Previous Article | Next Article 
Journal of Bacteriology, September 1998, p. 4950-4954, Vol. 180, No. 18
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Characterization of a Novel Acyl Carrier Protein, RkpF, Encoded
by an Operon Involved in Capsular Polysaccharide Biosynthesis
in Sinorhizobium meliloti
Guido
Epple,1
Koen M. G. M.
van der Drift,2
Jane E.
Thomas-Oates,2 and
Otto
Geiger1,*
Institute of Biotechnology, Technical
University Berlin, Berlin, Germany,1 and
Bijvoet Center for Biomolecular Research, Department of Mass
Spectrometry, Utrecht University, 3584 CA Utrecht, The
Netherlands2
Received 12 February 1998/Accepted 17 July 1998
 |
ABSTRACT |
Rhizobial capsular polysaccharides (RKPs) play an important role in
the development of a nitrogen-fixing symbiosis with the plant host and
in Sinorhizobium meliloti AK631 functional
rkpABCDEF genes are required for the production of RKPs.
After cloning the rkpF gene, we overexpressed and purified
the derived protein product (RkpF) in Escherichia coli.
Like acyl carrier protein (ACP), the RkpF protein can be labeled in
vivo with radioactive
-alanine added to the growth medium. If
homogeneous RkpF protein is incubated with radiolabeled coenzyme A in
the presence of purified holo-ACP synthase from E. coli, an
in vitro transfer of 4'-phosphopantetheine to the RkpF protein can be
observed. The conversion from apo-RkpF protein to holo-RkpF protein
seems to go along with a major conformational change of the protein
structure, because the holo-RkpF protein runs significantly faster
on native polyacrylamide gel electrophoresis than the apo-RkpF protein.
Electrospray mass spectrometric analysis reveals a mass of 9,585 for
the apo-RkpF protein and a mass of 9,927 for the holo-RkpF protein. Our
data show that RkpF is a novel ACP.
 |
TEXT |
The interaction of bacteria of the
genera Rhizobium, Sinorhizobium,
Azorhizobium, and Bradyrhizobium,
collectively called rhizobia, with the roots of leguminous host
plants leads to the formation of a new organ, the nodule, in which
atmospheric nitrogen is fixed. During the early events of nodulation,
plant flavonoids induce the nod genes, which are rhizobial
genes essential for nodulation. Most of the nod genes
are involved in the production of lipo-chitin oligosaccharide
signal molecules, which are able to induce nodule primordia on their
respective host plants (31). The later events of nodule
development leading to a mature, nitrogen-fixing nodule are less well
understood. For the infection of host plants that form indeterminate
nodules, the production of extracellular polysaccharides (EPSs) by the
microsymbiont is generally thought to be an essential requirement.
However, an exoB-deficient mutant of
Sinorhizobium (formerly Rhizobium)
meliloti 41, S. meliloti AK631, is unable to
produce EPSs but still forms mature, nitrogen-fixing nodules
(22). In S. meliloti AK631, a novel acidic
polysaccharide that is rich in
3-deoxy-D-manno-2-octulosonic acid (Kdo) but different from
classical lipopolysaccharide (24) can take over the
functional role of EPSs with regard to the formation of nitrogen-fixing
nodules in an exo mutant. This novel polysaccharide is
structurally analogous to group II K antigens (capsular
polysaccharides) of Escherichia coli. The production of such
K-like antigens in Sinorhizobium (rhizobial capsular
polysaccharides [RKPs]) can be modulated by certain flavonoids and by
host root extract (25). Interestingly, the presence of RKPs
is required for the induction of plant genes from the flavonoid
biosynthetic pathway in alfalfa leaves (1), suggesting that
in addition to lipo-chitin oligosaccharides, the RKPs might be another
class of compounds functioning as rhizobial signals for the host plant.
For the production of RKPs in S. meliloti, the gene
rkpZ (formerly lpsZ) and genes of the
fix-23 region are required (26). Because
rkpZ is normally absent in S. meliloti 1021 derivatives, such strains do not form capsular polysaccharides and
therefore have an absolute requirement for exopolysaccharides. The
fix-23 region consists of four complementation units, and
complementation unit I was found to contain six genes
(rkpABCDEF) coding for protein products that show a
considerable degree of similarity and organization similar to those of
the rat fatty acid synthase multifunctional enzyme domains (15,
19, 23). Complementation units II, III, and IV consist of four
additional genes (rkpGHIJ), with one of the gene products
(RkpG) sharing similarity with acyltransferases (15). This
prediction of function in fatty acid biosynthesis and transfer is
surprising, because the final capsular polysaccharide product seems to
contain no fatty acyl residue nor any other
-ketide (24).
