Previous Article | Next Article ![]()
Journal of Bacteriology, September 1998, p. 4879-4885, Vol. 180, No. 18
Department of Veterinary Science and
Microbiology, University of Arizona, Tucson, Arizona
857211;
Department of Microbiology
and Immunology, University of North Texas Health Science Center,
Fort Worth, Texas 761072;
Facultad de
Ciencias Químicas, Instituto de Investigación en
Biología Experimental, Universidad de Guanajuato, Guanajuato,
México3; and
Chemistry Department,
Cornell University, Ithaca, New York 148534
Received 8 June 1998/Accepted 20 July 1998
The major photoproduct in UV-irradiated spore DNA
is the unique thymine dimer 5-thyminyl-5,6-dihydrothymine, commonly
referred to as spore photoproduct (SP). An important determinant of the high UV resistance of Bacillus subtilis spores is the
accurate in situ reversal of SP during spore germination by the
DNA repair enzyme SP lyase. To study the molecular aspects of
SP lyase-mediated SP repair, the cloned B. subtilis
splB gene was engineered to encode SP lyase with a molecular tag
of six histidine residues at its amino terminus. The engineered
six-His-tagged SP lyase expressed from the amyE locus
restored UV resistance to spores of a UV-sensitive mutant B. subtilis strain carrying a deletion-insertion mutation which
removed the entire splAB operon at its natural locus and was shown to repair SP in vivo during spore germination. The
engineered SP lyase was purified both from dormant B. subtilis spores and from an Escherichia coli
overexpression system by nickel-nitrilotriacetic acid (NTA) agarose
affinity chromatography and was shown by Western blotting, UV-visible
spectroscopy, and iron and acid-labile sulfide analysis to be a 41-kDa
iron-sulfur (Fe-S) protein, consistent with its amino
acid sequence homology to the 4Fe-4S clusters in anaerobic
ribonucleotide reductases and pyruvate-formate lyases. SP lyase was
capable of reversing SP from purified SP-containing DNA in an in vitro
reaction either when present in a cell-free extract prepared from
dormant spores or after purification on nickel-NTA agarose. SP lyase
activity was dependent upon reducing conditions and addition of
S-adenosylmethionine as a cofactor.
Bacterial spores are significantly
more resistant to 254-nm UV than are the vegetative forms of the same
species (38, 44). Our current understanding is that this
high level of UV resistance is due mainly to two interlocking
mechanisms. (i) Binding of spore DNA by small, acid-soluble spore
proteins of the NER in Bacillus subtilis closely resembles the analogous
system which has been well characterized in Escherichia coli
(18). NER is a general system capable of detecting and
removing a variety of bulky (i.e., helix-distorting) lesions from DNA,
including both SP and cyclobutane-type pyrimidine dimers (reviewed in
references 14 and 49). SP lyase,
in contrast, is specifically dedicated to the in situ monomerization of
SP during spore germination (22, 23, 48), but to date little
is known of the molecular mechanism of SP repair mediated by SP lyase.
SP lyase is encoded by the splB cistron of the
splAB operon (13). The splA
cistron encodes a small, 9-kDa protein which is not needed for SP lyase
activity and which apparently functions in the regulation of
splAB operon expression (13, 24).
The results of early indirect experiments suggested that SP lyase was
synthesized during either vegetative growth or sporulation and was
packaged within the dormant spore (22, 23). Subsequent studies with lacZ fusions to the cloned B. subtilis SP lyase gene splB supported this conclusion;
SP lyase is expressed exclusively in the developing forespore
compartment during morphological stage III of sporulation as part of
the sigma-G regulon of forespore-specific genes (31, 32).
Early indirect experiments also indicated that SP disappeared from
spore DNA during germination but did not appear in trichloroacetic
acid-soluble material, suggesting that SP was not excised from
high-molecular-weight DNA but was reversed directly to two thymines in
situ (11, 23, 48). The direct reversal of SP by SP lyase is
reminiscent of the action of DNA photolyases upon cyclobutane
pyrimidine dimers (35), with the exception that SP
lyase-mediated repair is light independent (23). Analysis of
the deduced amino acid sequence of SP lyase genes cloned from
B. subtilis (13) and Bacillus
amyloliquefaciens (25) revealed that the two SP lyases
indeed share a short stretch of amino acid sequence with members of the
DNA photolyase-6-4 photolyase-blue light photoreceptor protein family
of enzymes (8, 13, 47), but the potential significance, if
any, of this homology is currently unknown.
Inspection of the amino acid sequences of the two cloned SP lyases also
revealed that they each contain a total of four cysteine residues,
three of which are clustered in an arrangement similar to that seen in
certain iron-sulfur (Fe-S) proteins. A search of the protein sequence
database with the region of B. subtilis SP lyase
encompassing amino acids 80 through 115 indeed revealed substantial
homology to Fe-S proteins such as the activating subunits of the
anaerobic ribonucleotide reductases (RNR) and pyruvate-formate lyases
(PFL) from E. coli, phage T4, Haemophilus
influenzae, and Clostridium pasteurianum
(24). Iron does appear to be associated with SP lyase
activity, as the UV sensitivity of spores of a B. subtilis strain which relies only upon SP lyase for DNA repair is
enhanced when this strain is germinated on solid medium lacking iron
(24).
