regions that overlap
are indicated by overlapping of the respective blocks representing each
gene. The B-dependent promoters (PB)
identified upstream of rsbV in B. subtilis
(28) and in L. monocytogenes (this report) are
indicated by arrows.
|
|
Detailed comparisons of the physical organization of the genes from
L. monocytogenes to that of the genes in
B. subtilis and
S. aureus showed two highly conserved
features. First, a significant
spacer region of 153 bases is positioned
between the 3' end of
rsbU and the 5' end of
rsbV
in
L. monocytogenes; although not
conserved in sequence,
this spacer region also exists in
B. subtilis (59 bp) and
S. aureus (110 bp) (
28,
57). This region contains
a known
B-dependent promoter in
B. subtilis
that serves as an autocatalytic
device for amplifying mRNA encoding
B and the RsbVWX regulatory components in response to
stress (
7,
13,
28). Secondly, there appears to be
translational coupling
between
rsbV and
rsbW and
between
rsbW and
sigB, as these coding
regions
overlap by at least 1 codon. The overlap is most striking
between
rsbW and
sigB (13 codons) and appears to be an
important
feature of these genes, because it is conserved in
B. subtilis (13 codons) and
S. aureus (8 codons) (
28,
34,
57). Translational
coupling has been proposed for these genes
(
28), and experimental
evidence supports this hypothesis in
the case of
rsbW and
sigB (
8). The
conservation of the
rsbW-sigB overlap further supports
the
importance of coupling as a device for ensuring equimolar
synthesis of
B and its primary regulator; however, the mechanism
through which
the coupling is mediated through this extensive overlap
remains
to be determined.
Homology of the Rsb and
B proteins.
Alignment
of the predicted amino acid sequences of RsbUVWX and
B
with their homologs from B. subtilis and S. aureus indicates that the L. monocytogenes homologs are
more closely related to their counterparts in B. subtilis
(Fig. 1 and 2). Overall, the putative
RsbU, RsbV, RsbW, and
B proteins display 60 to 75%
similarity (40 to 50% identity) with their B. subtilis and
S. aureus homologs. In contrast, however, the RsbX protein
displays only limited homology (29% identity) to its B. subtilis counterpart.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Multiple sequence alignments of the RsbU (A), RsbV (B),
RsbW (C), B (D), and RsbX (E) proteins with their
homologs from B. subtilis (Bsu) and S. aureus
(Sau). Lm, L. monocytogenes. (A through D) Alignments were
derived by using the PILEUP program of the Genetics Computer Group. (B)
The serine residue of SpoIIAA that is phosphorylated by SpoIIAB and is
believed to be the site of RsbW-dependent phosphorylation of RsbV is
indicated by an arrowhead. Highly conserved domains are shaded. (C)
Alignment of the RsbW proteins and the SpoIIAB homolog from B. subtilis. Domains showing homology with regions I and II of the
histidine protein kinase family of two-component system proteins are
shaded, and residues within these domains that are identical in every
homolog are boldfaced. (D) The conserved subregions of sigma factors
that were identified previously by Helman and Chamberlin
(27) are underlined with arrows and numbered. (E) Pairwise
alignment of the B. subtilis and L. monocytogenes
RsbX proteins was performed with BESTFIT. Vertical lines indicate
identical residues, and the periods and colons indicate
semiconservative and conservative changes, respectively.
|
|
Multiple sequence alignments of the
L. monocytogenes RsbV,
RsbW, and
B proteins with their counterparts from
B. subtilis and
S. aureus revealed highly
conserved subregions within each (Fig.
2). Alignment
of the RsbU
homologs predicts that our cloned fragment contains
only about half of
the
L. monocytogenes rsbU gene (Fig.
2A). Within
RsbV, we
identified three subregions, designated I through III,
that appear to
be highly conserved (Fig.
2B). Region II includes
the conserved serine
residue that can be aligned with the serine
residue in the homolog
SpoIIAA, which is the site of phosphorylation
by the SpoIIAB homolog
RsbW (
17,
37,
38). How domains I
and III contribute to RsbV
structure, function, or both remains
to be determined. As with RsbV, we
also observed three highly
conserved subregions, designated regions I,
IIa, and IIb, within
the
L. monocytogenes RsbW homolog (Fig.
2C). These regions have
previously been proposed to play a role in ATP
binding of the
RsbW homolog SpoIIAB by virtue of their similarities to
domains
I and II of histidine protein kinases (
37). The
B proteins, which demonstrated the highest identity
scores, showed
the highest degree of identity in regions 2.2, 2.4, and
4.2, which
are believed to participate in core RNA polymerase binding
and

10 and

35 recognition, respectively (
27).
Stress-dependent activation of
B in L. monocytogenes.
The intergenic region between rsbU and
rsbV is the location of a known
B-dependent
promoter in B. subtilis (28) that serves as an
autocatalytic device for increasing the levels of mRNA encoding the
RsbV, RsbW, RsbX, and
B proteins under conditions of
B activation (7, 13). We therefore examined
this region by primer extension to determine if a
B-dependent promoter is similarly positioned in L. monocytogenes and if its activity is stress dependent. A primer
(VPROM2) that is complementary to positions +63 to +83 relative to the
rsbV initiation codon was end labeled and used in primer
extension analyses on mRNA extracted from logarithmically growing cells before and after environmental stress (4% NaCl or pH 5.3) or entrance into stationary phase. As shown in Fig.
3, no transcript from this region was
detected in logarithmically growing cells; however, increasing the
osmolarity of the medium, decreasing its pH, or permitting the cells to
enter stationary phase led to the appearance of an extension product
mapping to position 646 of the nucleotide sequence. The initiation site
of this transcript lies immediately downstream of sequences that can be
aligned with known
B-dependent promoters (Fig.
4), indicating that this promoter may be
utilized by
B-RNA polymerase holoenzyme under stress
conditions.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension analyses of transcripts originating
upstream of rsbV in L. monocytogenes. In each
panel, 50 µg of each RNA sample was used as a template for extension
of the labeled VPROM2 primer. (A) RNA was derived from logarithmically
growing cells before (lane 1) and after the addition of 4% NaCl (lane
2), entrance into stationary phase (lane 3), or acidification of the
medium to pH 5.3 with glacial acetic acid (lane 4). The sequence ladder
was derived from sequencing reactions using the VPROM2 primer. (B and
C) Bands are shown at the same position relative to the sequencing
ladder in panel A. (B) RNA samples were derived from logarithmically
growing cells (25°C) of LO4035 (wild type) (lanes 1, 3, 5, 7, and 9)
and the isogenic sigB::km mutant LMA2B
(lanes 2, 4, 6, 8, and 10) before stress (lanes 1 and 2) and 20 min
after the addition of 4% NaCl (lanes 3 and 4), acidification to pH 5.3 with glacial acetic acid (lanes 5 and 6), a temperature upshift to
48°C (lanes 7 and 8), and entrance into stationary phase (lanes 9 and
10). (C) RNA samples were derived from LO4035 (wild type) during
logarithmic growth at 25°C (lane 1) and 20 min after the addition of
4% NaCl (lane 2), 2% ethanol (lane 3), 1 mM EDTA (lane 4), 0.15%
H2O2 (lane 5), or glacial acetic acid to pH 5.3 (lane 6), a temperature upshift to 48°C (lane 7), a downshift to
4°C (lane 8), or entrance into stationary phase (lane 9).
|
|

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 4.
