Previous Article | Next Article 
Journal of Bacteriology, September 1998, p. 4938-4941, Vol. 180, No. 18
Section of Microbiology, Division of
Biological Sciences, University of California, Davis, California
95616,1 and
Marine Biology Research
Division, Scripps Institution of Oceanography, University of
California at San Diego, La Jolla, California
92093-02022
Received 6 February 1998/Accepted 8 July 1998
An alternative group 2 sigma factor was identified in the
nitrogen-fixing, symbiotically competent cyanobacterium Nostoc
punctiforme and designated sigH. Transcription of
sigH was specifically induced within 1.5 h following
exposure of N. punctiforme to its symbiotic plant partner,
Anthoceros punctatus. A mutation in sigH
resulted in a sixfold-higher initial infection of A. punctatus tissue without a parallel increase in nitrogen-fixing
activity.
Sigma factor proteins are
responsible for conferring promoter-specific contacts upon the RNA
polymerase enzyme of eubacteria, thereby allowing specific genes to be
transcribed (11). Comparative sequence analysis has revealed
that there are two fundamental families of sigma factors in eubacteria.
These are referred to as the Some filamentous cyanobacteria have multiple cellular developmental
alternatives as well as nutritional versatility. Adaptation in response
to environmental stimuli in these organisms is presumed to be mediated
by distinct regulatory systems, resulting in differential gene
expression. However, the mechanisms of differential gene expression in
cyanobacteria that are responsible for adaptation to environmental
changes or initiation of cellular differentiation are not well
understood (6).
Filamentous heterocyst-forming (sites of nitrogen fixation in air)
Nostoc punctiforme ATCC 29133 (PCC 73102) is facultatively heterotrophic and regulates transcription of carbon catabolic genes
(18). In addition to heterocysts, N. punctiforme
differentiates spore-like akinetes in response to phosphate or energy
limitation (18) and gliding filaments called hormogonia
(2). N. punctiforme can form a symbiotic
association, via infection by hormogonium filaments, with pure cultures
of the bryophyte hornwort Anthoceros punctatus (9,
15). In symbiosis, two of the developmental alternatives,
hormogonium formation and heterocyst formation, are enhanced (2,
3). Although this symbiotic association has been characterized
physiologically (15), little is known about the changes in
gene expression resulting in the Nostoc sp. adaptation to
the symbiotic growth state. Since one way bacteria regulate
transcription of specific sets of genes is by alteration of the sigma
subunit of RNA polymerase, we have examined the potential role of an
alternative sigma factor in N. punctiforme development and
symbiotic interaction.
Identification of sigH and ctpH.
The
Anabaena sp. strain PCC 7120 group 2 sigma factor gene,
sigB (1), hybridized to multiple bands of
digested genomic DNA from N. punctiforme. Only one of the
hybridizing fragments is characterized here. A strongly hybridizing
2.9-kb EcoRI fragment from cosmid p1G9 of N. punctiforme genomic DNA (5) was subcloned into the
EcoRI site of pBluescript KS(+) to yield pSCR213. Sequencing of the 2.9-kb EcoRI fragment in pSCR213 revealed two open
reading frames (ORF) (Fig. 1). One ORF,
966 bp long, shows high similarity to sigma factor genes from the
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Mutation of an Alternative Sigma Factor in the
Cyanobacterium Nostoc punctiforme Results in Increased
Infection of Its Symbiotic Plant Partner, Anthoceros
punctatus
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
70 and 54
families, by virtue of their similarities either to the principal Escherichia coli sigma factor, 70, or to
E. coli 54, which is responsible for
transcription of nitrogen-regulated genes. Within the 70
family, three classes are recognized on the basis of function and
sequence similarity (14). Group 1 comprises the primary, or
housekeeping, sigma factors, which are essential for exponential cell
growth. Group 2 sigma factors exhibit sequence similarity to the group
1 sigma factors
especially in the regions which may recognize promoter
sequencesbut are dispensable for exponential cell growth. Group 3 sigma factors, which are the most divergent ones, fall into specialized
subgroups and are required for initiating transcription at distinct
promoters, such as ones for heat shock, motility, or sporulation genes
(14). Specific environmental changes may result in
activation of some group 2 or 3 sigma factors, leading to differential
gene expression and adaptation to the new environment.