The above observations suggest that SP lyase may be an Fe-S protein,
and further that class III anaerobic enzymes such as RNR, PFL, or
lysine 2,3-aminomutase from C. pasteurianum (reviewed in
reference 33) could serve as experimental paradigms
for elucidating the molecular mechanism of SP lyase action. An
important step towards this goal is the purification and physical
characterization of SP lyase and an assay of its activity in vitro. To
these ends, the present report describes the engineering of SP lyase
containing an amino (N)-terminal histidine tag, its expression in and
purification from B. subtilis spores or from an
E. coli overexpression system, and preliminary
characterization of its properties in vitro.
Bacterial strains, plasmids, and culture conditions.
B. subtilis and E. coli strains used
in this study are listed in Table 1.
Plasmids and cloned fragments are described in Table
2. Media used were Difco sporulation
medium (DSM) (37) and Luria-Bertani medium (19).
For strains carrying the thyA1 thyB1 markers, thymidine was
routinely added to media to a final concentration of 100 µg/ml. When
appropriate, antibiotics were added to media at the following final
concentrations: chloramphenicol, 3 µg/ml; ampicillin, 50 or 125 µg/ml; tetracycline, 15 µg/ml; erythromycin, 1 µg/ml; lincomycin,
25 µg/ml (the combination of erythromycin and lincomycin is
hereafter referred to as MLS). Labelling of spore DNA by growth and
sporulation of B. subtilis cultures in medium
containing [methyl-3H]thymidine was
performed as described previously (45). All liquid
cultures were incubated at 37°C with vigorous aeration, and optical
density was monitored with a Klett-Summerson colorimeter fitted with a
no. 66 (red) filter. Spore production, purification, and
germination conditions have all been described previously (27), as have methods for assaying spore UV resistance
(12, 13, 27).
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Spore Photoproduct Lyase from Bacillus subtilis Spores
Is a Novel Iron-Sulfur DNA Repair Enzyme Which Shares Features with
Proteins such as Class III Anaerobic Ribonucleotide Reductases and
Pyruvate-Formate Lyases


![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
/
class results in an alteration of the helical
conformation, and hence the UV photochemistry, of dormant spore DNA to
favor production of the unique spore photoproduct (SP)
5-thyminyl-5,6-dihydrothymine (reviewed in references
38-42). (ii) SP formed during exposure of dormant spores to UV is repaired during spore germination by two distinct DNA
repair pathways, nucleotide excision repair (NER) and direct reversal
of SP to thymine in DNA by an SP-specific enzyme called SP lyase
(21-23; reviewed in references 14,
25, and 49).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Bacterial strains used in this study
TABLE 2.
Plasmids used in this study
Genetic and molecular biology techniques. Preparation of competent E. coli or B. subtilis cells and their transformation with DNA were performed as previously described (6, 34). Large- and small-scale extractions of chromosomal DNA from B. subtilis (9) and plasmid DNA from E. coli (5, 34) were accomplished by standard techniques. Extraction of SP-containing methyl-3H-labelled DNA from spores was previously described (45). Standard techniques were used throughout for enzymatic manipulations and agarose gel electrophoresis of DNA (34), for in vitro mutagenesis (12), and for nucleotide sequencing (13, 36).
Construction of N- and C-terminal SP lyases. SP lyase carrying a C-terminal tag of 6 histidine residues (6×His) was constructed by PCR amplification of the splB gene from plasmid pWN41 (Table 2) with a pair of oligonucleotide primers, 5'-GGTCTAGAGGAAAAGGATGTGGC-3' and 5'-CCGTCGACTTAGTGATGGTGATGGTGATGAGTGAAATATTCAATTTTTGC G-3', followed by a series of cloning steps resulting in plasmid pWN376 (Table 2). SP lyase carrying an N-terminal histidine tag was constructed with a commercial kit (Altered Sites; Promega) by in vitro site-directed mutagenesis of the wild-type splAB operon cloned in plasmid pALTER-1 (plasmid pWN160; Table 2) with the mutagenic oligonucleotide 5'-GGATGTGGCATCATGCACCATCACCATCACCATCAGAACCCATTTGTTCCG-3', resulting in plasmid pWN406. The modified splAB operons were inserted into the amyE locus of B. subtilis by their removal from plasmids pWN376 and pWN406 and ligation into EcoRI-HindIII-cleaved plasmid pDG364, resulting in plasmids pWN378 and pWN413, respectively (Table 2). All final plasmid constructions were confirmed by nucleotide sequencing (36).
SP lyase purification and protein techniques. B. subtilis WN417 (1L) was sporulated for 48 h in DSM containing 3 µg of chloramphenicol and 100 µg of thymidine per ml. Spores were harvested, purified as described previously (27), heat shocked at 80°C for 10 min, and stored at 4°C in water until use. The spore coat layer was removed from purified spores by SDS-urea-dithiothreitol (DTT) treatment as described previously (27), and washed decoated spores were lysed by incubation in sonication buffer (50 mM sodium phosphate buffer [pH, 8.0], 300 mM NaCl, and 10 mM imidazole) containing lysozyme (1 mg/ml final concentration) at 37°C for 30 min. Thereafter, the sample was kept on ice or at 4°C. The lysate was sonicated six times for 10-s intervals to lyse cells and shear DNA and centrifuged (12,100 × g, 20 min), and the cell-free extract was loaded onto a nickel-nitrilotriacetic acid (NTA) agarose column (Superflow, Qiagen Inc.) equilibrated in sonication buffer. The column was routinely washed with sonication buffer containing 20 mM imidazole, and the bound protein was eluted with sonication buffer with 250 mM imidazole, and 0.5-ml fractions were collected. The concentration of protein in each fraction was determined by the Bradford assay (7) (Sigma).