Alignment of known B-dependent promoters.
The sequences immediately upstream of the B-dependent
transcription start site of the L. monocytogenes rsbV gene
are aligned with known B-dependent promoters from
B. subtilis. The most highly conserved residues, centering
around the 10 and 35 regions, are shaded. The alignment of B. subtilis promoters was derived from von Blohn et al.
(53). Bs, B. subtilis; Lm, L. monocytogenes.
|
|
To confirm that the stress-induced transcript is
B
dependent, we performed primer extension assays on RNA extracted from
both
the wild type, LO4035, and its isogenic derivative, LMA2B, which
carries an allele of
sigB
(
sigB::
km) that has been insertionally
inactivated by the introduction of a kanamycin resistance gene
(see
Materials and Methods). As predicted, only RNA samples from
the
wild-type strain yielded primer extension products after osmotic
upshifting, temperature upshifting, acidification, or entry into
stationary phase (Fig.
3B). Thus, the stress-induced transcript
relies
on
B and appears to be a conserved autocatalytic
mechanism for increasing
the abundance of the
rsbVW-sigB-rsbX transcript upon the perception
of stress.
Because of the autocatalytic nature of
B, the level of
the
B-dependent transcript that originates upstream of
rsbV is a convenient
measure of
B activity in
the cell. We therefore used our primer extension
assay to measure the
relative effects of different environmental
conditions on
B activity in
L. monocytogenes (Fig.
3C). As
observed in the previous
experiment, no transcript was detected in
logarithmically growing
cells; however, significant levels of the
transcript were observed
after cells had been exposed to 4% NaCl, 2%
ethanol, acidification
to a pH of 5.3, 1 mM EDTA, 0.15%
H
2O
2, or a temperature upshift
(from 25 to
48°C) or downshift (from 25 to 4°C). Each of these
treatments led
to the appearance of the
B-dependent transcript,
indicating that
B activity was stimulated.
Although many of the conditions examined above are known to activate
B in
B. subtilis, we noted unique aspects of
the
L. monocytogenes responses. First, based on the
intensity of the labeled bands,
osmotic upshifting gave rise to the
highest degree of stimulation
relative to the other treatments. The
magnitude of this response
relative to the other conditions is striking
and appears to be
greater than what has been observed in
B. subtilis after a similar
upshift (
13). We note,
however, that the dose-response curve
of
B activity is
complex and that the "doses" of each stress used
in our experiments
may not be optimal. Next, we observed two conditions,
temperature
downshifting and the addition of EDTA, which activated
B
only in
L. monocytogenes. Experiments with
B. subtilis cells
grown under similar conditions failed to yield
significant activation
of
B activity based on
measurements of transcription from the
B-dependent
transcriptional fusion (
ctc::
lacZ) and
on measurements
of
B by Western blotting (
4).
Effects of the sigB::km mutation
on osmotolerance in L. monocytogenes.
Because we observed
the highest level of
B activity after an osmotic
upshift, we next examined whether the absence of sigB would
have any effect on the ability of L. monocytogenes to grow under conditions of high osmotic strength. We initially evaluated the
growth of LO4035 and the isogenic LMA2B derivative
(sigB::km) in BHI after logarithmically
growing cells were exposed to an osmotic upshift by the addition of 6%
NaCl. As illustrated in Fig. 5A, the
addition of NaCl to the cultures led to an abrupt decrease in the
growth rate. Relative to the parental strain, however, the
sigB::km mutant showed a slightly
reduced, but reproducible, rate after upshifting of the culture during
the latter stages of logarithmic growth, suggesting that the absence of
B only slightly impaired adaptation to the osmotic
upshift in this complex growth medium.

View larger version (12K):
[in this window]
[in a new window]

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Growth of wild-type and sigB mutant strains
of L. monocytogenes after osmotic upshift in BHI (A) or DM
(B and C). (A) LO4035 (wild type) and LMA2B
(sigB::km) were grown in BHI, and the
cultures were divided into two equal portions at 425 min (arrow).
Sodium chloride was added to one portion to a final concentration of
6%, and both portions were further incubated. Symbols: , LO4035
without NaCl; , LO4035 with 6% NaCl; , LMA2B without NaCl; ,
LMA2B with 6% NaCl. (B) Equivalent volumes of 18-h cultures of LO4035
and LMA2B in DM were inoculated into DM without NaCl ( , LO4035; ,
LMA2B), DM with 3% NaCl ( ,
LO4035; ×, LMA2B), and DM with 3% NaCl supplemented with 1 mM betaine
( , LO4035; , LMA2B. (C) Equivalent volumes of 18-h cultures of
LO4035 and LMA2B in DM were inoculated into fresh DM ( , LO4035; ,
LMA2B), DM with 3% NaCl ( ,
LO4035; ×, LMA2B), and DM with 3% NaCl supplemented with 1 mM
carnitine ( , LO4035; , LMA2B).
|
|
Since the growth medium used in the above experiment provides several
amino acids and the quaternary ammonium compounds betaine
and
carnitine, which can be used by
L. monocytogenes as
osmoprotectants
(
9,
31,
32), we next tested the ability of
the isogenic
strains to grow in DM under conditions of high osmolarity
when
only a single osmoprotectant was provided (Fig.
5B and C). When
overnight cultures were inoculated into fresh DM of low osmolarity,
only a brief lag was observed. Inoculation of the same cells into
DM
containing 3% NaCl (514 mM), however, prevented growth of both
strains
during the course of the experiments. When the cells were
inoculated
into DM containing 3% NaCl and 1 mM betaine (Fig.
5B)
or 1 mM
carnitine (Fig.
5C), the wild-type strain was capable
of growth after a
prolonged lag period (30 h for betaine and 40
h for carnitine). In
contrast, LMA2B demonstrated a substantially
longer lag period in the
presence of betaine (Fig.
5B) and failed
to grow in the presence of
carnitine within the time frame of
the experiment (Fig.
5C). These
results indicate that the absence
of
B impairs the
ability of
L. monocytogenes to use betaine and carnitine
as
osmoprotectants, most likely due to defects in the transport
of the
osmoprotectants.
Betaine accumulation is defective in the
sigB::km strain.
To confirm that
the absence of
B impairs the accumulation of betaine, we
measured the ability of the isogenic strains to accumulate [14C]betaine under conditions of high and low osmolarity.
Cells from both LO4035 and LMA2B were grown to mid-logarithmic phase in
BHI (OD600, ~0.4) and then were harvested and washed at
room temperature to prevent temperature-dependent induction of
B activity. As shown in Fig.
