Previous Article | Next Article 
Journal of Bacteriology, September 1998, p. 4644-4649, Vol. 180, No. 17
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Expression of glnB and a
glnB-Like Gene (glnK) in a Ribulose Bisphosphate
Carboxylase/Oxygenase-Deficient Mutant of Rhodobacter
sphaeroides
Yilei
Qian1 and
F. Robert
Tabita1,2,*
The Biochemistry
Program1 and The
Department of
Microbiology and Plant Molecular Biology/Biotechnology
Program,2 The Ohio State University,
Columbus, Ohio 43210-1292
Received 2 February 1998/Accepted 18 June 1998
 |
ABSTRACT |
In a ribulose 1,5-bisphosphate carboxylase/oxygenase
(RubisCO)-deficient mutant of Rhodobacter sphaeroides,
strain 16PHC, nitrogenase activity was derepressed in the presence of
ammonia under photoheterotrophic growth conditions. Previous studies
also showed that reintroduction of a functional RubisCO and
Calvin-Benson-Bassham (CBB) pathway suppressed the deregulation of
nitrogenase synthesis in this strain. In this study, the derepression
of nitrogenase synthesis in the presence of ammonia in strain 16PHC was
further explored by using a
glnB::lacZ fusion, since the product
of the glnB gene is known to have a negative effect on
ammonia-regulated nif control. It was found that
glnB expression was repressed in strain 16PHC under
photoheterotrophic growth conditions with either ammonia or glutamate
as the nitrogen source; glutamine synthetase (GS) levels were also
affected in this strain. However, when cells regained a functional CBB
pathway by trans complementation of the deleted genes,
wild-type levels of GS and glnB expression were
restored. Furthermore, a glnB-like gene,
glnK, was isolated from this organism, and its expression
was found to be under tight nitrogen control in the wild type.
Surprisingly, glnK expression was found to be derepressed
in strain 16PHC under photoheterotrophic conditions in the presence of
ammonia.
 |
INTRODUCTION |
Strain 16 of the nonsulfur purple
photosynthetic bacterium Rhodobacter sphaeroides, a
ribulose bisphosphate carboxylase/oxygenase (RubisCO)-deficient mutant,
is devoid of a functional Calvin-Benson-Bassham (CBB) reductive pentose
pathway (10). Under photoheterotrophic growth conditions,
the CBB pathway is normally employed to balance the redox potential of
the cell, with CO2 serving as the major electron sink
(25, 35). Thus, an alternative electron acceptor, such as
dimethyl sulfoxide (DMSO), is required for photoheterotrophic growth of
strain 16 in order to dispose of excess reducing equivalents generated
from carbon (malate in this case) photometabolism (25, 35).
However, strain 16PHC, a spontaneous mutant derived from strain 16, exhibits the ability to grow under photoheterotrophic conditions
without the addition of DMSO (35) and is believed to have
developed an alternative redox balancing mechanism in the absence of
the CBB pathway under photoheterotrophic growth conditions. This strain
produces copious hydrogen gas when grown under these conditions. In
this and similar CBB pathway-defective mutants derived from
Rhodobacter capsulatus (26) and
Rhodospirillum rubrum (19), derepression of
nitrogenase synthesis was observed, even though high concentrations of
extracellular ammonia were present (19, 28). Therefore, it
is believed that the reduction of protons by the nitrogenase enzyme
complex under photoheterotrophic conditions in the presence of ammonia
serves as an alternative redox-balancing mechanism in strain 16PHC. The
acquisition of the capacity for hydrogen evolution presumably renders
this strain capable of photoheterotrophic growth in the absence of a
functional CBB pathway and precludes the need for exogenous electron
acceptors, such as DMSO. It was recently established (28)
that the nif-encoded nitrogenase, and probably not
alternative nitrogenases, is required for optimal photoheterotrophic
growth of strain 16PHC. Moreover, nifH transcription was
only partially derepressed in strain 16PHC in the presence of ammonia,
with deregulation suppressed when cells regained a
functional CBB pathway after trans complementation of
the missing cbb genes. These results suggest that the
mutation in strain 16PHC is of a regulatory nature and has a
pleiotropic effect on cellular metabolism. It is thus proposed that
there is a molecular link between the cbb and nif
systems and that the mutation in strain 16PHC might affect the
nitrogen-regulatory cascade (28).
The PII protein, the product of the glnB gene,
plays a central role in the signal transduction cascade of
nitrogen-regulatory systems in prokaryotes (9, 15, 17, 20).
In Escherichia coli, signals influencing the cellular N
status are transmitted through the
PII-adenylyltransferase-glutamine synthetase pathway to rapidly influence glutamine synthetase (GS) enzyme activity by
adenylylation or deadenylylation of the protein (9). In addition, the PII-NtrBC cascade regulates the synthesis
of GS (reference 34 and references therein). In some
diazotrophic organisms, signal transduction through PII
could also be demonstrated at the level of nif
transcription. However, in Azospirillum
brasilense, a glnB null mutation caused a
Nif
phenotype (7, 22), while in
Rhizobium leguminosarum, a glnB mutation did not
seem to have any effect on nif expression yet the
ntr system was influenced (1). In another
purple nonsulfur photosynthetic bacterium, R. capsulatus, an organism closely related to R. sphaeroides, point mutations in the glnB gene
caused nif derepression in the presence of ammonia
(Nifc phenotype) (21). A Nifc
mutant was also reported for R. sphaeroides: it is
caused by a mutation in the glnA gene, which forms an operon
and is cotranscribed with glnB (39), as in many
other nitrogen-fixing organisms (1, 7, 18, 21).