The sixth gene of complementation unit I, now called rkpF (15, 23), was proposed to code for an acyl carrier protein (ACP) (19), and here we describe the functional properties
of the RkpF protein.
Cloning of the rkpF gene.
Total genomic DNA
harboring genes involved in rhizobial capsular polysaccharide synthesis
(rkp) was prepared from S. meliloti AK631
(21) grown in TY medium (3) at 29°C. By using
PCR and specific
oligonucleo- tides (GGAATACATATGATCGAAGGCAAATCGCCG CAG and
AAAGGATCCTCACGGCTTGCTTACTTTTTCATGG),
an open reading frame (ORF 6, now rkpF) was amplified
from genomic DNA with Pfu polymerase. Suitable restriction
sites (underlined) for cloning the rkpF gene in
expression vector pET 9a (35) were introduced by PCR
with the oligonucleotides. After restriction with NdeI
and BamHI, the PCR-amplified DNA fragment was cloned into a
pET 9a vector to obtain the expression plasmid pTB1003, in which the
rkpF gene can be overexpressed under control of the T7
promoter. The correct in-frame cloning and the correct published
sequence (19) (EMBL database, accession no. X64131) were
demonstrated by DNA sequencing (data not shown). E. coli
BL21(DE3) (35), which expresses the T7 polymerase under the
control of the lac promoter, was transformed with pTB1003.
Expression and purification of the RkpF protein.
After
E. coli BL21 (DE3) pTB1003 had been grown on
complex Luria-Bertani (LB) medium in the presence of kanamycin (50 µg/ml) at 37°C on a gyratory shaker without or in the presence of
IPTG (isopropyl-
-D-thiogalactopyranoside [0.1 mM]),
the protein profiles obtained after electrophoresis in
nondenaturing (polyacrylamide gel electrophoresis [PAGE]) gels
according the method of Jackowski and Rock (14) were very
similar (Fig. 1). However, in the
IPTG-induced situation, a major protein was visible which was
present in much smaller amounts in the uninduced situation. The
IPTG-inducible protein migrates much more slowly under such
conditions than another rhizobial ACP, the NodF protein.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
Overexpression and purification of RkpF
protein. Purified ACP NodF (11) (lane 1) and cell
extracts from E. coli BL21 (DE3) × pTB1003, grown without
inducer (lane 2) or in the presence of IPTG (lane 3), dialyzed
supernatant after a 60% isopropanol precipitation (lane 4), pooled
fractions after chromatography on DE-52 (lane 5), and pooled fractions
after chromatography on Sephadex G-50 (lane 6) were separated in a
native 20% PAGE gel and stained with Coomassie blue.
|
|
For the purification of the IPTG-inducible protein, IPTG was added
to a final concentration of 0.1 mM to a growing bacterial
suspension of
E. coli BL21 (DE3) × pTB1003 on LB medium at a density
of
5 × 10
8 cells/ml. After 4 h of induction, cells
were harvested and stored
in a freezer at

20°C. Frozen cells (1.1 g) were suspended in
30 ml of buffer A (50 mM Tris-HCl [pH 6.8],
100 mM KCl) and passed
three times through a French pressure cell at
20,000 lb/in
2. The suspension was centrifuged at 6,800 ×
g for 30 min to obtain
the cell extract. The cell extract
was slowly stirred at 4°C,
and isopropanol was added dropwise to a
final concentration of
60% (vol/vol). After 60 min of incubation at
4°C, the precipitate
obtained was removed by centrifugation
at 6,800 ×
g for 30 min.
The supernatant was dialyzed
twice, each time for ca. 30 h against
1 liter of buffer B, which
was a mixture of 50 mM Tris-HCl [pH
8.0] and 1 mM CHAPS
{3-[(3-cholamidopropyl)-dimethyl-ammonio]-1-propanesulfonate},
and the dialysate was applied to a 30-ml column of
DEAE-52-cellulose
(Whatman), which had been equilibrated with buffer
B. The column
was washed with 90 ml of buffer B. Elution was performed
with
a linear gradient from 0 to 1 M NaCl in buffer B in a total volume
of 90 ml. Fractions (1.5 ml) were collected, and aliquots were
analyzed
by PAGE. The RkpF protein eluted in a range from 0.15
to 0.3 M
NaCl. Only those fractions in which the RkpF protein
made up more
than 90% of the total protein, as determined by densitometry,
were combined. In order to obtain highly purified RkpF preparations,
the concentrated RkpF-containing fractions from the DEAE-cellulose
eluate were chromatographed on a Sephadex G-50 superfine (Pharmacia)
column (2.6 cm by 80 cm). Elution was performed with 25 mM Tris-192
mM
glycine at a flow rate of 36 ml/h. RkpF-containing fractions
were
pooled, and after this final purification step, the RkpF
protein
was found to be homogeneous (Fig.