6, the two strains accumulated similar amounts of labeled betaine when incubated in phosphate buffer alone,
confirming the presence of a constitutive betaine transport system that
has been described previously (49). When 3% NaCl was added
to the cells, betaine accumulation in the wild-type strain LO4035 was
stimulated considerably. In contrast, inactivation of the
sigB gene in LMA2B prohibited osmotic stimulation of betaine accumulation. These results are consistent with a model in which
B mediates a sodium-inducible or osmotically inducible
component of betaine transport. Thus,
B appears to play
an integral role in coordinating the physiological adaptation of
L. monocytogenes to osmotic upshifting.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Betaine accumulation in LO4035 and LMA2B. Cells in the
mid-logarithmic growth phase (OD600, ~0.4) were
harvested, washed, and resuspended in potassium phosphate buffer. The
washed cell suspension from each strain was energized by the addition
of glucose and then divided into two equal volumes, and sodium chloride
to a final concentration of 3% was added to one of the samples. After
20 min of induction, 14C-labeled betaine was added to each
sample, and aliquots were removed over time, harvested by
centrifugation through oil, and counted by scintillation counting.
Symbols: , LO4035; , LO4035 plus 3% NaCl; , LMA2B; , LMA2B
plus 3% NaCl.
|
|
 |
DISCUSSION |
The ability of L. monocytogenes to grow under
conditions of suboptimal temperature, osmolarity, and pH may favor its
growth in contaminated food products and promote survival during
transit through the gastrointestinal tract and entry into host cell
phagosomes. In this report, we have used genetic analyses and
physiological studies to examine how L. monocytogenes
coordinates such physiological responses through the activity of an
alternative sigma subunit of RNA polymerase,
B.
Analysis of the physical organization of the L. monocytogenes
rsbU, rsbV, rsbW, sigB, and
rsbX genes demonstrated that the genes are organized in much
the same manner as they are in the related gram-positive organisms
B. subtilis and S. aureus, with the exception of
rsbX, which is absent downstream in S. aureus. These conserved features include an extensive overlap of the
rsbW and sigB coding regions, further supporting
an important role for translational coupling of
B to its
primary regulator, RsbW. Multiple sequence alignments of the putative
B and Rsb proteins further revealed highly conserved
subregions within the anti-anti-sigma factors RsbV and SpoIIAA, which
may facilitate further genetic and biochemical analysis of the
structure-function relationships among these proteins.
Given the high degree of conservation among the RsbUVW and
B proteins, we are intrigued by the low degree of
identity between the L. monocytogenes and B. subtilis RsbX proteins. In B. subtilis, RsbX is the
farthest-upstream member of the Rsb signal transduction cascade
(29, 50, 58). This divergence may therefore reflect adaptation of rsbX to sensing functions that are attuned to
unique aspects of the physiology and ecology of L. monocytogenes. We are currently identifying the other
rsb genes in L. monocytogenes to determine how
differences in structure might correspond to differences in function.
In addition to the divergence in the primary sequence of RsbX, we also
observed unique characteristics of the physical and chemical conditions
that elicit
B activity in L. monocytogenes,
including responses to temperature downshifting and to the presence of
EDTA, and the magnitude of the response to osmotic upshifting.
Induction of
B activity subsequent to a temperature
downshift suggests that
B may contribute to the unique
psychrotrophic characteristics of this organism. Since betaine has been
demonstrated to act as a cryoprotectant as well as an osmoprotectant in
L. monocytogenes (31), the participation of
B in betaine accumulation suggests that low-temperature
induction of
B activity may also stimulate betaine
accumulation after a temperature downshift. We are currently testing
this hypothesis.
Induction of
B activity in response to EDTA is also
notable. The response may be due to decreased availability of divalent cations within the cytoplasm. Alternatively, it could be an indirect response to destabilization of teichoic acids or effects on membrane proteins that require divalent ions for structure or function. Given
that the Rsb cascade responds to many types of physical signals (pH,
temperature, and osmolarity), it may be that compromising the integrity
of the envelope is sufficient to elicit
B activity. In
support of this idea is the fact that the S. aureus sigB
gene was originally discovered as a transposon insertion that led to
sensitivity of the cells to methicillin (57), suggesting a
role for
B in cell wall-associated functions in this
organism. We are currently determining which cation limitation invokes
B activity and whether it is due to its declining
concentration inside or outside the cell.
Role of
B in osmotolerance in L. monocytogenes.
The magnitude of
B induction that
was observed after an osmotic upshift (Fig. 3) initially suggested that
B function might be important in mediating
osmotolerance. Experiments with the isogenic
sigB+ and sigB mutant strains
subsequently demonstrated that the absence of
B impaired
the ability of L. monocytogenes to use betaine and carnitine as osmoprotectants (Fig. 5B and C). This defect was further shown to
result from the inability of the sigB mutant strain to
stimulate betaine accumulation after an osmotic upshift (Fig. 6).
Physiological studies with
L. monocytogenes have previously
demonstrated the existence of independent systems for betaine
and
carnitine uptake (
25,
48). Betaine is transported by a
sodium-driven transporter (
25) and is the principal
osmoprotectant
in the presence of other osmoprotectants, while
carnitine transport
appears to be ATP dependent and subject to
inhibition by betaine
(
25,
48). We did not observe defects
in constitutive betaine
accumulation in the
sigB mutant but
instead found that this strain
failed to stimulate accumulation after
an osmotic upshift (Fig.
6). Previous studies have demonstrated that
betaine uptake in
L. monocytogenes is stimulated by osmotic
upshifting (
31). These
results are consistent with
B mediating a sodium-inducible or osmotically inducible
component
of betaine transport. This function could be a consequence of
B directing the transcription of one or more genes
encoding a betaine
transporter or, alternatively, a regulatory protein
that modulates
the synthesis or activity of a betaine transport system.
Since
betaine is the osmoprotectant of choice, when available
(
48),
the
B-dependent component of betaine
transport in
L. monocytogenes may therefore be the primary
system for osmotic stimulation. Consistent
with this hypothesis, we
observed significant induction of
B activity in response
to osmotic upshifting.
The use of
B as a primary means for coordinating osmotic
responses in
L. monocytogenes is apparently unique.
B. subtilis sigB mutants do not show obvious defects in osmotolerance
(
53), likely
due to the existence of both multiple
regulatory systems and redundant
transporters in this organism. Indeed,
three independent transporters
can be used for proline and betaine
uptake in
B. subtilis (
30,
53). Moreover, in the
case of the
opuE gene, which encodes a
proline transporter,
its
B-dependent promoter is one of two osmotically
inducible promoters
(
53). The adoption of redundant genes
encoding transport systems
in this organism may have led to
dissemination of the role of
coordinating their expression among other
regulatory systems in
order to bring expression into harmony with the
availability of
different substrates. Given that several sophisticated
adaptive
responses such as sporulation and competence are also
available
to
B. subtilis, the role of the
B
regulon may have been further diminished to accommodate these
pathways.