Previous studies of the R. sphaeroides glnBA operon
led to the proposal that there is only one
70 promoter
(39) in the glnB promoter region; this is unlike
the situation in R. capsulatus (13) and
Rhodospirillum rubrum (18), where there are two
promoters upstream of the glnB coding region which are
thought to be differentially regulated according to the cellular N
status. Sequence analysis also suggested that glnA might be
cotranscribed with glnB in R. sphaeroides (39). However, there is no direct
evidence as to whether glnB expression is controlled by the
nitrogen status of the cell or even if the expression of glnB is essential for normal cellular nitrogen regulation in
R. sphaeroides. Because of the key role played by
the PII protein in nitrogen regulation (9, 15, 17,
20), an R. sphaeroides glnB::lacZ transcriptional fusion was
constructed to facilitate the analysis of glnB expression in
R. sphaeroides strains grown with different
nitrogen sources. It was apparent that glnB regulation in
the wild type differed from that in the RubisCO-deficient strain 16PHC.
In addition, a glnB homolog, glnK, was isolated
from R. sphaeroides and was also shown to be
differentially controlled in the wild type and strain 16PHC.
 |
MATERIALS AND METHODS |
R. sphaeroides strains and growth
conditions.
The R. sphaeroides strains and
plasmids used in this study are listed in Table
1. Photoheterotrophic growth, with either 30 mM ammonia or 5 mM glutamate as the nitrogen source, was described previously (28).
Cloning of glnB and construction of the
glnB::lacZ transcriptional
fusion.
Primers glnBF (5' GAGGCGATCATCAAGCCGTTC 3') and
glnBR (5' GCCGGTGCGGATGCGGATCGC 3') were designed according
to the previously published 5' and 3' nucleotide sequences of the
glnB coding region of R. sphaeroides 2R
(39). Subsequently, an approximately 340-bp glnB-specific PCR product synthesized by these two primers
was used as a homologous probe to screen a genomic library of strain HR. The positively hybridizing library clone pVKD8 was isolated, and a 4.0-kb EcoRI fragment, containing the glnB
region, was subcloned into pUC19 to generate pUCD84.0E (Fig.
1A). The 0.88-kb
BamHI-BglII fragment containing the
glnB upstream region and part of the glnB coding
region was cloned into the low-copy-number IncQ vector pHRP309 to
construct the glnB::lacZ
transcriptional fusion plasmid pHRPglnB (Fig. 1A), which is
compatible with IncP plasmid pJG106.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Physical map and gene organization of the
glnBA region of R. sphaeroides. Plasmid
pUCD84.0E carries a 4.0-kb EcoRI fragment from cosmid pVKD8,
which contains the glnBA region. The
glnB::lacZ fusion plasmid pHRPglnB contains a
0.88-kb BamHI-BglII fragment from pUCD84.0E. (B)
Cloning of the glnK region of R. sphaeroides and construction of a
glnK::lacZ fusion. Plasmid pRK3D11 is the
original library clone containing the glnK region from
strain 16PHC. Plasmid pUCEBg2.2 contains the region upstream and
includes part of glnK on a 2.2-kb
EcoRI-BglII fragment. A 1.1-kb
HindIII-BglII fragment from pUCEBg2.2 was
used to construct a glnK::lacZ fusion
[plasmid pHRPglnK(PHC)] from strain 16PHC. E, EcoRI; H,
HindIII; Bg, BglII; S, SalI; B,
BamHI. Restriction sites in parentheses were lost during
cloning.
|
|
Cloning of glnK and construction of
glnK::lacZ transcriptional fusions from
strains HR and 16PHC.
When a genomic library of strain 16PHC
(29) was examined with the same glnB probe,
a library clone, pRK3D11, was found to hybridize to a moderate
extent; this was subsequently isolated and shown to contain the
glnK gene (Fig. 1B). A 2.2-kb
EcoRI-BglII fragment was subcloned into pUC19 to
generate pUCEBg2.2 (Fig. 1B), and the 1.1-kb
HindIII-BglII fragment containing the
glnK upstream region and part of the glnK coding
region was cloned into pHRP309 to construct
glnK::lacZ transcriptional fusion plasmid, pHRPglnK(PHC) (Fig. 1B). The same 1.1-kb
HindIII-BglII fragment was also isolated from
strain HR via PCR procedures, and a
glnK::lacZ fusion plasmid, plasmid
pHRPglnK(HR) (not shown), was similarly constructed from this strain.
Enzyme assays.
GS levels were determined by the
-glutamyltransferase assay at pH 7.5 and 30°C with
Mn2+ as the divalent cation, as previously described
(16, 31) except that the reaction time was 15 min. This time
was shown to be well within the linear time response for these assays.
-galactosidase activities were measured as previously described
(28).
Nucleotide sequence accession number.
The sequences for the
glnB and glnK regions from R. sphaeroides HR and 16PHC, respectively, have been submitted to
the GenBank-EMBL data bank under accession no. AF032116 and AF023909,
respectively.
 |
RESULTS |
glnBA operon from R. sphaeroides
HR.
Nucleotide sequence analysis of the promoter and coding
region of the glnB gene from R. sphaeroides HR showed 98.8% identity to the R. sphaeroides glnB sequence previously determined for a
different strain, 2R (39) (accession no. X71659). When the
deduced amino acid sequences were compared, 98.2% identity between
these two sequences was found, with differences at only two residues;
the amino acids at positions 50 and 81 in strain HR are glutamate and
alanine, respectively, while in strain 2R they are alanine and serine,
respectively. These differences are each due to a single base change.