1). From 300 ml of IPTG-induced
cell
suspension, 1.1 g of wet cells was obtained containing a
total of
162 mg of protein. The combined fractions from the DEAE-cellulose
chromatography contained 35 mg of protein, and the combined
fractions
after the molecular sieving step contained 5.4 mg of
homogeneous
RkpF protein, as determined by a micro-biuret method
(
12). Figure
1 shows the degree of purification obtained as
a result of implementing
the individual steps of purification.
The homogeneous RkpF protein migrates as a single band on sodium
dodecyl sulfate (SDS) electrophoresis. In the system described
by
Schägger and von Jagow (
29) with the separating gel
containing
16.5% (6% C) and the stacking gel containing 4% (3% C)
acrylamide,
RkpF migrates with an apparent
Mr of
5,000 (data not shown), much
faster than expected from the predicted
molecular weight for RkpF
of 9,587, calculated from its sequence.
Electrospray mass spectrometric
analysis of purified RkpF protein
that had been overexpressed
in
E. coli indeed gives a mass
of 9,585. These results suggest
that the RkpF protein isolated from
E. coli consists of the plain
protein product without
any further substitution, and it was therefore
used in subsequent
experiments as an apo-RkpF preparation.
Interestingly, the ACP RkpF shows some unexpected properties. Following
the algorithm of Bjellqvist et al. (
5), the calculated
pI of
RkpF (4.84) is nearly 1 pH unit higher than the pI of classical
ACPs
(3.90 to 4.35) (
6,
9,
20,
30,
32). Multifunctional
peptide
synthetases, involved in nonribosomal peptide synthesis,
possess
thiolation domains that can be cloned and expressed as
individual
peptidyl carrier proteins (PCPs), functional analogs
of ACPs. It is
interesting to note that in contrast with ACPs
involved in fatty acid
or

-ketide biosynthesis, PCPs have almost
neutral pIs (pI = 6.07) (
34). It remains to be seen whether
RkpF is more
similar to PCPs in its biochemical function than
other, classical ACPs.
In vivo labeling of the RkpF protein with
-alanine.
-Alanine is a biosynthetic precursor of 4'-phosphopantetheine,
the prosthetic group of ACPs (7, 10). If RkpF carries a
4'-phosphopantetheine, it should become labeled with radioactive
-alanine. By P1 cotransduction (18) of the
panD mutation from E. coli SJ16
(13) to E. coli BL21 (DE3), the
-alanine
auxotrophic expression strain OG7001 was constructed.
OG7001 was transformed with pTB1003, and two cultures (1 ml each)
of E. coli OG7001 × pTB1003 were grown on minimal
medium M9 (18) in the presence of kanamycin (50 µg/ml). At
a cell density of 2.5 × 108 cells/ml, 20 µCi of
-[3H (N)]alanine (specific activity, 60 Ci/mmol;
American Radiolabeled Chemicals, St. Louis, Mo.) was added to each
culture, and one culture was induced with IPTG (0.1 mM). After 4 h
of incubation, cells were harvested and broken by successive treatments
with sucrose, lysozyme, and EDTA. Cell extracts were obtained as
supernatants after centrifugation at 7,000 × g for 5 min and were analyzed by PAGE and subsequent autoradiography, showing
that an IPTG-inducible protein was labeled in vivo (Fig.
2). These results suggest that RkpF
carries a
-alanine-derived prosthetic group, which is most likely
4'-phosphopantetheine, the usual prosthetic group of ACPs. The
experiment also indicates that the posttranslational modification of
adding the prosthetic group to the apoform of RkpF can be performed by
an enzyme activity present in E. coli. However, the in vivo substitution of the overexpressed RkpF protein with
4'-phosphopantetheine is in no way complete, and under the conditions
employed, more than 95% of the total RkpF proteins are still in
their apoform (data not shown).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 2.
RkpF protein is labeled in vivo with
-[3H]alanine. Cell extracts from cells grown in media
containing radiolabeled -alanine were analyzed by 20% PAGE
under native conditions and subsequent autoradiography. The various
lanes show E. coli OG7001 containing the NodF-overexpressing
plasmid pMP2301 induced with IPTG (lane 1), E. coli
OG7001 × pET9a (lane 2), E. coli OG7001 × pTB1003 without inducer (lane 3), and E. coli OG7001 × pTB1003 induced with IPTG (lane 4).
|
|
In vitro labeling of the RkpF protein with CoA.
