Previous Article | Next Article 
Journal of Bacteriology, October 1998, p. 5003-5009, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Genomic Analysis Reveals Chromosomal Variation in Natural
Populations of the Uncultured Psychrophilic Archaeon
Cenarchaeum symbiosum
Christa
Schleper,1,
Edward F.
DeLong,1,
Christina M.
Preston,1
Robert
A.
Feldman,2
Ke-Ying
Wu,1 and
Ronald V.
Swanson2,*
Marine Science Institute, University of
California, Santa Barbara, California
93106,1 and
Diversa Corporation, San
Diego, California 921212
Received 27 May 1998/Accepted 21 July 1998
 |
ABSTRACT |
Molecular phylogenetic surveys have recently revealed an
ecologically widespread crenarchaeal group that inhabits cold and temperate terrestrial and marine environments. To date these organisms have resisted isolation in pure culture, and so their phenotypic and genotypic characteristics remain largely unknown. To
characterize these archaea, and to extend methodological approaches for
characterizing uncultivated microorganisms, we initiated
genomic analyses of the nonthermophilic crenarchaeote
Cenarchaeum symbiosum found living in association with a
marine sponge, Axinella mexicana. Complex DNA libraries
derived from the host-symbiont population yielded several large clones
containing the ribosomal operon from C. symbiosum.
Unexpectedly, cloning and sequence analysis revealed the
presence of two closely related variants that were consistently found
in the majority of host individuals analyzed. Homologous regions from
the two variants were sequenced and compared in detail. The
variants exhibit >99.2% sequence identity in both small- and large-subunit rRNA genes and they contain homologous protein-encoding genes in identical order and orientation over a 28-kbp overlapping region. Our study not only indicates the potential for characterizing uncultivated prokaryotes by genome sequencing but also identifies the primary complication inherent in the approach: the widespread genomic microheterogeneity in naturally occurring prokaryotic populations.
| |
INTRODUCTION |
Molecular phylogenetic surveys
of mixed microbial populations have revealed the existence of many
new lineages undetected by classical microbiological approaches
(7, 25). Furthermore, quantitative rRNA hybridization
experiments demonstrate that some of these novel prokaryotic groups
represent major components of natural microbial communities. These
molecular phylogenetic approaches have altered current views of
microbial diversity and ecology and have demonstrated that traditional
cultivation techniques may recover only a small, skewed
fraction of naturally occurring microbes. However, phylogenetic
identification using single gene sequences provides a limited
perspective on other biological properties, particularly for novel
lineages only distantly related to cultivated and characterized
organisms. Consequently, additional approaches are necessary to better
characterize ecologically abundant and potentially
biotechnologically useful microorganisms, many of which resist
cultivation attempts.
Nonthermophilic members of the kingdom Crenarchaeota
are one of the more abundant, widespread, and frequently
recovered prokaryotic groups revealed by molecular phylogenetic
approaches. These microorganisms were originally detected in high
abundance in temperate ocean waters and polar seas (6, 8, 10, 22,
23, 28). Representatives have now been reported to exist in
terrestrial environments (2, 15, 19, 37) and freshwater lake
sediments (14, 20, 31), indicating a widespread
distribution. The ecological distribution of these organisms was
initially surprising, since their closest cultivated relatives are all
thermophilic or hyperthermophilic. No representative of this new
archaeal group has yet been obtained in pure culture, and so the
phenotypic and metabolic properties of these organisms as well as their
impact on the environment and global nutrient cycling remain unknown.
Since growth temperature and habitat characteristics vary so widely
between nonthermophilic and the hyperthermophilic
Crenarchaeota, these groups are likely to differ greatly
with respect to specific physiology and metabolism.
To gain a better perspective on the genetic and physiological
characteristics of nonthermophilic crenarchaeotes, we began a
genomic study of Cenarchaeum symbiosum. This
archaeon lives in specific association with the marine sponge
Axinella mexicana off the coast of California
(28), allowing access to relatively large amounts of biomass
from this species. Our approach differs in several respects from
now standard genomic characterization of cultivated organisms,
and also from comparable studies of uncultivated obligate parasites or
symbionts. C. symbiosum has not been completely physically
separated from the tissues of its metazoan host. Therefore, its genetic
material needs to be identified within the context of complex
genomic libraries that contain significant amounts of
eucaryotic DNA, as well as DNA derived from members of the domain
Bacteria.
In the course of our study, we identified the presence of at least two
major variants or strains of C. symbiosum that coexist inside the sponge tissues. This complexity of the C. symbiosum population was not detected in initial studies based
solely on direct sequencing of PCR-amplified small-subunit (SSU)
rRNA genes (28). This natural variation would also
have been lost upon isolation of a pure culture. One component of our
genomic analysis involved the sequencing and comparison of
large, overlapping chromosomal regions from the two dominant naturally
co-occurring C. symbiosum variants. The variability and
distribution of the variants within different sponge individuals were
also investigated.
| |
MATERIALS AND METHODS |
Enrichment for C. symbiosum cells from sponge
tissue, DNA extraction, and preparation of fosmid libraries.