Immunologic techniques. SP lyase containing an N-terminal 10×histidine tag was overproduced in an E. coli expression plasmid system (generously provided by C. Kinsland and T. Begley) and purified by nickel-NTA agarose chromatography as described above. Polyclonal goat antiserum was prepared by the following procedure (4). An adult male goat was immunized with 0.5 mg of SP lyase in Ribi Adjuvant System (Ribi ImmunoChem Research Inc.) administered intramuscularly in the hind leg at two sites. A similar booster immunization of 0.5 mg of SP lyase in Ribi Adjuvant was administered 28 days later. Blood was collected on day 42, and antiserum was harvested from the clotted blood. Preimmune serum collected in a similar manner prior to immunization did not demonstrate any reactivity to SP lyase (data not shown). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting were performed essentially as described by Ausubel et al. (1). Immunostaining of Western blots was performed with rabbit anti-goat immunoglobulin G-peroxidase conjugate (Kirkegaard & Perry Laboratories, Inc.) as the secondary antibody.
Physicochemical techniques. UV-visible spectroscopy of purified SP lyase from the E. coli overexpression system (0.8 mg of protein/ml in 50 mM Tris-HCl [pH 8.0], 300 mM NaCl, 250 mM imidazole) was performed with a Hewlett-Packard Model 8453 spectrophotometer by using the same buffer without protein as a blank.
Chemical determination of iron, acid-labile sulfide, and flavin content of purified SP lyase from the E. coli overexpression strain was performed as described by Nielsen et al. (28). For iron analysis, aliquots of enzyme (800 µl containing various amounts of protein in 5 mM sodium phosphate [pH 6]) were mixed with 100 µl of 8 M HCl, incubated for 10 min at 0°C, precipitated with 100 µl of 80% trichloroacetic acid (TCA) for 10 min, and clarified by centrifugation. The pH of 800 µl of the supernatant was adjusted to 4.5 by addition of 200 µl of 75% ammonium acetate followed by addition of 80 µl of 10% hydroxylamine hydrochloride and 80 µl of 4 mM tripyridyl-s-triazine and incubation for 10 min. Iron was quantitated by measuring absorption at 593 nm. For determination of acid-labile sulfide, aliquots of enzyme (320 µl containing various amounts of protein) were treated with 2.6% Zn(CH3COO)2 and 0.75% NaOH for 2 h; 100 µl of 0.1% N,N-dimethyl-p-phenylenediamine dissolved in 5 M HCl and 40 µl of 11.5 mM FeCl3 in 0.6 M HCl were added, and the solution was mixed by shaking for 1 min. Next, 320 µl of water was added, the sample was clarified by centrifugation, and acid-labile sulfide was determined by measuring A670. For determination of flavin content, aliquots of enzyme were treated with 4% ammonium sulfate in 75% methanol. After pelleting the protein by centrifugation, the absorption spectrum of the supernatant was determined and compared with those of purified flavin mononucleotide and flavin adenine dinucleotide (28).SP lyase assays. SP lyase assays from crude spore extracts were performed by a modification of the protocol described for RNR by Ollagnier et al. (30). Stock solutions (prepared in 30 mM Tris-HCl [pH 8.0]) of dithionite (100 mM), DTT (50 mM), AdoMet (32 mM), and NADPH (10 mM) were purged of oxygen by bubbling a mixture of 80% N2-10% H2-10% CO2 through them for 20 min. Spores of strain WN417 were decoated and lysed as described above in 30 mM Tris-HCl (pH 8.0), followed by deoxygenation of the cell-free extract on ice for 20 min. Reaction mixtures (200 µl total volume) were assembled on ice in the following order: to cell-free extract (120 µl, containing approximately 200 µg of total protein) were added (final concentration) dithionite (1 mM), DTT (5 mM), NADPH (1 mM), AdoMet (1 mM), and 50,000 cpm of SP-containing spore DNA labelled with [methyl-3H]thymidine. Reaction mixtures were incubated in a 37°C water bath overnight. Samples were precipitated by addition of ice-cold TCA to 10% final concentration and incubation on ice for 30 min. The TCA precipitates were centrifuged, and the pellet was used for SP quantitation as described below.
Assay of SP lyase activity with enzyme purified on nickel-NTA agarose was performed by a slight modification of the procedure developed by Ollagnier et al. (30) for the E. coli anaerobic RNR. All solutions were deoxygenated prior to use with 52% H2-48% CO2. Six-His-tagged SP lyase was purified from spores by nickel-NTA chromatography as described above and treated with 4 mM DTT and 52% H2-48% CO2. To deoxygenated enzyme (0.5 or 1.0 µg of protein) and buffer the following were added (final concentration): sodium dithionite (3 mM), KCl (30 mM), sodium formate (5 mM), S-adenosylmethionine (2 mM; AdoMet), and 50,000 cpm of [methyl-3H]thymidine-labelled, SP-containing DNA. A separate and identical set of reaction mixtures lacking AdoMet was also prepared. After overnight incubation at 37°C, samples were subjected to TCA precipitation and SP quantitation as described below.SP quantitation. Germination samples and in vitro reaction mixtures were precipitated on ice for 30 min with 10% TCA and centrifuged. The pellets were resuspended in 0.5 ml trifluoroacetic acid (TFA), sealed under vacuum in 2.0-ml glass ampules, and hydrolyzed at 155°C for 60 min. TFA was evaporated, and the dried contents in each ampule were resuspended in 100 µl of water and subjected to descending chromatography on Whatman no. 1 paper with 80:12:30 (vol/vol/vol) n-butanol-acetic acid-water. The resulting chromatograms were cut into 1-cm fractions, and SP (Rf, 0.45) and thymine (Rf, 0.6) were quantitated by scintillation counting as described in detail previously (10, 26, 45).