Holo-ACP
synthase (AcpS) from E. coli is the enzyme responsible for
the posttranslational modification of the AcpP protein in order to
obtain the 4'-phosphopantetheine-bearing holoform of the constitutive
ACP. The gene coding for AcpS has recently been cloned and
characterized (17). Holo-ACP synthase (AcpS) was
purified from an AcpS-overexpressing E. coli strain,
BL21 (DE3) × pDPJ (kindly supplied by Dr. Ralph Lambalot,
Harvard Medical School, Boston, Mass.), similarly to the purification
described by Lambalot and Walsh (17). Cell extracts of
IPTG-induced cells were subjected to chromatography on a DE52 column
under conditions described previously (17), and nonadsorbed
fractions were chromatographed on an SP-Sephadex C-50 column under
conditions described previously (17). Some of the fractions
eluted contained a homogeneous protein with a subunit molecular
weight of 14,000 as judged from electrophoresis in 15% polyacrylamide
gels containing 0.1% (wt/vol) SDS by the method of Laemmli
(16) (data not shown), the molecular weight expected for an
AcpS protein subunit (17). Such homogeneous AcpS
preparations were used routinely for in vitro conversion of apo-RkpF to
holo-RkpF.
In order to determine whether AcpS was the
E. coli enzyme
responsible for the attachment of the 4'-phosphopantetheine to the
RkpF
protein, we incubated apo-RkpF with radiolabeled coenzyme
A (CoA)
in the presence of homogeneous AcpS protein. In a total
volume of 150 µl, different amounts of apo-RkpF protein were
incubated
with [
3H]CoA (3.8 µM; specific radioactivity,
4.7 Ci/mmol; kind gift
of Hans von Döhren, Technical
University of Berlin), MgCl
2 (5
mM), dithiothreitol (DTT)
(0.33 µM), and 100 µg of homogeneous
holo-ACP synthase (AcpS) at
37°C for 45 min in 10 mM Tris-HCl
(pH 8.0), respectively. The
reaction was stopped by the addition
of 500 µl of 20%
trichloroacetic acid, and the precipitated proteins
were adsorbed
to a filter (0.45-µm pore diameter). Non-protein-bound
radioactivity was washed away from the filters with acetic acid,
and
the amount of
3H-labeled protein was quantified by
liquid scintillation counting.
The results given in Table
1 show that AcpS is able to transfer
the
radiolabeled part of CoA to apo-RkpF and that the amount of
radiolabel
transferred depends on the amount of apo-RkpF present.
When AcpS was
absent, no transfer occurred. Analysis of the radiolabeled
RkpF sample
on a native PAGE gel indicated that it migrates slightly
faster than
apo-RkpF (data not shown).
Apo-RkpF and holo-RkpF show different mobilities on native PAGE.
In order to test whether we could quantitatively convert apo-RkpF
to holo-RkpF, we repeated the incubation of apo-RkpF with higher
concentrations of CoA. For in vitro conversion of apo-RkpF to
holo-RkpF, a sample of apo-RkpF protein (38 µg) was incubated with CoA (300 µM), MgCl2 (5 mM), DTT (10 mM), and
homogeneous holo-ACP synthase (8.5 µg) at 37°C for 2 h in 10 mM Tris-HCl (pH 8.0) in a total volume of 200 µl. Over a time course,
such a reaction was stopped by adding EGTA (pH 8.0) to a final
concentration of 80 mM. The analysis of the different forms of RkpF was
performed with a native PAGE gel, and the results are shown in Fig.
3. The time course of a quantitative
conversion of apo-RkpF into holo-RkpF can readily be followed. If the
AcpS activity is inhibited by the presence of EGTA, apo-RkpF is not
converted to holo-RkpF.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Quantitative conversion of apo-RkpF into holo-RkpF
protein. Apo-RkpF was incubated with CoA in the presence of
holo-ACP synthase (AcpS), and the reaction was stopped after different
incubation times with EGTA. A Coomassie-stained gel of native 20% PAGE
is shown. The various lanes show reaction mixture lacking CoA (lane 1),
reaction mixture lacking AcpS (lane 2), reaction mixture in which EGTA
was added before the incubation was started (incubation time, 128 min)
(lane 3), 0-min incubation (lane 4), 8-min incubation (lane 5), 16-min
incubation (lane 6), 32-min incubation (lane 7), 64-min incubation
(lane 8), 128-min incubation (lane 9), and reaction mixture lacking
RkpF (lane 10).
|
|
By analysis with native PAGE, even apo-RkpF protein and holo-RkpF
protein migrate differently. Holo-RkpF migrates faster
(
Rf,
0.69) on native 20% PAGE than apo-RkpF
(
Rf, 0.54), suggesting
a more compact structure
for holo-RkpF than for apo-RkpF. Jackowski
and Rock showed for the
constitutive ACP (AcpP) from
E. coli that
the apoform and
the holoform could be separated by conformationally
sensitive gel
electrophoresis (
14). The separation of apo-AcpP
from
holo-AcpP was possible only when electrophoretic separation
was
performed at 37°C. We have tested the separation of apo-RkpF
and
holo-RkpF over a temperature range from 15 to 55°C, and we
see
equally good separation of the two forms over the whole temperature
range (data not shown).