70 family and was designated sigH. N. punctiforme SigH has a deduced molecular mass of 36,904 Da. The
amino acid sequence of SigH is 72, 64, and 59% similar to the
alternative sigma factors, SigB and SigC, and the primary sigma factor,
SigA, respectively, of Anabaena sp. strain PCC 7120. The
similarity of SigH to alternative sigma factors identified in
unicellular cyanobacteria is no greater: SigH has 53% similarity to
SigE of Synechococcus sp. strain PCC 7002 (12)
and 64% similarity to RpoD2 of Synechococcus sp. strain PCC
7942 (19). An amino acid alignment of the SigH, SigB, SigC, and SigA proteins shows a high degree of conservation in regions 1 to 4 and especially in regions 2.4 and 4.2 (Fig.
2) of sigma factors of the
70 family. The amino acids likely to be responsible for
base-specific contacts in the promoter regions by analogy to E. coli 70-type sigma factors (7, 10) are
also found in all four cyanobacterial sigma proteins.
View larger version (7K):
[in a new window]
FIG. 1.
Restriction map of the sigH and
ctpH genetic region showing the approximate site and
orientation of the antibiotic insertion in sigH.
PpsbAnpt designates the neomycin
phosphotransferase gene with the PpsbA promoter;
its size is not drawn to the same scale as the rest of the figure, as
indicated by breaks within the gene. Arrows indicate the direction of
transcription. The approximate location of the probe used in Northern
hybridization is indicated beneath sigH.
View larger version (45K):
[in a new window]
FIG. 2.
Amino acid sequence alignment of N. punctiforme ATCC 29133 SigH and Anabaena sp. strain PCC
7120 SigA, SigB, and SigC. Asterisks indicate identical amino acids and
dots indicate conserved amino acid changes, as defined in reference
13. Lines drawn above indicate regions 1 to 4 of
sigma factors as defined in reference 14. Dashes
indicate gaps introduced during the alignment process. Amino acids in
bold are those which may make base-specific contacts with promoter
sequences by analogy with E. coli sigma factors.
Phenotype of the sigH mutant. An insertion mutation in sigH was constructed by ligation of a neomycin phosphotransferase gene (npt) transcribed by the PpsbA promoter (from plasmid pRL448 [8]) into the unique Esp3I site of sigH (Fig. 1). The direction of transcription of the inserted npt gene coincides with the direction of sigH transcription such that the upstream gene, ctpH, is not affected by antisense transcripts and any cotranscribed downstream genes will now be transcribed from the PpsbA promoter. An ORF with a translational start point 246 bp 3' of the translational stop site of sigH has been partially sequenced from the cosmid p1G9; the predicted product of this ORF shows similarity to membrane fusion proteins involved in drug resistance and a hypothetical protein from Synechocystis sp. strain PCC 6803. Based on Southern hybridization and PCR amplification (data not shown), this ORF is also adjacent to sigH in the genome of N. punctiforme and is transcribed in the same direction as sigH. However, based on Northern hybridization with an internal PCR-generated probe, this ORF is neither cotranscribed with sigH nor transcribed under steady-state growth or hormogonium induction conditions (data not shown). Thus, the insertion should disrupt only sigH, and the resultant phenotype is unlikely to be a consequence of polar disruption of an undescribed gene adjacent to sigH.
The N. punctiforme sigH mutant, strain UCD 398, had no obvious phenotypic defects under photoautotrophic or heterotrophic culture conditions, with or without added combined nitrogen. Strain UCD 398 formed visibly normal akinetes upon entry into the stationary growth phase, similar to the parental wild-type strain. Since the N. punctiforme sigH product is dispensable for exponential growth and is highly similar at an amino acid level to other70 factors, it is by definition a group 2 sigma factor
of the 70 family.
Upon coculture of mutant UCD 398 with A. punctatus, a higher
level of infection was observed than with the wild-type strain. Following 2 weeks of coculture, strain UCD 398 formed 1.2 ± 0.2 (mean ± standard error) (n = 19, where
n equals the number of replicate experiments) symbiotic
colonies per mg (dry weight) of A. punctatus tissue per µg
of chlorophyll (Chl) a of the N. punctiforme
inoculum. Conversely, in the same coculture period, the wild-type
N. punctiforme strain, ATCC 29133, formed 0.21 ± 0.04 (n = 25) symbiotic colonies per mg (dry weight) µg of
Chl a inoculum. The sixfold increase in symbiotic colonies
over the wild type is similar to the infection frequency observed with mutations in the hrm operon of N. punctiforme
(4).