| |
RESULTS |
|---|
|
|
|---|
UV resistance of spores carrying engineered SP lyases expressed at amyE. Construction and characterization of B. subtilis WN356, which lacks NER and in which the splAB operon has been deleted and replaced with an MLS resistance cassette, have been described in detail elsewhere (24). Plasmids pWN378 (encoding SP lyase with a C-terminal histidine tag) and pWN413 (encoding SP lyase with an N-terminal histidine tag) (Table 2) were inserted into the amyE locus by transformation into competent cells of strain WN356, resulting in strains WN390 and WN417, respectively (Table 1). The ability of the two engineered SP lyases to restore UV resistance to spores of strain WN356 was then tested (Fig. 1). It was observed that SP lyase with a C-terminal histidine tag expressed from amyE (strain WN390) conferred only slightly more UV resistance to spores than did insertion of the vector alone into the amyE locus of strain WN356 (Fig. 1). In contrast, strain WN417, which from the amyE locus expressed SP lyase with the N-terminal histidine tag, produced spores whose UV resistance was virtually indistinguishable from that of spores of strain WN386, a strain which carries the wild-type splAB operon at amyE (24) (Fig. 1). This in vivo experiment indicated that SP lyase biological activity was nearly abolished by addition of six histidines at its C-terminus, but was not significantly affected by addition of six histidines at its N-terminus. Therefore, strain WN417 was used in subsequent experiments.
|
Repair of SP during spore germination by histidine-tagged SP lyase. To confirm that the enhanced UV resistance observed in spores of strain WN417 (Fig. 1) was indeed due to DNA repair by SP lyase carrying the N-terminal histidine tag, SP repair was assayed during germination of UV-irradiated spores of strain WN417 and its parent strain WN356 (Fig. 2). The DNA in spores of strain WN417 and its parent strain WN356 was labelled by growth and sporulation in DSM supplemented with [methyl-3H]thymidine, spores were irradiated with UV to produce SP, and the kinetics of SP repair during germination was monitored (Fig. 2). It was observed that strain WN356, lacking NER and SP lyase, was unable to remove SP from germinating spore DNA, whereas strain WN417, carrying the N-terminal histidine-tagged SP lyase expressed from amyE, removed approximately 65% of SP from DNA during the first 90 min of germination (Fig. 2). Therefore, it appeared that SP repair during germination, and hence UV resistance, of strain WN417 were due to the activity of N-terminal histidine-tagged SP lyase.
|
Purification of histidine-tagged SP lyase. Dormant spores of strain WN417 were disrupted, the cell debris was removed by centrifugation, and the cell-free extract was passed through a nickel-NTA agarose column. Because SP lyase is present at very low quantities in dormant spores, SP lyase was visualized during purification by Western blot analysis with polyclonal antiserum raised against purified SP lyase from an E. coli overexpression system. Decoated, lysed spores of strain WN417 exhibited a 41-kDa protein which reacted with anti-SP lyase antiserum (Fig. 3, lane 2) and whose mass corresponded very closely to the calculated molecular mass of N-terminal histidine-tagged SP lyase (40,847 Da). The 41-kDa protein was absent from decoated, lysed spores of the parental strain WN356 (Fig. 3, lane 1). The 41-kDa protein band persisted in the cell-free extract after the spore lysate of strain WN417 was clarified by high-speed centrifugation (Fig. 3, lane 3), and the protein bound to a nickel-NTA agarose column, as it was absent from the flow-through fraction at 20 mM imidazole (Fig. 3, lane 4) but was present in the 250 mM imidazole eluate from the column (Fig. 3, lane 5). The 10×His-tagged SP lyase overexpressed in E. coli and isolated by the same procedure was essentially pure, demonstrating a single 43-kDa band on Coomassie blue-stained SDS-PAGE gel which (i) reacted with anti-SP lyase antibody on a Western blot and (ii) when subjected to automated N-terminal sequencing was found to have a sequence that perfectly matched the predicted amino acid sequence of the engineered 10×His-tagged SP lyase (data not shown).
|
Purified SP lyase contains iron and sulfur. During purification of the 10×His-tagged SP lyase overexpressed in E. coli, it was noted that as the cell-free extract was allowed to flow through the nickel-NTA agarose column a reddish-brown band appeared at the top of the column, which remained after washing the column with sonication buffer containing 20 mM imidazole (reference 2 and our unpublished results). Upon application of a linear 25 to 500 mM imidazole gradient, the colored band eluted at approximately 120 mM imidazole, along with SP lyase (data not shown). This observation, along with the characteristic smell of sulfide upon treatment of the purified SP lyase with acid, was consistent with SP lyase containing an Fe-S cluster. As we were unable to purify sufficient quantities of SP lyase from dormant B. subtilis spores to perform chemical analyses, we assayed the purified 10×His-tagged SP lyase obtained from the E. coli overexpression system for iron, acid-labile sulfide, and flavin content (28) (Table 3). The SP lyase purified from E. coli was found to contain 1.03 ± 0.26 mol of iron and 1.55 ± 0.04 mol of acid-labile sulfide per mol of protein (Table 3). As no special care had been taken to exclude oxygen from these enzyme preparations, the above values are probably underestimates of the in vivo stoichiometry of Fe and S. No flavin cofactors were detected by chemical assay of the SP lyase overexpressed from E. coli (data not shown).