Masses of apo-RkpF and holo-RkpF.
If RkpF samples were further
analyzed by electrospray mass spectrometry, they were first desalted by
repeated washes with water by using Centricon TM3 devices from Amicon.
The two RkpF proteins were dissolved in acetonitrile-water (50:50
[vol/vol], 5% HCOOH) yielding final concentrations of about 1.5 µg/µl for the apoprotein and 3.3 µg/µl for the
holoprotein. Positive-mode electrospray mass spectra were obtained
on a VG Platform II single quadrupole mass spectrometer. Aliquots of 10 µl of the samples were infused in a mobile phase of
acetonitrile-water (50:50 [vol/vol]) and introduced into the
electrospray source at a flow rate of 5 µl/min. Spectra were scanned
at a speed of 10 s for m/z 700 to 1,800, with a cone
voltage of 60 V, and recorded and processed with MassLynx software,
version 2.0. Mass calibration was performed by multiple-ion monitoring
of horse heart myoglobin signals. Electrospray ionization mass
spectrometry allowed the average masses of the apo-RkpF and holo-RkpF
proteins to be determined. The experimental (9,585.0 ± 0.5)
and calculated (9,587.1) masses of the apo-RkpF protein
and the experimental (9,926.6 ± 1.9) and calculated
(9,927.4) masses of the holo-RkpF protein demonstrate that
both proteins have average masses that match the calculated masses
very well. The mass difference of 342 atomic mass units (amu) between
the values obtained for the apo- and holoforms is in agreement with that expected (340 amu) for 4'-phosphopantetheine substitution of the
holoform. RkpF therefore carries the 4'-phosphopantetheine prosthetic
group characteristic for ACPs involved in fatty acyl and
-ketide
biosynthesis. The 4'-phosphopantetheine residue is quite
different from the prosthetic group of ACPs associated with citrate lyase (28), citramalate lyase, and malonate
decarboxylase (2), the
2'-(5"-phosphoribosyl)-3'-dephospho-CoA, which has a mass of 959 and
for which a mass difference of 941 amu would be expected between the
respective apo- and holoforms of ACPs. The latter three enzymatic
systems are all involved in C-C bond cleavage reactions. These data
show that the overexpressed protein has the molecular mass
predicted from the gene sequence and that the holo-ACP synthase does
indeed transfer a 4'-phosphopantetheine group to form holo-RkpF
protein.
In summary, our data show that RkpF is indeed a novel ACP which
presumably functions in combination with the other gene products
of the
complementation unit I (RkpA-RkpE) in the synthesis of
an unusual fatty
acid or

-ketide. Studies designed to identify
the product formed by
RkpA-RkpF are presently under way. A model
for rhizobial capsular
polysaccharide biosynthesis proposed by
Reuhs et al. (
24)
suggests that the fatty acyl or

-ketide product
formed by RkpA-RkpF
might function as a membrane anchor during
the polymerization of the
polysaccharide subunits and during targeting
of the newly formed RKP to
the bacterial surface. At the bacterial
surface, the mature RKP would
be released from the fatty acyl
or

-ketide residue.
Until very recently, only ACPs expressed constitutively and involved in
the biosynthesis of essential fatty acids were known.
The discovery of
specialized ACPs for the biosynthesis of polyunsaturated
fatty acids in
S. meliloti (
9) and in
Rhizobium
leguminosarum (
10,
32) and the discovery of

-ketide
antibiotics in
Streptomyces (
4,
33) were thought
to represent unusual cases involved
in complex secondary metabolism.
Recently another ACP (AcpXL)
was isolated from
R. leguminosarum and characterized (
6). AcpXL
is able to
transfer 27-hydroxyoctacosanoic acid to lipid IVA during
lipid A
biosynthesis. Thus, to date, from the genera
Rhizobium and
Sinorhizobium, four different ACPs have been characterized:
the constitutive AcpP (
20), the flavonoid-inducible NodF
(
10,
27), AcpXL (
6), and RkpF (
19).
The overall amino acid sequence
similarities of these four ACPs vary
between 26 and 32% (
6),
and a well-conserved amino acid
region can be observed only around
the phosphopantetheine-binding site.