Despite the sixfold increase in the number of symbiotic colonies per
unit of A. punctatus tissue, the total amount of nitrogen fixation activity in mutant strain UCD 398-A. punctatus
associated tissue remained essentially the same as that of the
wild-type association as measured by acetylene reduction after 2 weeks
of coculture. The mutant reduced 8.0 ± 3.9 (n = 4) nmol of C2H2 per min per g (fresh weight) of
strain UCD 398-A. punctatus associated tissue versus
6.3 ± 1.2 (n = 14) nmol of
C2H2 per min per g (fresh weight) of wild-type
associated tissue. The proportionally elevated number of colonies
decreased as the A. punctatus tissue continued to grow, such
that after 9 weeks of coculture both mutant and wild-type reconstituted
associations contained about 0.1 symbiotic colony per mg (dry weight)
per µg of Chl a. These results are consistent with
previous observations that the host plant regulates the level of
heterocyst differentiation and/or total nitrogen fixation capability in
the associated tissue (9, 15, 17).
Because the phenotype of a sigH mutant is similar to those
of strains with mutations of the hrm operon, the potential
epistatic relationship between sigH and the hrm
operon was examined. A hrmA-luxAB fusion was constructed in
the sigH mutant background by recombination following
conjugation of the suicide plasmid pSCR9 (4) into strain UCD
398, creating strain UCD 417. Transcription of the hrm
operon is induced specifically by an A. punctatus extract containing a hormogonium-repressing factor (4). Strain UCD 417 showed no significant difference in the induction of
hrmA-luxAB by plant extract (peak of 1.5 × 106 ± 0.7 × 106 cpm µg of Chl
a
1; n = 6) compared with the
same reporter construction in the wild-type sigH background
(peak of 2.0 × 106 ± 1 × 106 cpm
µg of Chl a1; n = 6). Thus,
we conclude that the high-initial-infection phenotypes resulting from a
sigH mutation or mutations within the hrm operon reflect dual genetic pathways that are not transcriptionally linked.
Transcription of sigH. Transcription of sigH under steady-state growth conditions and following exposure to plant factors or environmental shifts was examined by Northern blot analysis. RNA was isolated by the method of Schmidt-Goff and Federspiel (16) and probed with an internal sigH fragment (shown in Fig. 1) generated by PCR with the following primers: 5' GCTAGTAACACAAACAAAGC 3' and 5' TGTGATATAGCTGTTAGAAG 3'.
As expected for a group 2 sigma factor, no sigH transcript was detectable by Northern blotting under normal vegetative growth conditions (time zero [Fig. 3]). However, a 1,250-nucleotide sigH transcript was present within 1.5 h following exposure of N. punctiforme cells to plant culture medium conditioned by incubation of A. punctatus in the absence of combined nitrogen (Fig. 3). Nitrogen starvation of A. punctatus was previously shown to elicit extracellular production of factors (termed hormogonium-inducing factors [HIF]) which enhance the production of the Nostoc sp. hormogonium filaments that subsequently serve as infective units in establishment of the symbiosis (2). The coding region of sigH consists of 966 bp; thus, the transcript size is consistent with that of a monocistronic message. Transcription of sigH appeared to increase slightly at 6 h and then declined. The high-molecular-mass smear in Fig. 3 appears to be characteristic of the sigH probe; it was not evident when this blot was probed with ctpH, but it was evident in RNA samples additionally treated with DNase and probed with sigH (data not shown).
|
2), heat shock (37°C), oxidative stress (120 µM
H2O2), and osmotic stress (50 mM fructose); or
stationary growth phase (akinetes present in the culture) (data not
shown). Consistent with our conclusion that sigH is not
involved in transcription of the hrm operon, plant extract
containing hormogonium-repressing factor, which induces transcription
of the hrm operon (4), did not induce the
transcription of sigH as determined by Northern blot analysis (data not shown).
We have now identified a second genetic target in N. punctiforme that responds to chemical signals from A. punctatus. We expect that the identification of genes whose
transcription is dependent upon SigH will clarify the nature of its
altered response to plant factors and lead to the discovery of
additional genes involved in symbiotic interactions.