The Glu-50 and Ala-81 residues of the strain HR GlnB protein are
conserved among other PII proteins and products of
glnB-like genes, such as glnK of E. coli (33) and glnZ of A. brasilense (6). A putative NtrC-binding site, 5'
TGCACAAAAATCGGGCG 3', located at nucleotides 443 to 459 in the
glnB (strain HR) sequence, was also found at the same
position upstream of the glnB coding region of strain 2R,
with only one base pair difference (5'
TGCACAAAAATAGGGCG 3') (39).
Expression of the glnB::lacZ fusion in
R. sphaeroides.
The
glnB::lacZ fusion plasmid pHRPglnB was
introduced into strains HR, 16PHC, and 16PHC(pJG106). Plasmid
pJG106 contains an intact cbbM gene (encoding form
II RubisCO), which allows the CBB pathway to be complete in strain
16PHC (14). In the wild-type strain, HR, a high level of
glnB::lacZ expression was obtained when
ammonia was used as the nitrogen source (Fig.
2), but a further threefold increase was
observed under glutamate growth conditions. Thus, glnB
transcription appears to be somewhat constitutive in this organism,
although there is still a modicum of nitrogen control, which is similar
to results reported for R. capsulatus (13) and Rhodospirillum rubrum (18); however, another
glnB::lacZ fusion study indicated that
glnB expression is constitutive in R. capsulatus (4). In strain 16PHC, glnB
expression was extremely low when either ammonia or glutamate was used
as the nitrogen source, although there was some indication of nitrogen
control even at these low levels of activity. Interestingly, for strain 16PHC(pJG106), which regained a functional CBB pathway,
glnB::lacZ expression was restored to
wild-type levels (or slightly higher) under both ammonia and glutamate
growth conditions. These results indicate that glnB
expression was repressed (or not activated) in strain 16PHC and that
the presence of a functional CBB pathway suppresses this effect and
restores glnB expression to the level observed in the wild
type.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
glnB::lacZ fusion expression
in different strains of R. sphaeroides. Strains
carrying the glnB::lacZ fusion plasmid
pHRPglnB were grown to mid-log phase under photoheterotrophic
conditions with either ammonia or glutamate as the nitrogen source.
Cells were harvested, and crude cell extracts were used for
-galactosidase activity measurements. Standard deviations are
indicated by error bars. Numbers above bars are the means.
|
|
Levels of GS in R. sphaeroides.
Since
there is evidence indicating that glnA is most likely
cotranscribed with glnB in R. sphaeroides (39), GS levels were examined in the
different R. sphaeroides strains. In the
wild-type strain, HR, the levels of GS were lower in the presence of
ammonia, with a fivefold increase observed when glutamate was used as
the nitrogen source (Fig. 3). These
results parallel the glnB expression pattern observed for
the wild-type strain. However, for strain 16PHC, although the levels of
GS were comparable to that for strain HR in the presence of ammonia, GS
activity did not increase further under glutamate growth conditions.
When plasmid pJG106 was introduced into strain 16PHC, high levels of GS
activity were obtained when glutamate was used as the nitrogen source
for growth. Since the genes glnB and glnA
(encoding GS) are cotranscribed in R. sphaeroides (39) and glnB is not expressed in the absence of
a functional CBB pathway (Fig. 2), it is possible that glnA
expression was affected under N-limiting conditions in strain 16PHC.
Lower derepression levels of GS activity in glutamate-grown cells were
also observed in CBB pathway-deficient strains of R. capsulatus and Rhodospirillum rubrum than in their
wild-type CBB pathway-positive parent strains (data not shown).
Immunoblot analysis with antisera raised against Rhodospirillum
rubrum PII protein (17) and GS did not
yield good cross-reactivity with R. sphaeroides
crude cell extracts.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Levels of GS activity in different strains of
R. sphaeroides. Cells grown with either ammonia or
glutamate were harvested at mid-log phase, and GS levels were
determined by measuring the transferase activity. Standard deviations
are indicated by error bars. Numbers above bars are the means.
|
|
Sequence of the glnK gene from R. sphaeroides.
During the cloning of the glnBA
cluster from R. sphaeroides, a glnB-like
gene, glnK, was isolated from a genomic library of strain 16PHC. The gene showed similarity to the deduced sequences of glnB and glnB-like genes from various
organisms. The deduced amino acid sequence of R. sphaeroides GlnK showed 64% identity with GlnZ from A. brasilense (6); 62% identity with GlnB from R. sphaeroides (strain HR [this study]),
Klebsiella pneumoniae (15), and E. coli (23); 60% identity with GlnB from
Herbaspirillum seropedicae (3) and
Rhizobium meliloti (2); 59% identity with GlnB
from A. brasilense (8) and Rhodospirillum
rubrum (18); 58% identity with GlnB from
Rhizobium leguminosarum (1) and
Bradyrhizobium japonicum (24); 57% identity with
GlnB from R. capsulatus (21); 53% identity
with GlnB from Synechococcus sp. strain PCC 7942 (32); only 52% identity with GlnK from E. coli
(33); and 50% identity with GlnB from
Synechocystis sp. strain PCC 6803 (19a). In all
cases, tyrosine 51, previously shown to be the uridylylation site under
nitrogen-limiting conditions, is conserved. A partial open reading
frame downstream of glnK was also identified (Fig. 1B);
it is very similar to a gene proposed to encode an ammonia
transporter (37), amtB, of E. coli, in which it is also located downstream from the
glnK gene.