A three-dimensional structure
of the constitutive ACP (AcpP) has been
obtained. Recently, initial
characterizations of the secondary
structure and general tertiary
fold of the NodF protein
(
11) and of the structure of the Act
protein
(
8) have shown that the overall structure of ACPs is
surprisingly well conserved.
 |
ACKNOWLEDGMENTS |
This research was supported by a grant (Ge 556/4-1) from the
Deutsche Forschungsgemeinschaft.
Plasmid pDPJ was kindly supplied by Ralph Lambalot (Harvard Medical
School, Boston, Mass.). We thank Hans von Döhren and Eva Pfeiffer
for the kind gift of radiolabeled CoA and for stimulating discussions,
as well as H. Görisch for critically reading the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Technische
Universität Berlin, Institut für Biotechnologie, FG
Technische Biochemie, Seestraße 13, D-13353 Berlin, Germany.
Phone: 49-30-314-27509. Fax: 49-30-4536-067. E-mail:
geig1332{at}mailszrz.zrz.tu-berlin.de.
 |
REFERENCES |
| 1.
|
Becquart-de Kozak, I.,
B. L. Reuhs,
D. Buffard,
C. Breda,
J. S. Kim,
R. Esnault, and A. Kondorosi.
1997.
Role of the K-antigen subgroup of capsular polysaccharides in the early recognition process between Rhizobium meliloti and alfalfa leaves.
Mol. Plant-Microbe Interact.
10:114-123.
|
| 2.
|
Berg, M.,
H. Hilbi, and P. Dimroth.
1996.
The acyl carrier protein of malonate decarboxylase of Malonomonas rubra contains 2'-(5'-phosphoribosyl)-3'-dephosphocoenzyme A as a prosthetic group.
Biochemistry
35:4689-4696[Medline].
|
| 3.
|
Beringer, J. E.
1974.
R factor transfer in Rhizobium leguminosarum.
J. Gen. Microbiol.
84:188-198[Abstract/Free Full Text].
|
| 4.
|
Bibb, M. J.,
S. Biro,
H. Motamedi,
J. F. Collins, and C. R. Hutchinson.
1989.
Analysis of the nucleotide sequence of the Streptomyces glaucescens tcmI genes provides key information about the enzymology of polyketide antibiotic biosynthesis.
EMBO J.
8:2727-2736[Medline].
|
| 5.
|
Bjellqvist, B.,
G. J. Hughes,
C. Pasquali,
N. Paquet,
F. Ravier,
J.-C. Sanchez,
S. Frutiger, and D. F. Hochstrasser.
1993.
The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences.
Electrophoresis
14:1023-1031[Medline].
|
| 6.
|
Brozek, K. A.,
R. W. Carlson, and C. H. R. Raetz.
1996.
A special acyl carrier protein for transferring long hydroxylated fatty acids to lipid A in Rhizobium.
J. Biol. Chem.
271:32126-32136[Abstract/Free Full Text].
|
| 7.
|
Cronan, J. E., Jr.
1980.
-Alanine synthesis in Escherichia coli.
J. Bacteriol.
141:1291-1297[Abstract/Free Full Text].
|
| 8.
|
Crump, M. P.,
J. Crosby,
C. E. Dempsey,
J. A. Parkinson,
M. Murray,
D. A. Hopwood, and T. J. Simpson.
1997.
Solution structure of the actinorhodin polyketide synthase acyl carrier protein from Streptomyces coelicolor A3(2).
Biochemistry
36:6000-6008[Medline].
|
| 9.
|
Debellé, F., and S. B. Sharma.
1986.
Nucleotide sequence of Rhizobium meliloti RCR2011 genes involved in host-specificity of nodulation.
Nucleic Acids Res.
14:7453-7471[Abstract/Free Full Text].
|
| 10.
|
Geiger, O.,
H. P. Spaink, and E. P. Kennedy.
1991.
Isolation of the Rhizobium leguminosarum NodF nodulation protein: NodF carries a 4'-phosphopantetheine prosthetic group.
J. Bacteriol.
173:2872-2878[Abstract/Free Full Text].
|
| 11.
|
Ghose, R.,
O. Geiger, and J. H. Prestegard.
1996.
NMR investigations of the structural properties of the nodulation protein, NodF, from Rhizobium leguminosarum and its homology with Escherichia coli acyl carrier protein.
FEBS Lett.
388:66-72[Medline].
|
| 12.
|
Itzhaki, R. F., and D. M. Gill.
1964.
A micro-biuret method for estimating protein.
Anal. Biochem.
9:401-410[Medline].
|
| 13.
|
Jackowski, S., and C. O. Rock.
1981.
Regulation of coenzyme A biosynthesis.
J. Bacteriol.
148:926-932[Abstract/Free Full Text].
|
| 14.
|
Jackowski, S., and C. O. Rock.