|
UV-visible absorption spectrum of SP lyase. UV-visible absorption spectroscopy was performed on the 10×His-tagged SP lyase purified from E. coli in order to gain information regarding unusual structural features or the potential presence of UV-absorbing cofactors. The reddish-brown form of SP lyase obtained directly from the nickel-NTA agarose column exhibited a spectrum characteristic of an Fe-S protein (11a, 17, 45a), with peaks centered at 340, 400, and 472 nm (Fig. 4). Absorption peaks characteristic of potential chromophores, such as flavins, expected to be visualized at 377 and 452 nm (28) were not detected (Fig. 4). Upon addition of 1 mM (final concentration) dithionite to the purified SP lyase, the reddish-brown color immediately disappeared and the UV-visible absorption spectrum of the dithionite-treated SP lyase (30 min on ice) exhibited a dramatic shift (Fig. 4; see Discussion).
|
In vitro assay of SP lyase activity. Numerous previous attempts to detect SP lyase activity in vitro have been unsuccessful; however, the homology observed between SP lyase and the anaerobic RNR and PFL enzymes (24), coupled with the spectroscopic data indicating that the Fe-S cluster in SP lyase was partially oxidized upon purification (Fig. 4), presented the possibility that SP lyase would require at least reducing, if not anoxic, conditions for its activity. To assay SP lyase in vitro, we therefore modified conditions which were previously used to achieve in vitro activity of the anaerobic RNR of E. coli (29, 30). SP lyase activity was detected in vitro with cell-free spore extracts from strain WN417, encoding the N-terminal 6×His-tagged SP lyase (Fig. 5), but not from the parental strain WN356 treated in an identical manner (data not shown). When cell-free extracts prepared from strain WN417 were incubated under reducing conditions with SP-containing DNA, a paradoxical increase in SP was observed (Fig. 5), apparently due to enhanced TCA precipitation of small SP-containing DNA fragments bound by SP lyase (data not shown). Addition of either AdoMet or NADPH to the reaction mixture enabled the WN417 cell-free extract to correct approximately 20 and 25% of the SP present in the substrate DNA, respectively (Fig. 5). The two cofactors added in combination also stimulated SP repair activity in vitro, but not as effectively as either added alone (Fig. 5).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Repair of UV-induced DNA damage by SP lyase during spore germination is an important determinant of bacterial spore UV resistance (reviewed in references 14, 25, 42, and 49). We have shown in this report that SP lyase from B. subtilis is an Fe-S protein which requires reducing conditions and AdoMet for its activity, in a fashion similar to enzymes such as class III anaerobic RNR and to PFL.
The 6×His-tagged SP lyase was expressed in B. subtilis from the amyE locus by using its native transcriptional and translational signals; therefore, its level in the dormant spore is probably similar to that of native SP lyase. Calculation of the yield of the purified 6×His-tagged SP lyase from spores (approximately 1 µg of protein per 1.25 × 1011 spores) corresponds to approximately 100 to 200 subunit copies per spore. Because SP lyase is present at such a low concentration in spores, some of the physicochemical data reported here were derived from the splB gene product overexpressed in E. coli. Chemical extraction of flavin and spectral analysis (28) of the 10×His-tagged SP lyase purified from E. coli failed to detect flavin-containing compounds, consistent with the absence of absorption peaks characteristic of flavins in its UV-visible spectrum (Fig. 4). Chemical analysis of iron and acid-labile sulfide content (28) of the 10×His-tagged SP lyase purified from the E. coli overexpression system indicated 1.03 mol of iron and 1.60 mol of sulfide per mol of SP lyase subunit (Table 3), strongly suggesting that SP lyase contains an Fe-S center. The observed iron and sulfur stoichiometry of the purified 10×His-tagged SP lyase overexpressed in E. coli is probably an underestimate of the in vivo stoichiometry, as the protein was isolated under nonreducing conditions. The UV-visible spectrum of the 10×His-tagged SP lyase from E. coli (Fig. 4) is also characteristic of a protein containing an Fe-S cluster; the presence of absorption peaks in the SP lyase spectrum at 340, 400, and 472 nm are reminiscent of 2Fe-2S proteins such as biotin synthase (11a) and ferredoxin (45a). The dramatic shift in UV-visible spectrum of SP lyase upon reduction with dithionite is similar to that seen in 2Fe-2S to 4Fe-4S cluster conversion upon dithionite reduction of biotin synthase (11a). While definitive determination of which type of Fe-S cluster is contained by SP lyase awaits further characterization, the spectroscopic and chemical analysis data are consistent with the previous observation that the amino acid sequence of SP lyase contains a constellation of cysteine residues arranged in a manner highly homologous to the regions of the anaerobic RNR and PFL proteins which participate in 4Fe-4S cluster formation (24).