A putative NtrC-binding site (5' TGCATTAAAATTGGGCG 3') was
found upstream of the
glnK coding region; it is similar to
the
NtrC-binding sites of the
Rhodospirillum rubrum
(
18) and
R. sphaeroides glnB regions
(data not shown) but not very similar
to the
glnB region of
R. capsulatus (
13). Two sets of direct
repeats, the functions of which are unknown, were also found.
Neither
an upstream activator sequence nor a

12/

24-type promoter,
both
of which are found in the
nifH promoter regions of
R. sphaeroides (
28) and
R. capsulatus (
37), was observed in the
glnK
promoter
region of
R. sphaeroides.
Expression of glnK::lacZ fusions in
R. sphaeroides.
glnK::lacZ
transcription fusions were constructed from DNA fragments isolated from
strains HR and 16PHC, and the expression levels were examined. In
strain HR, a very low level of glnK expression was observed
in the presence of ammonia, and it was highly derepressed when
glutamate was used as the nitrogen source under nitrogen-limiting growth conditions (Fig. 4A). These
results indicated that glnK expression is under tight
nitrogen control in wild-type R. sphaeroides, much
like nifH expression (28). In strain 16PHC, this
tight nitrogen control was abolished and there was a significant level of glnK derepression in the presence of ammonia.
Although this depression was significant, the level of
glnK expression did not reach the levels attained in
this strain under glutamate growth conditions. Strain
16PHC(pJG106), which possesses a functional CBB pathway, suppressed
the derepression of glnK expression that was observed in
strain 16PHC in the presence of ammonia. Moreover, with glutamate as
the nitrogen source, high levels of glnK expression were
achieved, even somewhat higher than in the wild type. The fusion
plasmid pHRPglnK(PHC), which was constructed from sequences derived
from strain 16PHC, yielded approximately the same pattern of gene
expression (Fig. 4B), the only difference being a lower level of
derepression in strain 16PHC in the presence of ammonia than that with
plasmid pHRPglnK(HR). Nevertheless, it is unlikely that the
derepression of glnK was caused by a cis mutation
in the glnK promoter region in strain 16PHC, since
glnK::lacZ fusions from both strains yielded
similar results. These findings were quite similar to the pattern of
nifH expression in R. sphaeroides strains (28).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
glnK::lacZ fusion activities
in R. sphaeroides HR, 16PHC, and 16PHC(pJG106).
Strains carrying glnK::lacZ fusion plasmids
pHRPglnK(HR) (A) and pHRPglnK(PHC) (B) were grown
photoheterotrophically with ammonia or glutamate as the nitrogen
source. Cells were harvested at mid-log phase, and
-galactosidase activities were measured. Standard deviations are
indicated by error bars. Numbers above bars are the means.
|
|
 |
DISCUSSION |
Previous studies demonstrated that nitrogenase derepression
occurs when the RubisCO-deficient strain 16PHC is grown in the presence of ammonia, with nitrogenase presumably serving to substitute for the CBB pathway as the means of achieving redox balancing under
photoheterotrophic growth conditions (19). The
Nifc phenotype of strain 16PHC is unique in that
nitrogenase synthesis is only partially derepressed; however,
derepression is reversible and suppressed when a functional CBB
pathway is introduced by the addition of a RubisCO gene in
trans. This suggests that the mutation that caused nif
derepression is somehow linked to the nif regulatory system
of R. sphaeroides, yet the basis of the Nifc phenotype is undoubtedly different from those of
other, previously described Nifc mutants, which are
unrelated to CBB function (21, 39, 40). Since a
glnB mutation of R. capsulatus resulted in a
Nifc phenotype and the PII protein had been
previously proposed to be a negative regulator of nif
regulation in this organism (20), we examined
glnB expression in strain 16PHC. Our results clearly indicated that glnB expression was affected in strain 16PHC.
Despite the fact that a previous study showed the presence of a
70 promoter motif upstream of the glnB coding
region in R. sphaeroides (39),
glnB expression was nevertheless affected by the nitrogen source supplied to this organism; e.g., the high level of
glnB expression found in cells grown in the presence of
ammonia was increased threefold when glutamate was used as the nitrogen
source. In R. sphaeroides 16PHC, however, there was
little or no glnB::lacZ fusion activity when
either ammonia or glutamate was used as the nitrogen source. Since it
is possible that the PII protein might also function as a
nif repressor in R. sphaeroides, the
absence of glnB expression in strain 16PHC might lead to the
derepression of nitrogenase synthesis in the presence of ammonia.
However, repression of glnB expression was relieved by the
introduction of a gene which yields a functional CBB pathway, leading
to a concomitant suppression of nitrogenase synthesis in the presence of ammonia (19, 28). These results are compatible with a
suggested role of a functional CBB pathway in nif expression
in strain 16PHC, presumably via the activation and/or inactivation of
PII protein synthesis.
It has been shown for many bacteria that the glnB and
glnA genes are cotranscribed and are part of a two-gene
operon controlled by a glnB promoter(s) (1, 13, 18,
24). Evidence that a third promoter might also be used to
specifically regulate glnA expression has been presented
(1, 7, 13, 18). In strain 16PHC, GS activity was extremely
low and levels were comparable to those obtained from the wild-type
strain, HR, in the presence of ammonia. This low, yet constitutive,
level of GS activity in strain 16PHC is probably due to the existence
of a glnA promoter which may not be controlled by the
nitrogen source used for growth. The fact that GS activity is detected
in the absence of glnB expression in strain 16PHC might
explain why glutamine auxotrophy was not observed in this strain.