Thus, in organisms, such as
L. monocytogenes, that do
not
possess such sophisticated adaptive responses,
B may
serve a primary role in coordinating responses to physical
changes in
the environment. Further comparative studies of the
B
regulon from related gram-positive organisms would therefore
provide
important information about the role of adaptive responses
in the
physiology and ecology of these organisms.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from Li-Cor, Inc., and from the
USDA Midwest Advanced Food Manufacturing Alliance to A.K.B. L.A.B. is a
recipient of the Widaman Trust Distinguished Graduate Assistant
Fellowship.
We thank Abraham Oommen and Margaret Esser for performing the DNA
sequence analysis and Mark Morrison and Jeff Cirillo for critical
reading of the manuscript.
L. A. Becker and M. S. Çetin contributed equally to
this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Food Science and Technology, 358 Food Industry Complex, University of Nebraska, Lincoln, NE 68583-0919. Phone: (402) 472-5637. Fax: (402)
472-1693. E-mail: abenson{at}foodsci.unl.edu.
Journal Series paper 12219 of the Nebraska Agricultural
Experimental Station.
 |
REFERENCES |
| 1.
|
Akbar, S.,
C. M. Kang,
T. A. Gaidenko, and C. W. Price.
1997.
Modulator protein RsbR regulates environmental signalling in the general stress pathway of Bacillus subtilis.
Mol. Microbiol.
24:567-578[Medline].
|
| 2.
|
Alper, S.,
L. Duncan, and R. Losick.
1994.
An adenosine nucleotide switch controlling the activity of a cell type-specific transcription factor in Bacillus subtilis.
Cell
77:195-205[Medline].
|
| 3.
|
Antelmann, H.,
J. Bernhardt,
R. Schmid, and M. Hecker.
1995.
A gene at 333° on the Bacillus subtilis chromosome encodes the newly identified B-dependent general stress protein GspA.
J. Bacteriol.
177:3540-3545[Abstract/Free Full Text].
|
| 4.
| Becker, L. A., and A. K. Benson. 1998. Unpublished data.
|
| 5.
|
Benson, A. K., and W. G. Haldenwang.
1992.
Characterization of a regulatory network that controls B expression in Bacillus subtilis.
J. Bacteriol.
174:749-757[Abstract/Free Full Text].
|
| 6.
|
Benson, A. K., and W. G. Haldenwang.
1993.
Bacillus subtilis B is regulated by a binding protein (RsbW) that blocks its association with core RNA polymerase.
Proc. Natl. Acad. Sci. USA
90:2330-2334[Abstract/Free Full Text].
|
| 7.
|
Benson, A. K., and W. G. Haldenwang.
1993.
The B-dependent promoter of the Bacillus subtilis sigB operon is induced by heat shock.
J. Bacteriol.
175:1929-1935[Abstract/Free Full Text].
|
| 8.
|
Benson, A. K., and W. G. Haldenwang.
1993.
Regulation of B levels and activity in Bacillus subtilis.
J. Bacteriol.
175:2347-2356[Abstract/Free Full Text].
|
| 9.
|
Beumer, R. R.,
M. C. Te Giffel,
L. J. Cox,
F. M. Rombouts, and T. Abee.
1994.
Effect of exogenous proline, betaine, and carnitine on growth of Listeria monocytogenes in a minimal medium.
Appl. Environ. Microbiol.
60:1359-1363[Abstract/Free Full Text].
|
| 10.
|
Binne, C.,
M. Lampe, and R. Losick.
1986.
Gene encoding the 37 species of RNA polymerase factor from Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
83:5943-5947[Abstract/Free Full Text].
|
| 11.
|
Boylan, S. A.,
A. R. Redfield, and C. W. Price.
1993.
Transcription factor B of Bacillus subtilis controls a large stationary-phase regulon.
J. Bacteriol.
175:3957-3963[Abstract/Free Full Text].
|
| 12.
|
Boylan, S. A.,
A. Rutherford,
S. M. Thomas, and C. W. Price.
1992.
Activation of Bacillus subtilis transcription factor B by a regulatory pathway responsive to stationary-phase signals.
J. Bacteriol.
174:3695-3706[Abstract/Free Full Text].
|
| 13.
|
Boylan, S. A.,
A. Rutherford,
S. M. Thomas, and C. W. Price.
1993.
Stress-induced activation of the B transcription factor of Bacillus subtilis.
J. Bacteriol.
175:7931-7937[Abstract/Free Full Text].
|
| 14.
|
Camilli, A.,
D. A. Portnoy, and P. Youngman.
1990.
Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions.
J. Bacteriol.
172:3738-3744[Abstract/Free Full Text].
|
| 15.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 16.
|
Christensen, D. P., and R. W. Hutkins.
1994.
Glucose uptake by Listeria monocytogenes Scott A and inhibition by pediocin JD.
Appl. Environ. Microbiol.
60:3870-3873[Abstract/Free Full Text].
|
| 17.
|
Diederich, B.,
J. F. Wilkinson,
T. Magnin,
M. Najafi,
J. Errington, and M. D. Yudkin.
1994.
Role of interactions between SpoIIAA and SpoIIAB in regulating cell-specific transcription factor sigma F of Bacillus subtilis.
Genes Dev.
8:2653-2663[Abstract/Free Full Text].
|
| 18.
|
Dufour, A., and W. G. Haldenwang.
1994.
Interactions between a Bacillus subtilis anti-sigma factor (RsbW) and its antagonist (RsbV).
J. Bacteriol.
176:1813-1820[Abstract/Free Full Text].
|
| 19.
|
Engelmann, S., and M. Hecker.
1996.
Impaired oxidative stress resistance of Bacillus subtilis sigB mutants and the role of katA and katE.
FEMS Microbiol. Lett.
145:63-69[Medline].
|
| 20.
|
Englemann, S.,
C. Linder, and M. Hecker.
1995.
Cloning, nucleotide sequence, and regulation of katE encoding a B-dependent catalase in Bacillus subtilis.
J. Bacteriol.
177:5598-5605[Abstract/Free Full Text].
|
| 21.
|
Farber, J. M., and B. E. Brown.
1990.
Effect of prior heat shock on heat resistance of Listeria monocytogenes in meat.
Appl. Environ. Microbiol.
56:1584-1587[Abstract/Free Full Text].
|
| 22.
|
Farber, J. M., and P. I. Peterkin.
1991.
Listeria monocytogenes, a food-borne pathogen.
Microbiol. Rev.
55:476-511[Abstract/Free Full Text].
|
| 23.
|
Finlay, B. B., and P. Cossart.
1997.
Exploitation of mammalian host cell functions by bacterial pathogens.
Science
276:718-725[Abstract/Free Full Text].
|
| 24.
|
Gellin, B., and C. Broome.
1989.
Listeriosis.
JAMA
261:1313-1320[Abstract/Free Full Text].
|
| 25.
|
Gerhardt, P. N.,
L. T. Smith, and G. M. Smith.
1996.
Sodium-driven, osmotically activated glycine betaine transport in Listeria monocytogenes membrane vesicles.