Preparation of archaeal cells for the first fosmid (16)
library has been previously described (28). A small
individual of A. mexicana was incubated in calcium- and
magnesium-free artificial seawater (ASW) containing pronase (0.25 mg/ml); the tissue was then homogenized and enriched for archaeal cells
by differential centrifugation. For the second library, prepared from a
different sponge individual, this cell fraction was further incubated
for 1 h at 4°C in 10 mM Tris-HCl (pH 8)-200 mM EDTA. This
additional incubation step was found to increase the lysis of sponge
cells, which resulted in an enhanced separation of archaeal and
eucaryotic cells in the Percoll gradient. The cells were then pelleted
and subsequently purified on a 15% Percoll (Sigma) cushion in ASW. Archaeal cells banded in the light, upper fraction after centrifugation at 2,500 rpm in a Beckman SS34 rotor. This cell fraction was washed in
ASW and resuspended in TE buffer (10 mM Tris-HCl [pH 8], 0.1 mM
EDTA). Quantitative hybridization experiments using a domain-specific oligonucleotide (6) indicated that 25 to 30% of the total
rRNA from this fraction was derived from archaea. DNA extraction,
preparation of the fosmid libraries, and PCR-based screening were
performed as previously described (28, 36). The first fosmid
library yielded 7 unique C. symbiosum rRNA
operon-containing clones out of a total 10,236 recombinant fosmids
(0.07%). The second fosmid library yielded eight unique C. symbiosum rRNA operon-containing clones out of 2,100 recombinants (0.38%).
Fosmid sequencing.
Small (1- to 2-kbp)-insert plasmid
libraries were prepared by cloning partial restriction enzyme digests
of purified fosmids. Plasmids were sequenced by using Applied
Biosystems Inc. (ABI; Foster City, Calif.) Prism dye terminator FS
reaction mix. Direct sequencing from fosmids was used for gap filling
and resequencing to ensure accuracy. Fosmid sequencing was performed by
using DNA from a single 3-ml overnight culture purified on an Autogen
740 automated plasmid isolation system. Each reaction consisted of one
preparation of DNA directly resuspended by the addition of 16 µl of
H2O, 8 µl of oligonucleotide primer (1.4 pmol/µl), and 16 µl of ABI Prism dye terminator FS reaction mix. Cycle sequencing was performed with a 3-min preincubation at 96°C followed by 25 cycles of the sequence 96°C for 20 s-50°C for 20 s-60°C for 4 min
and a 5-min postcycling incubation at 60°C. Sequencing reaction products were analyzed on ABI 377 sequencers.
Direct sequencing of PCR fragments.
PCRs with two
archaeon-specific 16S rDNA primers (21F and 958R [6],
one biotinylated) were used to amplify a 950-bp fragment from total
nucleic acids of 16 different sponge individuals. Primers 21F and
459R-LSU (CTTTCCCTCACGGTA) were used to amplify the 16S-23S spacer region from fosmids. The PCR products were purified and sequenced as described previously (28), with primer 519R for 16S rDNA and primer SP23rev (CTA TTG CCG TCT TTA CACC) for the spacer
region.
rRNA hybridization.
Two oligonucleotides specific for
each variant type were designed from the 23S rDNA gene sequences
(positions 283 to 303, E. coli numbering) of fosmids
101G10 and 60A5. The probes differ by three point mutations:
L-St-C.symA-283-a-A-19 (variant A), ACACTTCAACTATTTCCTG;
and L-St-C.symB-283-a-A-19 (variant B),
ACACTTTGACTATTTCGTG. Nucleic acids from sponges (300 ng) and
controls (fosmids 101G10 and 60A5, 50 ng of each) were denatured, bound
to nylon membranes (Hybond-N; Amersham), hybridized with the labeled
probes (22), and washed at 41.5°C. Hybridization
was analyzed by autoradiography.
RFLP analysis of PCR fragments.
Primers 21F (6)
and 459R-LSU for amplification of 2.2 kbp of the ribosomal operon,
primers GSAT810F (GAATCCGCCCCCGACTATCTT) and 16S37REV
(CATGGCTTAGTATCAATC) for amplification of the 16S RNA-glutamate semialdehyde aminotransferase (GSAT) region (2.2 kbp),
and primers Cenpol357F (ACITACAACGGIGACGAYTTTGA) and
Cenpol735R (CACCCCGAARTAGTTYTTYTT) for an internal DNA
polymerase fragment (of 1,134 bp) were used in PCRs with 5 ng of
purified fosmids. The PCR products were cut with TaqI and
HpaII (16S-23S RNA), HaeIII and RsaI
(GSAT-16S RNA), or HaeIII and AvaII (polymerase)
and analyzed on 2% agarose gels. If the pattern did not exactly match but closely resembled the restriction fragment length polymorphism (RFLP) of either type A or B, it was denoted by a lowercase letter (a
or b [Table 1]), meaning that at least three of four or three of five
bands created by restriction digest appear identical in size to the
ones from either type A or B.