Similar results were obtained for Rhizobium leguminosarum
(1), in which a glnB mutation seemed to affect GS
expression only under glutamate growth conditions. In the same study, a
glnA::lacZ fusion which was not sensitive to
the nitrogen source for growth was constructed. In addition,
glnA::lacZ activities were not affected by a
glnB mutation. It is thus reasonable to believe that in
R. sphaeroides, like Rhizobium
leguminosarum, if transcription from a glnB promoter(s)
is not possible, glnA may be transcribed from its own
promoter, a promoter which is not regulated by the nitrogen source used
for growth.
A glnB-like gene, glnK, was also isolated from
R. sphaeroides, but glnK expression
appeared to be controlled differently from glnB expression
in that it was highly regulated by the nitrogen source used for growth.
Indeed, glnK appeared to be expressed only under N-limiting
growth conditions, e.g., with glutamate as the nitrogen source. Similar
results were also obtained from studies of glnB-like genes
from E. coli (33) and Bacillus
subtilis (38), although the expression of the
glnB-like gene glnZ in A. brasilense seemed to be insensitive to nitrogen sources
(6). In strain 16PHC, this tight nitrogen control was lost
and glnK expression was partially derepressed in the
presence of ammonia, similar to nitrogenase synthesis in this strain,
suggesting that perhaps nifH and glnK expression
might have common regulatory elements. However, in a recent study
(28), it was found that the same upstream activation and
12/
24-type promoter sequences that were present in the
nifH promoter region did not appear to be present in the
upstream region of glnK. Another fact to be considered in
the future is that many organisms contain two different types of GS
(e.g., in Synechocystis sp. strain PCC 6803 [30] and Rhizobium leguminosarum
[1]), which are differentially regulated by nitrogen
availability. Why certain organisms possess two such different systems
is unknown at this point; however, such findings might relate to
potential efficient ways to control nitrogen metabolism under the
widest possible range of environmental conditions. It should be
noted that glnB-like genes have also been reported for
H. seropedicae (3), B. subtilis (nrgB) (38), A. brasilense (glnZ) (6), and E. coli (glnK) (33). Although the syntheses of
GlnB and GlnK are differentially regulated in R. sphaeroides, these two proteins are both predicted to be
composed of 112 amino acids and have very similar sequences, including a conserved uridylylation site, Tyr-51. It has been shown that purified
GlnK from E. coli (33) can activate adenylylation
of GS in vitro in the presence of ammonia (even though GlnK is not synthesized under such conditions in vivo). GlnK can also be modified by uridylylation under nitrogen-limiting conditions in vivo, suggesting that GlnK, the PII homolog, might function similarly to the
PII protein itself and interact with regulatory proteins in
the cell. Therefore, it is possible that the GlnK protein, which is
presumably synthesized in the presence of ammonia in strain 16PHC,
takes on the role of the PII protein, which presumably is
not synthesized in this strain. Thus, if GlnB acts as a negative
regulator for nif derepression by binding NtrB, subsequently
leading to dephosphorylation of NtrC-Pi, perhaps GlnK is
not as efficient as GlnB in binding to NtrB. Perhaps, then, partial
derepression of nitrogenase synthesis in the absence of PII
is related to the efficiency of GlnK-NtrB binding and/or its relative
influence on NtrC dephosphorylation. It appears that the
Nifc phenotype of strain 16PHC is different from the
phenotypes of other Nifc mutants, because the mutation in
strain 16PHC caused a pleiotropic effect on gene expression, including
the repression of glnB expression and derepression of
glnK and nitrogenase synthesis in the presence of ammonia.
It will thus be important to determine if glnK derepression in the presence of ammonia is caused by the absence of PII
synthesis in strain 16PHC.
Although the control of nitrogen metabolism and the complicated
regulatory cascade have been studied extensively for prokaryotes, our
results indicate that carbon metabolism also plays a significant role
in regulating nitrogen metabolism. It is apparent that the CBB pathway
is linked to PII expression in strain 16PHC. A regulatory link between carbon metabolism and nitrogen metabolism is also suggested for the cyanobacterium Synechococcus sp. strain
PCC 7942, in which the rate of CO2 fixation through the CBB
pathway affects phosphorylation of the PII protein
(11, 12). In cyanobacteria, modification by phosphorylation
seemingly is the equivalent of uridylylation of the PII
protein observed in other prokaryotes (5). The precise
mechanism by which the CBB pathway affects gene expression and enzyme
activity within the nitrogen assimilatory system remains to be
determined. However, it seems apparent that further probing of the link
between the two major biosynthetic processes of carbon assimilation and
nitrogen assimilation will lead to definitive answers.
 |
ACKNOWLEDGMENTS |
We thank Stefan Nordlund and Paul Ludden for the gifts of
antisera to PII protein and GS, respectively.
This study was supported by Public Health Service grant GM45404 from
the National Institutes of Health and by Department of Energy grant
DE-FG02-91ER 20033.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, The Ohio State University, 484 West 12th Ave., Columbus, OH 43210-1292. Phone: (614) 292-4297. Fax: (614) 292-6337. E-mail: Tabita.1{at}osu.edu.
 |
REFERENCES |
| 1.
|
Amar, M.,
E. J. Patriarca,
G. Manco,
P. Bernard,
A. Riccio,
A. Lamberti,
R. Defez, and M. Iaccarino.
1994.
Regulation of nitrogen metabolism is altered in a glnB mutant strain of Rhizobium leguminosarum.
Mol. Microbiol.