J. Bacteriol.
178:6105-6109[Abstract/Free Full Text].
|
| 26.
|
Guerout-Fleury, A.-M.,
K. Shazand,
N. Frandsen, and P. Stragier.
1995.
Antibiotic-resistance cassettes for Bacillus subtilis.
Gene
167:335-337[Medline].
|
| 27.
|
Helman, J. D., and M. J. Chamberlin.
1988.
Structure and function of bacterial sigma factors.
Annu. Rev. Biochem.
57:839-872[Medline].
|
| 28.
|
Kalman, S.,
M. L. Duncan,
S. M. Thomas, and C. W. Price.
1990.
Similar organization of the sigB and spoIIA operons encoding alternate sigma factors of Bacillus subtilis.
J. Bacteriol.
172:5575-5585[Abstract/Free Full Text].
|
| 29.
|
Kang, C. M.,
M. S. Brody,
S. Akbar,
X. Yang, and C. W. Price.
1996.
Homologous pairs of regulatory proteins control activity of Bacillus subtilis transcription factor B in response to environmental stress.
J. Bacteriol.
178:3846-3853[Abstract/Free Full Text].
|
| 30.
|
Kappes, R. M.,
B. Kempf, and E. Bremer.
1996.
Three transport systems for the osmoprotectant glycine betaine operate in Bacillus subtilis: characterization of OpuD.
J. Bacteriol.
178:5071-5079[Abstract/Free Full Text].
|
| 31.
|
Ko, R.,
L. T. Smith, and G. M. Smith.
1994.
Glycine betaine confers enhanced osmotolerance and cryotolerance on Listeria monocytogenes.
J. Bacteriol.
176:426-431[Abstract/Free Full Text].
|
| 32.
|
Kroll, R. G., and P. A. Patchett.
1992.
Induced acid tolerance in Listeria monocytogenes.
Lett. Appl. Microbiol.
14:224-227.
|
| 33.
|
Krüger, E.,
T. Msadek, and M. Hecker.
1996.
Alternate promoters direct stress-induced transcription of the Bacillus subtilis clpC operon.
Mol. Microbiol.
20:713-723[Medline].
|
| 34.
|
Kullik, I., and P. Giachino.
1997.
The alternative sigma factor B in Staphylococcus aureus: regulation of the sigB operon in response to growth phase and heat shock.
Arch. Microbiol.
167:151-159[Medline].
|
| 35.
|
Marron, L.,
N. Emerson,
C. G. Gahan, and C. Hill.
1997.
A mutant of Listeria monocytogenes LO28 unable to induce an acid tolerance response displays diminished virulence in a murine model.
Appl. Environ. Microbiol.
63:4945-4947[Abstract].
|
| 36.
|
Miller, A. J.
1992.
Combined water activity and solute effects on growth and survival of Listeria monocytogenes Scott A.
J. Food Prot.
55:414-418.
|
| 37.
|
Min, K.-T.,
C. M. Hilditch,
B. Diedrich,
J. Errington, and M. D. Yudkin.
1993.
F, the first compartment-specific transcription factor of Bacillus subtilis, is regulated by an anti-sigma factor that is also a protein kinase.
Cell
74:735-742[Medline].
|
| 38.
|
Najafi, S. M.,
A. C. Willis, and M. D. Yudkin.
1995.
Site of phosphorylation of SpoIIAA, the anti-anti-sigma factor for sporulation-specific sigma F of Bacillus subtilis.
J. Bacteriol.
177:2912-2913[Abstract/Free Full Text].
|
| 39.
|
Pine, L.,
G. B. Malcom,
J. B. Brooks, and M. I. Daneshvar.
1989.
Physiological studies on the growth and utilization of sugars by Listeria species.
Can. J. Microbiol.
35:245-254[Medline].
|
| 40.
|
Portnoy, D. A.,
T. Chakraborty,
W. Goebel, and P. Cossart.
1992.
Molecular determinants of Listeria monocytogenes pathogenesis.
Infect. Immun.
60:1263-1267[Free Full Text].
|
| 41.
|
Roberts, T., and R. Pinner.
1990.
Economic impact of disease caused by Listeria monocytogenes, p. 137-149.
In
A. J. Miller, J. L. Smith, and G. A. Somkuti (ed.), Foodborne listeriosis. Elsevier Science Publishing Co., Inc., Amsterdam, The Netherlands.
|
| 42.
|
Rouquette, C.,
M. T. Ripio,
E. Pellegrini,
J. M. Bolla,
R. I. Tascon,
J. A. Vázquez-Boland, and P. Berche.
1996.
Identification of a ClpC ATPase required for stress tolerance and in vivo survival of Listeria monocytogenes.
Mol. Microbiol.
21:977-987[Medline].
|
| 43.
|
Sheehan, B.,
C. Kocks,
S. Dramsi,
E. Gouin,
A. D. Klarsfield,
J. Mengaud, and P. Cossart.
1994.
Molecular and genetic determinants of the Listeria monocytogenes infectious process.
Curr. Top. Microbiol. Immunol.
192:187-216[Medline].
|
| 44.
|
Smith, K., and P. Youngman.
1992.
Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene.
Biochimie
74:705-711[Medline].
|
| 45.
|
Smith, L. T.
1996.
Role of osmolytes in adaptation of osmotically stressed and chill-stressed Listeria monocytogenes grown in liquid media and on processed meat surfaces.
Appl. Environ. Microbiol.
62:3088-3093[Abstract].
|
| 46.
|
Varón, D.,
S. A. Boylan,
K. Okamoto, and C. W. Price.
1993.
Bacillus subtilis gtaB encodes UDP-glucose pyrophosphorylase and is controlled by stationary-phase transcription factor B.
J. Bacteriol.
175:3964-3971[Abstract/Free Full Text].
|
| 47.
|
Varón, D.,
M. S. Brody, and C. W. Price.
1996.
Bacillus subtilis operon under the dual control of the general stress transcription factor B and the sporulation transcription factor H.
Mol. Microbiol.
20:339-350[Medline].
|
| 48.
|
Verheul, A.,
E. Glaasker,
B. Poolman, and T. Abee.
1997.
Betaine and L-carnitine transport by Listeria monocytogenes Scott A in response to osmotic signals.
J. Bacteriol.
179:6979-6985[Abstract/Free Full Text].
|
| 49.
|
Verheul, A.,
F. M. Rombouts,
R. R. Beumer, and T. Abee.
1995.
An ATP-dependent L-carnitine transporter in Listeria monocytogenes is involved in osmoprotection.
J. Bacteriol.
177:3205-3212[Abstract/Free Full Text].
|
| 50.
|
Voelker, U.,
A. Dufour, and W. G. Haldenwang.
1995.
The Bacillus subtilis rsbU gene product is necessary for RsbX-dependent regulation of B.
J. Bacteriol.
177:114-122[Abstract/Free Full Text].
|
| 51.
|
Voelker, U.,
A. Voelker,
B. Maul,
M. Hecker,
A. Dufour, and W. G. Haldenwang.
1995.