By using a modification of conditions used for assaying RNR activity (29; see Materials and Methods), SP lyase activity was detected in a cell-free extract prepared from dormant spores of strain WN417 (Fig. 5). This represents the first in vitro demonstration of SP lyase enzymatic activity, a significant first step toward characterizing the enzymatic mechanism of SP lyase in detail. Deoxygenated cell-free extract from strain WN417 dormant spores could not by itself repair SP in vitro, but activity was obtained by addition of either AdoMet or NADPH (Fig. 5). That AdoMet stimulated SP lyase activity seems reasonable, based upon the analogy with RNR and PFL, both of which require AdoMet for activity (29). Stimulation of SP lyase activity by NADPH addition to the cell-free extract from strain WN417 dormant spores may indicate that the reduced form of NADPH could be involved in a redox system used in vivo for regeneration of active-site cysteines, as seen in other RNRs (33). Interestingly, although dormant spores contain amounts of pyridine nucleotides comparable to vegetative cells, almost none is in the reduced form (43).
Chemical reduction of the 6×His-tagged SP lyase purified from
B. subtilis spores with formate resulted in activation
of the enzyme such that it required only AdoMet for activity (Fig.
6). However, we were unable to detect
activity from the 10×His-tagged SP lyase purified from the E. coli overexpression system pretreated identically. This result
suggests either that the loss or inactivation of some essential
factor(s) occurred during purification of the E. coli enzyme
or that the cloned splB locus by itself expressed in
E. coli does not encode the entire SP lyase
holoenzyme. By analogy to RNR or PFL, what we call SP
lyase encoded by splB would correspond only to
the
2 activating subunit of an
2
2 tetrameric holoenzyme. In anaerobic
RNR and in PFL, the activating subunits are homodimers which
associate through a 4Fe-4S cluster (30); separate
genetic evidence suggests that SP lyase may also be active as a
homodimer (24). The possibility therefore
presents itself that while the B. subtilis WN417 spore
contains the putative SP lyase holoenzyme, the E. coli
system expresses only the splB-encoded activating subunit.
Experiments are currently under way to identify the putative second
subunit.
Fe-S clusters have been shown to be ubiquitous and important
determinants of protein structure and enzymatic activity (reviewed in
reference 3) and have been shown to operate by such
diverse mechanisms as stabilization of the DNA binding site, as in the endonuclease III of E. coli (46); behaving as a
sensor of oxidative stress by changes in oxidation state, as in the
SoxR protein of E. coli (15, 16); or regulation
of DNA binding through oxidative assembly-disassembly of an
Fe-S cluster holding together two identical subunits, as in the
E. coli anaerobic transcriptional activator FNR (3,
17). Because SP lyase was found by an amino acid sequence
homology search to resemble the activating subunits of anaerobic RNR and PFL (24), these enzymes are
being used as models for probing in vitro SP lyase activity.
The enzymology of RNR and PFL is rather complex. Both enzymes are
active as
2
2 tetramers (29).
Enzymatic activity is dependent upon generation of an oxygen-labile
glycyl free radical in the larger
2 catalytic subunit.
The smaller
2 activating subunit dimerizes through an oxygen-labile 4Fe-4S cluster which in its reduced form participates in
splitting AdoMet into methionine and a 5'-deoxyadenosyl radical which then generates the glycyl radical in the
2
catalytic subunit by abstracting a hydrogen atom from the
-carbon of
glycine. AdoMet is thus required for activity (20). In
AdoMet-requiring enzymes which cleave C---H or C==C bonds, such as
PFL, anaerobic RNR, lysine 2,3-aminomutase, biotin synthase, and lipoic
acid synthase, a common theme appears to be oxidative degradation of
subunit-bridging 4Fe-4S clusters during purification to 2Fe-2S clusters
(11a). The 4Fe-4S cluster in the
2 subunit of
RNR can be reduced in vitro by treatment with either (i) flavodoxin,
flavodoxin reductase, and NADPH; (ii) photochemically reduced
5-deazaflavin; or (iii) dithionite (29). By analogy to these
enzymes, the Fe-S cluster in SP lyase also appears to share these
properties (Fig. 4). The results reported above with SP lyase are
important steps towards determination of the physical organization and
reaction mechanism of this unique DNA repair enzyme.
| |
ACKNOWLEDGMENTS |
|---|
We thank the following: Glenn Songer and Veronica Enriquez for assistance in antiserum preparation; Robert Switzer for helpful discussions; and the two anonymous reviewers for their insightful comments and suggestions.
This work was supported by grants from the National Institutes of Health (GM47461) and the American Cancer Society (JFRA-410) to W.L.N. and by an NIH Supplemental Grant for Underrepresented Minorities to R.R.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Veterinary Science and Microbiology, Building 90, Room 102, University of Arizona, Tucson, AZ 85721. Phone: (520) 621-2157. Fax: (520) 621-6366. E-mail: WLN{at}u.arizona.edu.
Present address: Department of Medicine, University of Miami, Coral
Gables, FL 33124.
Present address: Department of Chemistry and Biochemistry,
University of Oklahoma, Norman, OK 73019.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology. John Wiley and Sons, Inc., New York, N.Y. |
| 2. | Begley, T. Personal communication. |
| 3. |
Beinert, H.,
R. H. Holm, and E. Münck.
1997.
Iron-sulfur clusters: nature's modular, multipurpose structures.
Science
277:653-659 |
| 4. |
Billington, S. J.,
B. H. Jost,
W. A. Cuevas,
K. R. Bright, and J. G. Songer.
1997.