1983.
Ratio of active to inactive forms of acyl carrier protein in Escherichia coli.
J. Biol. Chem.
258:15186-15191[Abstract/Free Full Text].
|
| 15.
|
Kiss, E.,
B. L. Reuhs,
J. S. Kim,
A. Kereszt,
G. Petrovics,
P. Putnoky,
I. Dusha,
R. W. Carlson, and A. Kondorosi.
1997.
The rkpGHI and -J genes are involved in capsular polysaccharide production by Rhizobium meliloti.
J. Bacteriol.
179:2132-2140[Abstract/Free Full Text].
|
| 16.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 17.
|
Lambalot, R. H., and C. T. Walsh.
1995.
Cloning, overproduction, and characterization of the Escherichia coli holo-acyl carrier protein synthase.
J. Biol. Chem.
270:24658-24661[Abstract/Free Full Text].
|
| 18.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 19.
|
Petrovics, G.,
P. Putnoky,
B. Reuhs,
J. Kim,
T. A. Thorp,
K. D. Noel,
R. W. Carlson, and A. Kondorosi.
1993.
The presence of a novel type surface polysaccharide in Rhizobium meliloti requires a new fatty acid synthase-like gene cluster involved in symbiotic nodule development.
Mol. Microbiol.
8:1083-1094[Medline].
|
| 20.
|
Platt, M. W.,
K. J. Miller,
W. S. Lane, and E. P. Kennedy.
1990.
Isolation and characterization of the constitutive acyl carrier protein from Rhizobium meliloti.
J. Bacteriol.
172:5440-5444[Abstract/Free Full Text].
|
| 21.
|
Putnoky, P., and A. Kondorosi.
1986.
Two gene clusters of Rhizobium meliloti code for early essential nodulation functions and a third influences nodulation efficiency.
J. Bacteriol.
167:881-887[Abstract/Free Full Text].
|
| 22.
|
Putnoky, P.,
G. Petrovics,
A. Kereszt,
E. Grosskopf,
D. T. C. Ha,
Z. Banfalvi, and A. Kondorosi.
1990.
Rhizobium meliloti lipopolysaccharide and exopolysaccharide can have the same function in the plant-bacterium interaction.
J. Bacteriol.
172:5450-5458[Abstract/Free Full Text].
|
| 23.
|
Reuhs, B. L.
1996.
Acidic capsular polysaccharides (K antigens) of Rhizobium, p. 331-336.
In
G. Stacey, B. Mullin, and P. M. Gresshoff (ed.), Biology of plant-microbe interactions. International Society for Molecular Plant-Microbe Interactions, St. Paul, Minn.
|
| 24.
|
Reuhs, B. L.,
R. W. Carlson, and J. S. Kim.
1993.
Rhizobium fredii and Rhizobium meliloti produce 3-deoxy-D-manno-2-octulosonic acid-containing polysaccharides that are structurally analogous to group II K antigens (capsular polysaccharides) found in Escherichia coli.
J. Bacteriol.
175:3570-3580[Abstract/Free Full Text].
|
| 25.
|
Reuhs, B. L.,
J. S. Kim,
A. Badgett, and R. W. Carlson.
1994.
Production of cell-associated polysaccharides of Rhizobium fredii USDA205 is modulated by apigenin and host root extract.
Mol. Plant-Microbe Interact.
7:240-247[Medline].
|
| 26.
|
Reuhs, B. L.,
M. N. V. Williams,
J. S. Kim,
R. W. Carlson, and F. Côté.
1995.
Suppression of the Fix phenotype of Rhizobium meliloti exoB mutants by lpsZ is correlated to a modified expression of the K polysaccharide.
J. Bacteriol.
177:4289-4296[Abstract/Free Full Text].
|
| 27.
|
Ritsema, T.,
O. Geiger,
P. van Dillewijn,
B. J. J. Lugtenberg, and H. P. Spaink.
1994.
Serine residue 45 of nodulation protein NodF from Rhizobium leguminosarum bv. viciae is essential for its biological function.
J. Bacteriol.
176:7740-7743[Abstract/Free Full Text].
|
| 28.
|
Robinson, J. B.,
M. Singh, and P. A. Srere.
1976.
Structure of the prosthetic group of Klebsiella aerogenes citrate (pro-3S)-lyase.
Proc. Natl. Acad. Sci. USA
73:1872-1876[Abstract/Free Full Text].
|
| 29.
|
Schägger, H., and G. von Jagow.
1987.
Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa.
Anal. Biochem.
166:368-379[Medline].
|
| 30.
|
Schofield, P. R., and J. M. Watson.
1986.