Separate mechanisms activate B of Bacillus subtilis in response to environmental and metabolic stress.
J. Bacteriol.
177:3771-3780[Abstract/Free Full Text].
|
| 52.
|
Völker, U.,
S. Engelmann,
B. Maul,
S. Riethdorf,
A. Völker,
R. Schmid,
H. Mach, and M. Hecker.
1994.
Analysis of the induction of general stress proteins of Bacillus subtilis.
Microbiology
140:741-752[Abstract/Free Full Text].
|
| 53.
|
Von Blohn, C.,
B. Kempf,
R. M. Kappes, and E. Bremer.
1997.
Osmostress response in Bacillus subtilis: characterization of a proline uptake system (OpuE) regulated by high osmolarity and the alternative transcription factor sigma B.
Mol. Microbiol.
25:175-187[Medline].
|
| 54.
|
Waite, B. L.,
G. R. Siragusa, and R. W. Hutkins.
1998.
Bacteriocin inhibition of two glucose transport systems in Listeria monocytogenes.
J. Appl. Microbiol.
84:715-721[Medline].
|
| 55.
|
Wilkins, P. O.,
R. Bourgeois, and R. G. E. Murray.
1972.
Psychrotrophic properties of Listeria monocytogenes.
Can. J. Microbiol.
18:543-551[Medline].
|
| 56.
|
Wise, A. A., and C. W. Price.
1995.
Four additional genes in the sigB operon of Bacillus subtilis that control activity of the general stress factor B in response to environmental signals.
J. Bacteriol.
177:123-133[Abstract/Free Full Text].
|
| 57.
|
Wu, S.,
H. de Lencastre, and A. Tomasz.
1996.
Sigma-B, a putative operon encoding alternate sigma factor of Staphylococcus aureus RNA polymerase: molecular cloning and DNA sequencing.
J. Bacteriol.
178:6036-6042[Abstract/Free Full Text].
|
| 58.
|
Yang, X.,
C. M. Kang,
M. S. Brody, and C. W. Price.
1996.
Opposing pairs of serine protein kinases and phosphatases transmit signals of environmental stress to activate a bacterial transcription factor.
Genes Dev.
10:2265-2275[Abstract/Free Full Text].
|
J Bacteriol, September 1998, p. 4547-4554, Vol. 180, No. 17
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ollinger, J., Bowen, B., Wiedmann, M., Boor, K. J., Bergholz, T. M.
(2009). Listeria monocytogenes {sigma}B Modulates PrfA-Mediated Virulence Factor Expression. Infect. Immun.
77: 2113-2124
[Abstract]
[Full Text]
-
Abram, F., Starr, E., Karatzas, K. A. G., Matlawska-Wasowska, K., Boyd, A., Wiedmann, M., Boor, K. J., Connally, D., O'Byrne, C. P.
(2008). Identification of Components of the Sigma B Regulon in Listeria monocytogenes That Contribute to Acid and Salt Tolerance. Appl. Environ. Microbiol.
74: 6848-6858
[Abstract]
[Full Text]
-
Abram, F., Su, W.-L., Wiedmann, M., Boor, K. J., Coote, P., Botting, C., Karatzas, K. A. G., O'Byrne, C. P.
(2008). Proteomic Analyses of a Listeria monocytogenes Mutant Lacking {sigma}B Identify New Components of the {sigma}B Regulon and Highlight a Role for {sigma}B in the Utilization of Glycerol. Appl. Environ. Microbiol.
74: 594-604
[Abstract]
[Full Text]
-
Raengpradub, S., Wiedmann, M., Boor, K. J.
(2008). Comparative Analysis of the {sigma}B-Dependent Stress Responses in Listeria monocytogenes and Listeria innocua Strains Exposed to Selected Stress Conditions. Appl. Environ. Microbiol.
74: 158-171
[Abstract]
[Full Text]
-
Hu, Y., Raengpradub, S., Schwab, U., Loss, C., Orsi, R. H., Wiedmann, M., Boor, K. J.
(2007). Phenotypic and Transcriptomic Analyses Demonstrate Interactions between the Transcriptional Regulators CtsR and Sigma B in Listeria monocytogenes. Appl. Environ. Microbiol.
73: 7967-7980
[Abstract]
[Full Text]
-
Hu, Y., Oliver, H. F., Raengpradub, S., Palmer, M. E., Orsi, R. H., Wiedmann, M., Boor, K. J.
(2007). Transcriptomic and Phenotypic Analyses Suggest a Network between the Transcriptional Regulators HrcA and {sigma}B in Listeria monocytogenes. Appl. Environ. Microbiol.
73: 7981-7991
[Abstract]
[Full Text]
-
Chan, Y. C., Boor, K. J., Wiedmann, M.
(2007). {sigma}B-Dependent and {sigma}B-Independent Mechanisms Contribute to Transcription of Listeria monocytogenes Cold Stress Genes during Cold Shock and Cold Growth. Appl. Environ. Microbiol.
73: 6019-6029
[Abstract]
[Full Text]
-
McGann, P., Ivanek, R., Wiedmann, M., Boor, K. J.
(2007). Temperature-Dependent Expression of Listeria monocytogenes Internalin and Internalin-Like Genes Suggests Functional Diversity of These Proteins among the Listeriae. Appl. Environ. Microbiol.
73: 2806-2814
[Abstract]
[Full Text]
-
Chaturongakul, S., Boor, K. J.
(2006). {sigma}B Activation under Environmental and Energy Stress Conditions in Listeria monocytogenes. Appl. Environ. Microbiol.
72: 5197-5203
[Abstract]
[Full Text]
-
Garner, M. R., James, K. E., Callahan, M. C., Wiedmann, M., Boor, K. J.
(2006). Exposure to Salt and Organic Acids Increases the Ability of Listeria monocytogenes To Invade Caco-2 Cells but Decreases Its Ability To Survive Gastric Stress. Appl. Environ. Microbiol.
72: 5384-5395
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Wiedmann, M., Boor, K. J.
(2006). Contributions of Listeria monocytogenes {sigma}B and PrfA to expression of virulence and stress response genes during extra- and intracellular growth. Microbiology
152: 1827-1838
[Abstract]
[Full Text]
-
Gray, M. J., Freitag, N. E., Boor, K. J.
(2006). How the Bacterial Pathogen Listeria monocytogenes Mediates the Switch from Environmental Dr. Jekyll to Pathogenic Mr. Hyde.. Infect. Immun.
74: 2505-2512
[Full Text]
-
Begley, M., Hill, C., Ross, R. P.
(2006). Tolerance of Listeria monocytogenes to Cell Envelope-Acting Antimicrobial Agents Is Dependent on SigB.. Appl. Environ. Microbiol.
72: 2231-2234
[Abstract]
[Full Text]
-
Roberts, A., Nightingale, K., Jeffers, G., Fortes, E., Kongo, J. M., Wiedmann, M.