11:685-693[Medline].
|
| 2.
|
Arcondéguy, T.,
I. Huez,
P. Tillard,
C. Gangneux,
F. de Billy,
A. Gojon,
G. Truchet, and D. Kahn.
1997.
The Rhizobium meliloti PII protein, which controls bacterial nitrogen metabolism, affects alfalfa nodule development.
Genes Dev.
11:1194-1206[Abstract/Free Full Text].
|
| 3.
|
Benelli, E. M.,
E. M. Souza,
S. Funayama,
L. U. Rigo, and F. O. Pedrosa.
1997.
Evidence for two possible glnB-type genes in Herbaspirillum seropedicae.
J. Bacteriol.
179:4623-4626[Abstract/Free Full Text].
|
| 4.
|
Borghese, R., and J. D. Wall.
1995.
Regulation of the glnBA operon of Rhodobacter capsulatus.
J. Bacteriol.
177:4549-4552[Abstract/Free Full Text].
|
| 5.
|
Cheah, E.,
P. D. Carr,
P. M. Suffolk,
S. G. Vasudevan,
N. E. Dixon, and D. L. Ollis.
1994.
Structure of the Escherichia coli signal transducing protein PII.
Structure
2:981-990[Medline].
|
| 6.
|
de Zamaroczy, M.,
A. Paquelin,
G. Peltre,
K. Forchhammer, and C. Elmerich.
1996.
Coexistence of two structurally similar but functionally different PII proteins in Azospirillum brasilense.
J. Bacteriol.
178:4143-4149[Abstract/Free Full Text].
|
| 7.
|
de Zamaroczy, M.,
A. Paquelin, and C. Elmerich.
1993.
Functional organization of the glnB-glnA cluster of Azospirillum brasilense.
J. Bacteriol.
175:2507-2515[Abstract/Free Full Text].
|
| 8.
|
de Zamaroczy, M.,
F. Delorme, and C. Elmerich.
1990.
Characterization of three different nitrogen-regulated promoter regions for the expression of glnB and glnA in Azospirillum brasilense.
Mol. Gen. Genet.
224:421-430[Medline].
|
| 9.
|
Engleman, E. G., and S. H. Francis.
1978.
Cascade control of E. coli glutamine synthetase. II. Metabolite regulation of the enzymes in the cascade.
Arch. Biochem. Biophys.
191:602-612[Medline].
|
| 10.
|
Falcone, D. L., and F. R. Tabita.
1991.
Expression of endogenous and foreign ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) genes in a RubisCO deletion mutant of Rhodobacter sphaeroides.
J. Bacteriol.
173:2099-2108[Abstract/Free Full Text].
|
| 11.
|
Forchhammer, K., and N. Tandeau de Marsac.
1995.
Phosphorylation of the PII protein (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942: analysis of in vitro kinase activity.
J. Bacteriol.
177:5812-5817[Abstract/Free Full Text].
|
| 12.
|
Forchhammer, K., and N. Tandeau de Marsac.
1995.
Functional analysis of the phosphoprotein PII (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942.
J. Bacteriol.
177:2033-2040[Abstract/Free Full Text].
|
| 13.
|
Foster-Hartnett, D., and R. G. Kranz.
1994.
The Rhodobacter capsulatus glnB gene is regulated by NtrC at tandem rpoN-independent promoters.
J. Bacteriol.
176:5171-5176[Abstract/Free Full Text].
|
| 14.
|
Gibson, J. L., and F. R. Tabita.
1988.
Localization and mapping of CO2 fixation genes within two gene clusters in Rhodobacter sphaeroides.
J. Bacteriol.
170:2153-2158[Abstract/Free Full Text].
|
| 15.
|
Holtel, A., and M. Merrick.
1988.
Identification of the Klebsiella pneumoniae glnB gene: nucleotide sequence of wild-type and mutant alleles.
Mol. Gen. Genet.
215:134-138[Medline].
|
| 16.
|
Johansson, B. C., and H. Gest.
1977.
Adenylylation/deadenylylation control of the glutamine synthetase of Rhodopseudomonas capsulata.
Eur. J. Biochem.
81:365-371[Medline].
|
| 17.
|
Johansson, M., and S. Nordlund.
1997.
Uridylylation of the PII protein in the photosynthetic bacterium Rhodospirillum rubrum.
J. Bacteriol.
179:4190-4194[Abstract/Free Full Text].
|
| 18.
|
Johansson, M., and S. Nordlund.
1996.
Transcription of the glnB and glnA genes in the photosynthetic bacterium Rhodospirillum rubrum.
Microbiology
142:1265-1272[Abstract/Free Full Text].
|
| 19.
|
Joshi, H. M., and F. R. Tabita.
1996.
A global two component signal transduction system that integrates the control of photosynthesis, carbon dioxide assimilation, and nitrogen fixation.
Proc. Natl. Acad. Sci. USA
93:14515-14520[Abstract/Free Full Text].
|
| 19a.
|
Kaneko, T.,
S. Sato,
H. Kotani,
A. Tanaka,
E. Asamizu,
Y. Nakamura,
N. Miyajima,
M. Hirosawa,
M. Sigiura,
S. Sasamoto,
T. Kimura,
T. Hosouchi,
A. Matsuno,
A. Muraki,
N. Nakazaki,
K. Naruo,
S. Okumura,
S. Shimpo,
C. Takeuchi,
T. Wada,
A. Watanabe,
M. Yamada,
M. Yasuda, and S. Tabata.
1996.
Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions.
DNA Res.
3:109-136[Abstract].
|
| 20.
|
Kranz, R. G., and P. J. Cullen.