Nucleotide sequence accession numbers. Nucleotide sequences have been deposited in the GenBank data base under accession no. AF022822 for sigH and AF022823 for ctpH.
| |
ACKNOWLEDGMENTS |
|---|
We thank F. Wong for confirming the second-strand sequence of sigH and K. Hagen for contributions of acetylene reduction values for the wild-type association. We thank the above as well as T. Hanson and F. F. del Campo for critical reading of the manuscript.
This work was supported by the National Science Foundation (grant IBN 95-14787).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Section of Microbiology, Division of Biological Sciences, University of California, One Shields Ave., Davis, CA 95616. Phone: 530-752-3346. Fax: 530-752-9014. E-mail: jcmeeks{at}ucdavis.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Brahamsha, B., and R. Haselkorn.
1992.
Identification of multiple RNA polymerase sigma factor homologs in the cyanobacterium Anabaena sp. strain PCC 7120: cloning, expression, and inactivation of the sigB and sigC genes.
J. Bacteriol.
174:7273-7282 |
| 2. |
Campbell, E. L., and J. C. Meeks.
1989.
Characteristics of hormogonia formation by symbiotic Nostoc spp. in response to the presence of Anthoceros punctatus or its extracellular products.
Appl. Environ. Microbiol.
55:125-131 |
| 3. | Campbell, E. L., and J. C. Meeks. 1992. Evidence for plant-mediated regulation of nitrogenase expression in the Anthoceros-Nostoc symbiotic association. J. Gen. Microbiol. 138:473-480. |
| 4. | Cohen, M. F., and J. C. Meeks. 1997. A hormogonium regulating locus, hrmUA, of the cyanobacterium Nostoc punctiforme strain ATCC 29133 and its response to an extract of a symbiotic plant partner Anthoceros punctatus. Mol. Plant-Microbe Interact. 10:280-289[Medline]. |
| 5. |
Cohen, M. F.,
J. G. Wallis,
E. L. Campbell, and J. C. Meeks.
1994.
Transposon mutagenesis of Nostoc sp. strain ATCC 29133, a filamentous cyanobacterium with multiple cellular differentiation alternatives.
Microbiology
140:3233-3240 |
| 6. | Curtis, S. E., and J. A. Martin. 1994. The transcriptional apparatus and the regulation of transcription initiation, p. 613-639. In D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands. |
| 7. |
Daniels, D.,
P. Zuber, and R. Losick.
1990.
Two amino acids in an RNA polymerase factor involved in the recognition of adjacent base pairs in the  10 region of a cognate promoter.
Proc. Natl. Acad. Sci. USA
87:8075-8079 |
| 8. | Elhai, J., and C. P. Wolk. 1988. A versatile class of positive-selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68:119-138[Medline]. |
| 9. | Enderlin, C. S., and J. C. Meeks. 1983. Pure culture and reconstitution of the Anthoceros-Nostoc symbiotic association. Planta 158:157-165. |
| 10. |
Gardella, T.,
H. Moyle, and M. M. Susskind.
1989.
A mutant Escherichia coli 70 subunit of RNA polymerase with altered promoter specificity.
J. Mol. Biol.
206:579-590[Medline].
|
| 11. | Gross, C. A., M. Lonetto, and R. Losick. 1992. Bacterial sigma factors, p. 129-176. In K. Yamamoto, and S. Mcknight (ed.), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 12. | Gruber, T. M., and D. A. Bryant. 1998. Characterization of the alternative sigma factors SigD and SigE in Synechococcus sp. strain PCC 7002. SigE is implicated in transcription of post-exponential-phase-specific genes. Arch. Microbiol. 169:211-219[Medline]. |
| 13. | Hellman, J. D., and M. J. Chamberlin. 1988. Structure and function of bacterial sigma factors. Annu. Rev. Biochem. 57:839-872[Medline]. |
| 14. |
Lonetto, M.,
M. Gribskov, and C. A. Gross.
1992.
The 70 family: sequence conservation and evolutionary relationships.
J. Bacteriol.
174:3843-3849 |
| 15. | Meeks, J. C. 1998. Symbiosis between nitrogen-fixing cyanobacteria and plants. BioScience 48:266-276. |
| 16. |
Schmidt-Goff, C. M., and N. A. Federspiel.
1993.