(2006). Genetic and phenotypic characterization of Listeria monocytogenes lineage III.. Microbiology
152: 685-693
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Wiedmann, M., Boor, K. J.
(2005). Alternative Sigma Factors and Their Roles in Bacterial Virulence. Microbiol. Mol. Biol. Rev.
69: 527-543
[Abstract]
[Full Text]
-
Zhang, C., Nietfeldt, J., Zhang, M., Benson, A. K.
(2005). Functional Consequences of Genome Evolution in Listeria monocytogenes: the lmo0423 and lmo0422 Genes Encode {sigma}C and LstR, a Lineage II-Specific Heat Shock System. J. Bacteriol.
187: 7243-7253
[Abstract]
[Full Text]
-
Gravesen, A., Lekkas, C., Knochel, S.
(2005). Surface Attachment of Listeria monocytogenes Is Induced by Sublethal Concentrations of Alcohol at Low Temperatures. Appl. Environ. Microbiol.
71: 5601-5603
[Abstract]
[Full Text]
-
Begley, M., Sleator, R. D., Gahan, C. G. M., Hill, C.
(2005). Contribution of Three Bile-Associated Loci, bsh, pva, and btlB, to Gastrointestinal Persistence and Bile Tolerance of Listeria monocytogenes. Infect. Immun.
73: 894-904
[Abstract]
[Full Text]
-
Rauch, M., Luo, Q., Muller-Altrock, S., Goebel, W.
(2005). SigB-Dependent In Vitro Transcription of prfA and Some Newly Identified Genes of Listeria monocytogenes Whose Expression Is Affected by PrfA In Vivo. J. Bacteriol.
187: 800-804
[Abstract]
[Full Text]
-
Lee, E.-J., Cho, Y.-H., Kim, H.-S., Ahn, B.-E., Roe, J.-H.
(2004). Regulation of {sigma}B by an Anti- and an Anti-Anti-Sigma Factor in Streptomyces coelicolor in Response to Osmotic Stress. J. Bacteriol.
186: 8490-8498
[Abstract]
[Full Text]
-
Kim, H., Boor, K. J., Marquis, H.
(2004). Listeria monocytogenes {sigma}B Contributes to Invasion of Human Intestinal Epithelial Cells. Infect. Immun.
72: 7374-7378
[Abstract]
[Full Text]
-
Sue, D., Fink, D., Wiedmann, M., Boor, K. J.
(2004). {sigma}B-dependent gene induction and expression in Listeria monocytogenes during osmotic and acid stress conditions simulating the intestinal environment. Microbiology
150: 3843-3855
[Abstract]
[Full Text]
-
Chaturongakul, S., Boor, K. J.
(2004). RsbT and RsbV Contribute to {sigma}B-Dependent Survival under Environmental, Energy, and Intracellular Stress Conditions in Listeria monocytogenes. Appl. Environ. Microbiol.
70: 5349-5356
[Abstract]
[Full Text]
-
Roth, V., Aigle, B., Bunet, R., Wenner, T., Fourrier, C., Decaris, B., Leblond, P.
(2004). Differential and Cross-Transcriptional Control of Duplicated Genes Encoding Alternative Sigma Factors in Streptomyces ambofaciens. J. Bacteriol.
186: 5355-5365
[Abstract]
[Full Text]
-
van Schaik, W., Zwietering, M. H., de Vos, W. M., Abee, T.
(2004). Identification of {sigma}B-Dependent Genes in Bacillus cereus by Proteome and In Vitro Transcription Analysis. J. Bacteriol.
186: 4100-4109
[Abstract]
[Full Text]
-
Wemekamp-Kamphuis, H. H., Wouters, J. A., de Leeuw, P. P. L. A., Hain, T., Chakraborty, T., Abee, T.
(2004). Identification of Sigma Factor {sigma}B-Controlled Genes and Their Impact on Acid Stress, High Hydrostatic Pressure, and Freeze Survival in Listeria monocytogenes EGD-e. Appl. Environ. Microbiol.
70: 3457-3466
[Abstract]
[Full Text]
-
Christiansen, J. K., Larsen, M. H., Ingmer, H., Sogaard-Andersen, L., Kallipolitis, B. H.
(2004). The RNA-Binding Protein Hfq of Listeria monocytogenes: Role in Stress Tolerance and Virulence. J. Bacteriol.
186: 3355-3362
[Abstract]
[Full Text]
-
Wemekamp-Kamphuis, H. H., Sleator, R. D., Wouters, J. A., Hill, C., Abee, T.
(2004). Molecular and Physiological Analysis of the Role of Osmolyte Transporters BetL, Gbu, and OpuC in Growth of Listeria monocytogenes at Low Temperatures. Appl. Environ. Microbiol.
70: 2912-2918
[Abstract]
[Full Text]
-
Cetin, M. S., Zhang, C., Hutkins, R. W., Benson, A. K.
(2004). Regulation of Transcription of Compatible Solute Transporters by the General Stress Sigma Factor, {sigma}B, in Listeria monocytogenes. J. Bacteriol.
186: 794-802
[Abstract]
[Full Text]
-
van Schaik, W., Tempelaars, M. H., Wouters, J. A., de Vos, W. M., Abee, T.
(2004). The Alternative Sigma Factor {sigma}B of Bacillus cereus: Response to Stress and Role in Heat Adaptation. J. Bacteriol.
186: 316-325
[Abstract]
[Full Text]
-
Sue, D., Boor, K. J., Wiedmann, M.
(2003). {sigma}B-dependent expression patterns of compatible solute transporter genes opuCA and lmo1421 and the conjugated bile salt hydrolase gene bsh in Listeria monocytogenes. Microbiology
149: 3247-3256
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Mithoe, S. C., Boor, K. J., Wiedmann, M.
(2003). Listeria monocytogenes {sigma}B Regulates Stress Response and Virulence Functions. J. Bacteriol.
185: 5722-5734
[Abstract]
[Full Text]
-
Cotter, P. D., Hill, C.
(2003). Surviving the Acid Test: Responses of Gram-Positive Bacteria to Low pH. Microbiol. Mol. Biol. Rev.
67: 429-453
[Abstract]
[Full Text]
-
Brigulla, M., Hoffmann, T., Krisp, A., Volker, A., Bremer, E., Volker, U.
(2003). Chill Induction of the SigB-Dependent General Stress Response in Bacillus subtilis and Its Contribution to Low-Temperature Adaptation. J. Bacteriol.
185: 4305-4314
[Abstract]
[Full Text]
-
Gardan, R., Cossart, P., The European Listeria Genome Consortium,, , Labadie, J.
(2003). Identification of Listeria monocytogenes Genes Involved in Salt and Alkaline-pH Tolerance. Appl. Environ. Microbiol.
69: 3137-3143
[Abstract]
[Full Text]
-
Ferreira, A., Sue, D., O'Byrne, C. P., Boor, K. J.
(2003). Role of Listeria monocytogenes{sigma}B in Survival of Lethal Acidic Conditions and in the Acquired Acid Tolerance Response. Appl. Environ. Microbiol.