DNA sequence of Rhizobium trifolii nodulation genes reveals a reiterated and potentially regulatory sequence preceding nodABC and nodFE.
Nucleic Acids Res.
14:2891-2903[Abstract/Free Full Text].
|
| 31.
|
Schultze, M.,
E. Kondorosi,
P. Ratet,
M. Buire, and A. Kondorosi.
1994.
Cell and molecular biology of Rhizobium-plant interactions.
Int. Rev. Cytol.
156:1-75.
|
| 32.
|
Shearman, C. A.,
L. Rossen,
A. W. B. Johnston, and J. A. Downie.
1986.
The Rhizobium leguminosarum nodulation gene nodF encodes a polypeptide similar to acyl carrier protein and is regulated by nodD plus a factor in pea root exudate.
EMBO J.
5:647-652[Medline].
|
| 33.
|
Sherman, D. H.,
F. Malpartida,
M. J. Bibb,
H. M. Kieser,
M. J. Bibb, and D. A. Hopwood.
1989.
Structure and deduced function of the granaticin-producing polyketide synthase gene cluster of Streptomyces violaceoruber Tu22.
EMBO J.
8:2717-2725[Medline].
|
| 34.
|
Stachelhaus, T.,
A. Hüser, and M. A. Marahiel.
1996.
Biochemical characterization of peptidyl carrier protein (PCP), the thiolation domain of multifunctional peptide synthetases.
Chem. Biol.
3:913-921[Medline].
|
| 35.
|
Studier, F. W.,
A. H. Rosenberg,
J. J. Dunn, and J. W. Dubendorff.
1990.
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol.
185:60-89[Medline].
|
Journal of Bacteriology, September 1998, p. 4950-4954, Vol. 180, No. 18
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ramos-Vega, A. L., Davila-Martinez, Y., Sohlenkamp, C., Contreras-Martinez, S., Encarnacion, S., Geiger, O., Lopez-Lara, I. M.
(2009). SMb20651 is another acyl carrier protein from Sinorhizobium meliloti. Microbiology
155: 257-267
[Abstract]
[Full Text]
-
Zhang, X.-S., Cheng, H.-P.
(2006). Identification of Sinorhizobium meliloti Early Symbiotic Genes by Use of a Positive Functional Screen. Appl. Environ. Microbiol.
72: 2738-2748
[Abstract]
[Full Text]
-
Putnoky, P., Deak, V., Bekasi, K., Palvolgyi, A., Maasz, A., Palagyi, Z., Hoffmann, G., Kerepesi, I.
(2004). H Protein of Bacteriophage 16-3 and RkpM Protein of Sinorhizobium meliloti 41 Are Involved in Phage Adsorption. J. Bacteriol.
186: 1591-1597
[Abstract]
[Full Text]
-
Marketon, M. M., Gronquist, M. R., Eberhard, A., Gonzalez, J. E.
(2002). Characterization of the Sinorhizobium meliloti sinR/sinI Locus and the Production of Novel N-Acyl Homoserine Lactones. J. Bacteriol.
184: 5686-5695
[Abstract]
[Full Text]
-
Branen, J. K., Chiou, T.-J., Engeseth, N. J.
(2001). Overexpression of Acyl Carrier Protein-1 Alters Fatty Acid Composition of Leaf Tissue in Arabidopsis. Plant Physiol.
127: 222-229
[Abstract]
[Full Text]
-
Louch, H. A., Miller, K. J.
(2001). Synthesis of a Low-Molecular-Weight Form of Exopolysaccharide by Bradyrhizobium japonicum USDA 110. Appl. Environ. Microbiol.
67: 1011-1014
[Abstract]
[Full Text]
-
López-Lara, I. M., Geiger, O.
(2000). Expression and purification of four different rhizobial acyl carrier proteins. Microbiology
146: 839-849
[Abstract]
[Full Text]
-
Kutchma, A. J., Hoang, T. T., Schweizer, H. P.
(1999). Characterization of a Pseudomonas aeruginosa Fatty Acid Biosynthetic Gene Cluster: Purification of Acyl Carrier Protein (ACP) and Malonyl-Coenzyme A:ACP Transacylase (FabD). J. Bacteriol.
181: 5498-5504
[Abstract]
[Full Text]
-
Kremer, L., Nampoothiri, K. M., Lesjean, S., Dover, L. G., Graham, S., Betts, J., Brennan, P. J., Minnikin, D. E., Locht, C., Besra, G. S.
(2001). Biochemical Characterization of Acyl Carrier Protein (AcpM) and Malonyl-CoA:AcpM Transacylase (mtFabD), Two Major Components of Mycobacterium tuberculosis Fatty Acid Synthase II. J. Biol. Chem.
276: 27967-27974
[Abstract]
[Full Text]