1995.
Regulation of nitrogen fixation, p. 1191-1208.
In
R. E. Blankenship, M. T. Madigan, and C. E. Bauer (ed.), Anoxygenic photosynthetic bacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 21.
|
Kranz, R. G.,
V. M. Pace, and I. M. Caldicott.
1990.
Inactivation, sequence, and lacZ fusion analysis of a regulatory locus required for repression of nitrogen fixation genes in Rhodobacter capsulatus.
J. Bacteriol.
172:53-62[Abstract/Free Full Text].
|
| 22.
|
Liang, Y. Y.,
M. de Zamaroczy,
F. Arsène,
A. Paquelin, and C. Elmerich.
1992.
Regulation of nitrogen fixation in Azospirillum brasilense Sp7: involvement of nifA, glnA and glnB gene products.
FEMS Microbiol. Lett.
100:113-120.
|
| 23.
|
Liu, J., and B. Magasanik.
1993.
The glnB region of the Escherichia coli chromosome.
J. Bacteriol.
175:7441-7449[Abstract/Free Full Text].
|
| 24.
|
Martin, G. B.,
M. F. Thomashow, and B. K. Chelm.
1989.
Bradyrhizobium japonicum glnB, a putative nitrogen-regulatory gene, is regulated by NtrC at tandem promoters.
J. Bacteriol.
171:5638-5645[Abstract/Free Full Text].
|
| 25.
|
McEwan, A. G.
1994.
Photosynthetic electron transport and anaerobic metabolism in purple non-sulfur phototrophic bacteria.
Antonie Leeuwenhoek
66:151-164[Medline].
|
| 26.
|
Paoli, G. P.
1997.
Ph.D. dissertation.
The Ohio State University, Columbus.
|
| 27.
|
Parales, R. E., and C. S. Harwood.
1993.
Construction and use of a new broad-host-range lacZ transcriptional fusion vector, pHRP309, for Gram bacteria.
Gene
133:23-30[Medline].
|
| 28.
|
Qian, Y.
1998.
Ph.D. dissertation.
The Ohio State University, Columbus.
|
| 29.
|
Qian, Y., and F. R. Tabita.
1996.
A global signal transduction system regulates aerobic and anaerobic CO2 fixation in Rhodobacter sphaeroides.
J. Bacteriol.
178:12-18[Abstract/Free Full Text].
|
| 30.
|
Reyes, J. C.,
M. I. Muro-Pastor, and F. J. Florencio.
1997.
Transcription of glutamine synthetase genes (glnA and glnN) from the cyanobacterium Synechocystis sp. strain PCC 6803 is differently regulated in response to nitrogen availability.
J. Bacteriol.
179:2678-2689[Abstract/Free Full Text].
|
| 31.
|
Shapiro, B. M., and E. R. Stadtman.
1970.
Glutamine synthetase (Escherichia coli).
Methods Enzymol.
17A:910-922.
|
| 32.
|
Tsinoremas, N. F.,
A. M. Castets,
M. A. Harrison,
J. F. Allen, and N. Tandeau de Marsac.
1991.
Photosynthetic electron transport controls nitrogen assimilation in cyanobacteria by means of posttranslational modification of the glnB gene product.
Proc. Natl. Acad. Sci. USA
88:4565-4569[Abstract/Free Full Text].
|
| 33.
|
van Heeswijk, W. C.,
S. Hoving,
D. Molenaar,
B. Stegeman,
D. Kahn, and H. V. Westerhoff.
1996.
An alternative PII protein in the regulation of glutamine synthetase in E. coli.
Mol. Microbiol.
21:133-146[Medline].
|
| 34.
|
van Heeswijk, W. C.,
M. Rabenberg,
H. V. Westerhoff, and D. Kahn.
1993.
The genes of the glutamine synthetase adenylylation cascade are not regulated by nitrogen in Escherichia coli.
Mol. Microbiol.
9:443-457[Medline].
|
| 35.
|
Wang, X.,
D. L. Falcone, and F. R. Tabita.
1993.
Reductive pentose phosphate-independent CO2 fixation in Rhodobacter sphaeroides and evidence that ribulose bisphosphate carboxylase/oxygenase activity serves to maintain the redox balance of the cell.
J. Bacteriol.
175:3372-3379[Abstract/Free Full Text].
|
| 36.
|
Weaver, K. E., and F. R. Tabita.
1983.
Isolation and partial characterization of Rhodopseudomonas sphaeroides mutants defective in the regulation of ribulose bisphosphate carboxylase/oxygenase.
J. Bacteriol.
156:507-515[Abstract/Free Full Text].
|
| 37.
|
Willison, J. C.,
J. Pierrard, and P. Hubner.
1993.
Sequence and transcript analysis of the nitrogenase structure gene operon (nifHDK) of Rhodobacter capsulatus: evidence for intramolecular processing of nifHDK mRNA.
Gene
133:39-46[Medline].
|
| 38.
|
Wray, L. V., Jr.,
M. R. Atkinson, and S. H. Fisher.
1994.
The nitrogen-regulated Bacillus subtilis nrgAB operon encodes a membrane protein and a protein highly similar to the Escherichia coli glnB-encoded PII protein.
J. Bacteriol.
176:108-114[Abstract/Free Full Text].
|
| 39.
|
Zinchenko, V.,
Y. Churin,
V. Shestopalov, and S. Shestakov.
1994.
Nucleotide sequence and characterization of the Rhodobacter sphaeroides glnB and glnA genes.