In vivo and in vitro footprinting of a light-regulated promoter in the cyanobacterium Fremyella diplosiphon.
J. Bacteriol.
175:1806-1813 |
| 17. |
Steinberg, N. A., and J. C. Meeks.
1991.
Physiological sources of reductant for nitrogen fixation activity in Nostoc sp. strain UCD 7801 in symbiotic association with Anthoceros punctatus.
J. Bacteriol.
173:7324-7329 |
| 18. |
Summers, M. L.,
J. G. Wallis,
E. L. Campbell, and J. C. Meeks.
1995.
Genetic evidence of a major role for glucose-6-phosphate dehydrogenase in nitrogen fixation and dark growth of the cyanobacterium Nostoc sp. strain ATCC 29133.
J. Bacteriol.
177:6184-6194 |
| 19. | Tsinoremas, N. F., M. Ishiura, T. Kondo, C. R. Anderson, K. Tanaka, H. Takahashi, C. H. Johnson, and S. S. Golden. 1996. A sigma factor that modifies the circadian expression of a subset of genes in cyanobacteria. EMBO J. 15:2488-2495[Medline]. |
Journal of Bacteriology, September 1998, p. 4938-4941, Vol. 180, No. 18
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chapman, K. E., Duggan, P. S., Billington, N. A. née, Adams, D. G.
(2008). Mutation at Different Sites in the Nostoc punctiforme cyaC Gene, Encoding the Multiple-Domain Enzyme Adenylate Cyclase, Results in Different Levels of Infection of the Host Plant Blasia pusilla. J. Bacteriol.
190: 1843-1847
[Abstract] [Full Text] -
Adams, D. G., Duggan, P. S.
(2008). Cyanobacteria-bryophyte symbioses. J Exp Bot
59: 1047-1058
[Abstract] [Full Text] -
Campbell, E. L., Summers, M. L., Christman, H., Martin, M. E., Meeks, J. C.
(2007). Global Gene Expression Patterns of Nostoc punctiforme in Steady-State Dinitrogen-Grown Heterocyst-Containing Cultures and at Single Time Points during the Differentiation of Akinetes and Hormogonia. J. Bacteriol.
189: 5247-5256
[Abstract] [Full Text] -
Osanai, T., Kanesaki, Y., Nakano, T., Takahashi, H., Asayama, M., Shirai, M., Kanehisa, M., Suzuki, I., Murata, N., Tanaka, K.
(2005). Positive Regulation of Sugar Catabolic Pathways in the Cyanobacterium Synechocystis sp. PCC 6803 by the Group 2 {sigma} Factor SigE. J. Biol. Chem.
280: 30653-30659
[Abstract] [Full Text] -
Meeks, J. C., Elhai, J.
(2002). Regulation of Cellular Differentiation in Filamentous Cyanobacteria in Free-Living and Plant-Associated Symbiotic Growth States. Microbiol. Mol. Biol. Rev.
66: 94-121
[Abstract] [Full Text] -
Wong, F. C. Y., Meeks, J. C.
(2002). Establishment of a functional symbiosis between the cyanobacterium Nostoc punctiforme and the bryophyte Anthoceros punctatus requires genes involved in nitrogen control and initiation of heterocyst differentiation. Microbiology
148: 315-323
[Abstract] [Full Text] -
Khudyakov, I. Y., Golden, J. W.
(2001). Identification and Inactivation of Three Group 2 Sigma Factor Genes in Anabaena sp. Strain PCC 7120. J. Bacteriol.
183: 6667-6675
[Abstract] [Full Text] -
Nair, U., Thomas, C., Golden, S. S.
(2001). Functional Elements of the Strong psbAI Promoter of Synechococcus elongatus PCC 7942. J. Bacteriol.
183: 1740-1747
[Abstract] [Full Text] -
Muro-Pastor, A. M., Herrero, A., Flores, E.
(2001). Nitrogen-Regulated Group 2 Sigma Factor from Synechocystis sp. Strain PCC 6803 Involved in Survival under Nitrogen Stress. J. Bacteriol.
183: 1090-1095
[Abstract] [Full Text] -
Huckauf, J., Nomura, C., Forchhammer, K., Hagemann, M.
(2000). Stress responses of Synechocystis sp. strain PCC 6803 mutants impaired in genes encoding putative alternative sigma factors. Microbiology
146: 2877-2889
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»