69: 2692-2698
[Abstract]
[Full Text]
-
Fraser, K. R., Sue, D., Wiedmann, M., Boor, K., O'Byrne, C. P.
(2003). Role of {sigma}B in Regulating the Compatible Solute Uptake Systems of Listeria monocytogenes: Osmotic Induction of opuC Is {sigma}B Dependent. Appl. Environ. Microbiol.
69: 2015-2022
[Abstract]
[Full Text]
-
Sleator, R. D., Gahan, C. G. M., Hill, C.
(2003). A Postgenomic Appraisal of Osmotolerance in Listeria monocytogenes. Appl. Environ. Microbiol.
69: 1-9
[Full Text]
-
Gardan, R., Duche, O., Leroy-Setrin, S., the European Listeria Genome Consortium,, , Labadie, J.
(2003). Role of ctc from Listeria monocytogenes in Osmotolerance. Appl. Environ. Microbiol.
69: 154-161
[Abstract]
[Full Text]
-
Wemekamp-Kamphuis, H. H., Wouters, J. A., Sleator, R. D., Gahan, C. G. M., Hill, C., Abee, T.
(2002). Multiple Deletions of the Osmolyte Transporters BetL, Gbu, and OpuC of Listeria monocytogenes Affect Virulence and Growth at High Osmolarity. Appl. Environ. Microbiol.
68: 4710-4716
[Abstract]
[Full Text]
-
Nadon, C. A., Bowen, B. M., Wiedmann, M., Boor, K. J.
(2002). Sigma B Contributes to PrfA-Mediated Virulence in Listeria monocytogenes. Infect. Immun.
70: 3948-3952
[Abstract]
[Full Text]
-
Okada, Y., Makino, S.-i., Tobe, T., Okada, N., Yamazaki, S.
(2002). Cloning of rel from Listeria monocytogenes as an Osmotolerance Involvement Gene. Appl. Environ. Microbiol.
68: 1541-1547
[Abstract]
[Full Text]
-
Rince, A., Uguen, M., Le Breton, Y., Giard, J.-C., Flahaut, S., Dufour, A., Auffray, Y.
(2002). The Enterococcus faecalis gene encoding the novel general stress protein Gsp62. Microbiology
148: 703-711
[Abstract]
[Full Text]
-
Ferreira, A., O'Byrne, C. P., Boor, K. J.
(2001). Role of {sigma}B in Heat, Ethanol, Acid, and Oxidative Stress Resistance and during Carbon Starvation in Listeria monocytogenes. Appl. Environ. Microbiol.
67: 4454-4457
[Abstract]
[Full Text]
-
Herbert, K. C., Foster, S. J.
(2001). Starvation survival in Listeria monocytogenes: characterization of the response and the role of known and novel components. Microbiology
147: 2275-2284
[Abstract]
[Full Text]
-
Vazquez-Boland, J. A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G., Goebel, W., Gonzalez-Zorn, B., Wehland, J., Kreft, J.
(2001). Listeria Pathogenesis and Molecular Virulence Determinants. Clin. Microbiol. Rev.
14: 584-640
[Abstract]
[Full Text]
-
Knobloch, J. K.-M., Bartscht, K., Sabottke, A., Rohde, H., Feucht, H.-H., Mack, D.
(2001). Biofilm Formation by Staphylococcus epidermidis Depends on Functional RsbU, an Activator of the sigB Operon: Differential Activation Mechanisms Due to Ethanol and Salt Stress. J. Bacteriol.
183: 2624-2633
[Abstract]
[Full Text]
-
Gertz, S., Engelmann, S., Schmid, R., Ziebandt, A.-K., Tischer, K., Scharf, C., Hacker, J., Hecker, M.
(2000). Characterization of the sigma B Regulon in Staphylococcus aureus. J. Bacteriol.
182: 6983-6991
[Abstract]
[Full Text]
-
Becker, L. A., Evans, S. N., Hutkins, R. W., Benson, A. K.
(2000). Role of sigma B in Adaptation of Listeria monocytogenes to Growth at Low Temperature. J. Bacteriol.
182: 7083-7087
[Abstract]
[Full Text]
-
Fraser, K. R., Harvie, D., Coote, P. J., O'Byrne, C. P.
(2000). Identification and Characterization of an ATP Binding Cassette L-Carnitine Transporter in Listeria monocytogenes. Appl. Environ. Microbiol.
66: 4696-4704
[Abstract]
[Full Text]
-
Chen, P., Ruiz, R. E., Li, Q., Silver, R. F., Bishai, W. R.
(2000). Construction and Characterization of a Mycobacterium tuberculosis Mutant Lacking the Alternate Sigma Factor Gene, sigF. Infect. Immun.
68: 5575-5580
[Abstract]
[Full Text]
-
Fouet, A., Namy, O., Lambert, G.
(2000). Characterization of the Operon Encoding the Alternative sigma B Factor from Bacillus anthracis and Its Role in Virulence. J. Bacteriol.
182: 5036-5045
[Abstract]
[Full Text]
-
Varmanen, P., Ingmer, H., Vogensen, F. K.
(2000). ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology
146: 1447-1455
[Abstract]
[Full Text]
-
Wouters, J. A., Jeynov, B., Rombouts, F. M., de Vos, W. M., Kuipers, O. P., Abee, T.
(1999). Analysis of the role of 7 kDa cold-shock proteins of Lactococcus lactis MG1363 in cryoprotection. Microbiology
145: 3185-3194
[Abstract]
[Full Text]
-
Ko, R., Smith, L. T.
(1999). Identification of an ATP-Driven, Osmoregulated Glycine Betaine Transport System in Listeria monocytogenes. Appl. Environ. Microbiol.
65: 4040-4048
[Abstract]
[Full Text]
-
Morse, R., O'Hanlon, K., Virji, M., Collins, M. D.
(1999). Isolation of Rifampin-Resistant Mutants of Listeria monocytogenes and Their Characterization by rpoB Gene Sequencing, Temperature Sensitivity for Growth, and Interaction with an Epithelial Cell Line. J. Clin. Microbiol.
37: 2913-2919
[Abstract]
[Full Text]
-
Völker, U., Maul, B., Hecker, M.
(1999). Expression of the sigma B-Dependent General Stress Regulon Confers Multiple Stress Resistance in Bacillus subtilis. J. Bacteriol.
181: 3942-3948
[Abstract]
[Full Text]
-
Sleator, R. D., Gahan, C. G. M., Abee, T., Hill, C.
(1999). Identification and Disruption of BetL, a Secondary Glycine Betaine Transport System Linked to the Salt Tolerance of Listeria monocytogenes LO28. Appl. Environ. Microbiol.
65: 2078-2083
[Abstract]
[Full Text]
-
Miyazaki, E., Chen, J.-M., Ko, C., Bishai, W. R.
(1999). The Staphylococcus aureus rsbW (orf159) Gene Encodes an Anti-Sigma Factor of SigB. J. Bacteriol.
181: 2846-2851
[Abstract]
[Full Text]