Microbiology
140:2143-2151[Abstract/Free Full Text].
|
| 40.
|
Zinchenko, V. V.,
A. V. Kopteva,
N. V. Belavina,
T. N. Mitronova,
V. D. Frolova, and S. V. Shestakov.
1991.
A study of different types of Rhodobacter sphaeroides mutants with derepression of nitrogenase.
Sov. Genet.
27:695-702.
|
Journal of Bacteriology, September 1998, p. 4644-4649, Vol. 180, No. 17
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Drepper, T., Gross, S., Yakunin, A. F., Hallenbeck, P. C., Masepohl, B., Klipp, W.
(2003). Role of GlnB and GlnK in ammonium control of both nitrogenase systems in the phototrophic bacterium Rhodobacter capsulatus. Microbiology
149: 2203-2212
[Abstract]
[Full Text]
-
Dubbs, J. M., Tabita, F. R.
(2003). Interactions of the cbbII Promoter-Operator Region with CbbR and RegA (PrrA) Regulators Indicate Distinct Mechanisms to Control Expression of the Two cbb Operons of Rhodobacter sphaeroides. J. Biol. Chem.
278: 16443-16450
[Abstract]
[Full Text]
-
Gibson, J. L., Dubbs, J. M., Tabita, F. R.
(2002). Differential Expression of the CO2 Fixation Operons of Rhodobacter sphaeroides by the Prr/Reg Two-Component System during Chemoautotrophic Growth. J. Bacteriol.
184: 6654-6664
[Abstract]
[Full Text]
-
Tichi, M. A., Tabita, F. R.
(2002). Metabolic Signals That Lead to Control of CBB Gene Expression in Rhodobacter capsulatus. J. Bacteriol.
184: 1905-1915
[Abstract]
[Full Text]
-
Ehlers, C., Grabbe, R., Veit, K., Schmitz, R. A.
(2002). Characterization of GlnK1 from Methanosarcina mazei Strain Go1: Complementation of an Escherichia coli glnK Mutant Strain by GlnK1. J. Bacteriol.
184: 1028-1040
[Abstract]
[Full Text]
-
Tichi, M. A., Meijer, W. G., Tabita, F. R.
(2001). Complex I and Its Involvement in Redox Homeostasis and Carbon and Nitrogen Metabolism in Rhodobacter capsulatus. J. Bacteriol.
183: 7285-7294
[Abstract]
[Full Text]
-
Zhang, Y., Pohlmann, E. L., Ludden, P. W., Roberts, G. P.
(2001). Functional Characterization of Three GlnB Homologs in the Photosynthetic Bacterium Rhodospirillum rubrum: Roles in Sensing Ammonium and Energy Status. J. Bacteriol.
183: 6159-6168
[Abstract]
[Full Text]
-
Tichi, M. A., Tabita, F. R.
(2001). Interactive Control of Rhodobacter capsulatus Redox-Balancing Systems during Phototrophic Metabolism. J. Bacteriol.
183: 6344-6354
[Abstract]
[Full Text]
-
Arcondeguy, T., Jack, R., Merrick, M.
(2001). PII Signal Transduction Proteins, Pivotal Players in Microbial Nitrogen Control. Microbiol. Mol. Biol. Rev.
65: 80-105
[Abstract]
[Full Text]
-
Zhang, Y., Pohlmann, E. L., Halbleib, C. M., Ludden, P. W., Roberts, G. P.
(2001). Effect of PII and Its Homolog GlnK on Reversible ADP-Ribosylation of Dinitrogenase Reductase by Heterologous Expression of the Rhodospirillum rubrum Dinitrogenase Reductase ADP-Ribosyl Transferase-Dinitrogenase Reductase-Activating Glycohydrolase Regulatory System in Klebsiella pneumoniae. J. Bacteriol.
183: 1610-1620
[Abstract]
[Full Text]
-
Kessler, P. S., Daniel, C., Leigh, J. A.
(2001). Ammonia Switch-Off of Nitrogen Fixation in the Methanogenic Archaeon Methanococcus maripaludis: Mechanistic Features and Requirement for the Novel GlnB Homologues, NifI1 and NifI2. J. Bacteriol.
183: 882-889
[Abstract]
[Full Text]
-
Richardson, D. J.
(2000). Bacterial respiration: a flexible process for a changing environment. Microbiology
146: 551-571
[Full Text]
-
Zhang, Y., Pohlmann, E. L., Ludden, P. W., Roberts, G. P.
(2000). Mutagenesis and Functional Characterization of the glnB, glnA, and nifA Genes from the Photosynthetic Bacterium Rhodospirillum rubrum. J. Bacteriol.
182: 983-992
[Abstract]
[Full Text]
-
Johansson, M., Nordlund, S.
(1999). Purification of PII and PII-UMP and In Vitro Studies of Regulation of Glutamine Synthetase in Rhodospirillum rubrum. J. Bacteriol.
181: 6524-6529
[Abstract]
[Full Text]
-
Cheng, J., Johansson, M., Nordlund, S.
(1999). Expression of PII and Glutamine Synthetase Is Regulated by PII, the ntrBC Products, and Processing of the glnBA mRNA in Rhodospirillum rubrum. J. Bacteriol.
181: 6530-6534
[Abstract]
[Full Text]
-
Dubbs, J. M., Bird, T. H., Bauer, C. E., Tabita, F. R.
(2000). Interaction of CbbR and RegA* Transcription Regulators with the Rhodobacter sphaeroides cbbIPromoter-Operator Region. J. Biol. Chem.
275: 19224-19230
[Abstract]
[Full Text]