The Arcanobacterium (Actinomyces) pyogenes hemolysin, pyolysin, is a novel member of the thiol-activated cytolysin family.
J. Bacteriol.
179:6100-6106 |
| 5. |
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523 |
| 6. |
Boylan, R. J.,
N. H. Mendelson,
D. Brooks, and F. E. Young.
1972.
Regulation of the bacterial cell wall: analysis of a mutant of Bacillus subtilis defective in biosynthesis of teichoic acid.
J. Bacteriol.
110:281-290 |
| 7. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline]. |
| 8. |
Brennan, R. G., and B. W. Matthews.
1989.
The helix-turn-helix DNA binding motif.
J. Biol. Chem.
264:1903-1906 |
| 9. | Cutting, S. M., and P. B. Vander Horn. 1990. Genetic analysis, p. 27-74. In C. R. Harwood, and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley and Sons, Sussex, England. |
| 10. |
Donnellan, J. E., Jr., and R. B. Setlow.
1965.
Thymine photoproducts but not thymine dimers are found in ultraviolet irradiated bacterial spores.
Science
149:308-310 |
| 11. | Donnellan, J. E., Jr., and R. S. Stafford. 1968. The ultraviolet photochemistry and photobiology of vegetative cells and spores of Bacillus megaterium. Biophys. J. 8:17-28. |
| 11a. | Duin, E. C., M. E. Lafferty, B. R. Crouse, R. M. Allen, I. Sanyal, D. H. Flint, and M. K. Johnson. 1997. [2Fe-2S] to [4Fe-4S] cluster conversion in Escherichia coli biotin synthase. Biochemistry 36:11811-11820[Medline]. |
| 12. |
Fajardo-Cavazos, P., and W. L. Nicholson.
1995.
Molecular dissection of mutations in the Bacillus subtilis spore photoproduct lyase gene which affect repair of spore DNA damage caused by UV radiation.
J. Bacteriol.
177:4402-4409 |
| 13. |
Fajardo-Cavazos, P.,
C. Salazar, and W. L. Nicholson.
1993.
Molecular cloning and characterization of the Bacillus subtilis spore photoproduct lyase (spl) gene, which is involved in repair of UV radiation-induced DNA damage during spore germination.
J. Bacteriol.
175:1735-1744 |
| 14. | Friedberg, E. C., G. C. Walker, and W. Siede. 1995. DNA repair and mutagenesis. American Society for Microbiology, Washington, D.C. |
| 15. |
Gaudu, P., and B. Weiss.
1996.
SoxR, a (2Fe-2S) transcription factor, is active only in its oxidized form.
Proc. Natl. Acad. Sci. USA
93:10094-10098 |
| 16. |
Hidalgo, E.,
J. M. Bollinger, Jr.,
T. M. Bradley,
C. T. Walsh, and B. Demple.
1995.
Binuclear (2Fe-2S) clusters in the Escherichia coli SoxR protein and role of the metal centers in transcription.
J. Biol. Chem.
270:20908-20914 |
| 17. |
Lazazzera, B. A.,
H. Beinert,
N. Khoroshilova,
M. C. Kennedy, and P. J. Kiley.
1996.
DNA binding and dimerization of the Fe-S-containing FNR protein from Escherichia coli are regulated by oxygen.
J. Biol. Chem.
271:2762-2768 |
| 18. |
Lin, J.-J., and A. Sancar.
1990.
Reconstitution of nucleotide excision nuclease with UvrA and UvrB proteins from Escherichia coli and UvrC protein from Bacillus subtilis.
J. Biol. Chem.
265:21337-21341 |
| 19. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 20. |
Mulliez, E.,
M. Fontecave,
J. Gaillard, and P. Reichard.
1993.
An iron sulfur center and a free radical in the active anaerobic ribonucleotide reductase of Escherichia coli.
J. Biol. Chem.
268:2296-2299 |
| 21. | Munakata, N. 1969. Genetic analysis of a mutant of Bacillus subtilis producing ultraviolet-sensitive spores. Mol. Gen. Genet. 104:258-263[Medline]. |
| 22. |
Munakata, N., and C. S. Rupert.
1972.
Genetically controlled removal of "spore photoproduct" from deoxyribonucleic acid of ultraviolet-irradiated Bacillus subtilis spores.
J. Bacteriol.
111:192-198 |
| 23. | Munakata, N., and C. S. Rupert. 1974. Dark repair of DNA containing "spore photoproduct" in Bacillus subtilis. Mol. Gen. Genet. 130:239-250[Medline]. |
| 24. | Nicholson, W. L., L. Chooback, and P. Fajardo-Cavazos. 1997. Analysis of spore photoproduct lyase operon (splAB) function using targeted deletion-insertion mutations spanning the Bacillus subtilis ptsHI and splAB operons. Mol. Gen. Genet. 255:587-594[Medline]. |
| 25. | Nicholson, W. L., and P. Fajardo-Cavazos. 1997. DNA repair and the ultraviolet radiation resistance of bacterial spores: from the laboratory to the environment., p. 125-140. In S. Pandalai (ed.), Recent research developments in microbiology, vol. 1. Research Signpost, Trivandrum, India. |
| 26. |
Nicholson, W. L.,
B. Setlow, and P. Setlow.
1991.
Ultraviolet irradiation of DNA complexed with / -type small, acid-soluble proteins from spores of Bacillus or Clostridium species makes spore photoproduct but not thymine dimers.
Proc. Natl. Acad. Sci. USA
88:8288-8292 |
| 27. | Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination, and outgrowth, p. 391-450. In C. R. Harwood, and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley and Sons, Sussex, England. |
| 28. |
Nielsen, F. S.,
P. S. Andersen, and K. F. Jensen.
1996.
The B form of dihydroorotate dehydrogenase from Lactococcus lactis consists of two different subunits, encoded by the pyrDb and pyrK genes, and contains FMN, FAD, and [FeS] redox centers.
J. Biol. Chem.
271:29359-29365 |
| 29. |
Ollagnier, S.,
E. Mulliez,
J. Gaillard,
R. Eliasson,
M. Fontecave, and P. Reichard.
1996.
The anaerobic Escherichia coli ribonucleotide reductase: subunit structure and iron-sulfur center.
J. Biol. Chem.
271:9410-9416 |
| 30. |
Ollagnier, S.,
E. Mulliez,
P. P. Schmidt,
R. Eliasson,
J. Gaillard,
C. Deronzier,
T. Bergman,
A. Gräslund,
P. Reichard, and M. Fontcave.
1997.
Activation of the anaerobic ribonucleotide reductase from Escherichia coli. The essential role of the iron-sulfur center for S-adenosylmethionine reduction.
J. Biol. Chem.
272:24216-24223 |
| 31. |
Pedraza-Reyes, M.,
F. Gutiérrez-Corona, and W. L. Nicholson.
1994.
Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation.
J. Bacteriol.
176:3983-3991 |
| 32. | Pedraza-Reyes, M., F. Gutiérrez-Corona, and W. L. Nicholson. 1997. Spore photoproduct lyase operon (splAB) regulation during Bacillus subtilis sporulation: modulation of splB-lacZ fusion expression by P1 promoter mutations and by an in-frame deletion of splA. Curr. Microbiol. 34:133-137[Medline]. |
| 33. | Reichard, P. 1997. The evolution of ribonucleotide reduction. Trends Biochem. Sci. 22:81-85[Medline]. |
| 34. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. | Sancar, A. 1994. Structure and function of DNA photolyase. Biochemistry 33:2-9[Medline]. |
| 36. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 37. |
Schaeffer, P.,
J. Millet, and J.-P. Aubert.
1965.
Catabolic repression of bacterial sporulation.
Proc. Natl. Acad. Sci. USA
54:704-711 |
| 38. | Setlow, P. 1988. Resistance of bacterial spores to ultraviolet light. Comments Mol. Cell. Biophys. 5:253-264. |
| 39. |
Setlow, P.
1992.
I will survive: protecting and repairing spore DNA.
J. Bacteriol.
174:2737-2741 |
| 40. | Setlow, P. 1992. DNA in dormant spores of Bacillus species is in an A-like conformation. Mol. Microbiol. 6:563-567[Medline]. |
| 41. | Setlow, P. 1994. DNA structure, spore formation, and spore properties., p. 181-194. In P. J. Piggot, C. P. Moran, Jr., and P. Youngman (ed.), Regulation of bacterial differentiation. American Society for Microbiology, Washington, D.C. |
| 42. | Setlow, P. 1995. Mechanisms for the prevention of damage to DNA in spores of Bacillus species. Annu. Rev. Microbiol. 49:29-54[Medline]. |
| 43. |
Setlow, P., and A. Kornberg.
1970.
Biochemical studies of bacterial sporulation and germination. XXII. Energy metabolism in early stages of germination of Bacillus megaterium spores.
J. Biol. Chem.
245:3637-3644 |
| 44. | Stuy, J. H. 1956. Studies on the mechanism of radiation inactivation of microorganisms. III. Inactivation of germinating spores of Bacillus cereus. Biochim. Biophys. Acta 22:241-246. |
| 45. | Sun, Y., K. Palasingam, and W. L. Nicholson. 1994. High-pressure liquid chromatography assay for quantitatively monitoring spore photoproduct repair mediated by spore photoproduct lyase during germination of UV-irradiated Bacillus subtilis spores. Anal. Biochem. 221:61-65[Medline]. |
| 45a. |
Tang, C., and H. L. Henry.
1993.
Overexpression in Escherichia coli and affinity purification of chick kidney ferredoxin.
J. Biol. Chem.
268:5069-5076 |
| 46. | Thayer, M. M., H. Ahern, D. Xing, R. P. Cunningham, and J. A. Tainer. 1995. Novel DNA binding motifs in the DNA repair enzyme endonuclease III crystal structure. EMBO J. 14:4108-4120[Medline]. |
| 47. | Todo, T., H. Ryo, K. Yamamoto, H. Toh, T. Inui, H. Ayaki, T. Nomura, and M. Ikenaga. 1996. Similarity among the Drosophila (6-4) photolyase, a human photolyase homolog, and the DNA photolyase-blue-light photoreceptor family. Science 272:109-112[Abstract]. |
| 48. | Wang, T.-C.V., and C. S. Rupert. 1977. Evidence for the monomerization of spore photoproduct to two thymines by the light-independent "spore repair" process in Bacillus subtilis. Photochem. Photobiol. 25:123-127[Medline]. |
| 49. | Yasbin, R. E., D. Cheo, and D. Bol. 1993. DNA repair systems, p. 529-537. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»