Nucleotide sequence accession numbers.
The sequences
described in this report have been deposited in GenBank
under accession no. AF083072 (fosmid 101G10) and AF083071 (fosmid
60A5).
| |
RESULTS |
Isolation and comparison of fosmid clones from two
environmental libraries.
We constructed two environmental
fosmid libraries from tissue preparations of the A. mexicana-C. symbiosum association that were enriched for
archaeal cells. These libraries yielded 15 unique C. symbiosum rRNA operon-containing fosmids. Partial sequence and RFLP analysis of the SSU RNA genes of all 15 fosmids revealed the presence of two variants, termed A and B, that differed by only two
point mutations over a 590-bp region. Southern blotting of
restriction digests of entire fosmids also confirmed the presence of two classes of rRNA operon-containing clones (data
not shown). A total of 10 clones were identified as variant A, and 5 clones represented variant B (Table
1). The A/B variant recovery ratios were
4:3 in the first library and 6:2 in the second library.
We determined the complete sequences of two fosmids, both
containing an rRNA operon, which corresponded to the
two variant
types. The insert of fosmid 101G10 (designated variant
A) was
32,998 bp and is syntenic over ca. 28 kbp with the
42,432-bp insert
of fosmid 60A5 (variant B). Analysis of the
common 28-kbp region
is shown in Fig.
1.
The large-subunit (LSU) and SSU rRNA genes
of the two variants were
99.2 and 99.3% identical, respectively.
Protein coding regions were
highly similar in both nucleic acid
and deduced amino acid
sequences (Fig.
1; Table
2). The data
provide strong evidence that these genomic clones are derived
from two very closely related but distinct strains, as opposed
to
representing two rRNA operon regions originating from the
same
organism. This conclusion is consistent with the observation that
all crenarchaeotes characterized to date contain only one rRNA
operon (
11).
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Gene map of related 28-kbp regions from two fosmids of
C. symbiosum. Sequences were aligned over their entire
length. The same genes and gene order were found on both fosmid 101G10
and fosmid 60A5 (for abbreviations of depicted ORFs, see the footnote
to Table 2). G+C plots for both fosmids are shown underneath
(calculated within a window size of 400 bp and an increment of 150 bp).
A bar depicts different levels of DNA identity between the two aligned
sequences (see text for more details). Insertions/deletions were found
predominantly in intergenic regions. The two largest insertions, one
found between PPI and HYP3 (hypothetical 03) in fosmid 60A5 and the REP
(repeat) element between MenA and ORF 5 in fosmid 101G10, are shown as
gaps in the G+C plots. POL, DNA polymerase; DEAM, deaminase; METH,
methylase.
|
|
In protein coding regions, the DNA identity of the two contigs
ranged from 80.9% (triosephosphate isomerase) to 91.5%
(hypothetical
03) (Table
2). Within intergenic regions, the
identity dropped
to 70 to 86%, and small insertions or deletions were
found frequently.
The high similarity in coding regions and upstream
sequences aided
in the identification of genes, start codons, and
putative transcriptional
promoter motifs (see below).
Although both sequences could be aligned unambiguously over most of the
overlapping region, four large insertions/deletions
ranging in size
from 142 to 1,994 bp were identified between positions
20500 and 25800. The longest insertion contained a repetitive
element of 1,784 bp, which
was found in variant A between
menA and open read frame
(ORF) 05. It was composed of a threefold direct
repeat of 575 bp (REP
in Fig.
1), with repeats exhibiting only
minor sequence variation (95.8 to 98.7% identity). A segment of
56 bp at the start of this repeat is
also found adjacent to the
3' terminus of the third direct repeat. No
obvious structural
or sequence similarities to known repeats or mobile
genetic elements
from other organisms were identified within the repeat
sequence.
Its occurrence in only one variant and its relatively low G+C
content relative to the rest of the fragment suggest that it may
have
been acquired by horizontal transfer from a different genetic
context.
Analysis of the 28-kbp genomic fragment from C. symbiosum.
The average G+C contents in the fosmid inserts were
55.6% for variant A and 57.1% for variant B in protein coding regions but were significantly lower in the gene for the hypothetical protein
01 and in the repetitive element of variant A (Fig. 1). Genes appear as
densely packed in C. symbiosum as they are in other
sequenced archaeal genomes (4, 17, 34). The rRNA operon is composed of the genes for 16S and 23S RNAs separated by spacer of 131 bp. This organization is typical of crenarchaeotes and
differs from that of rRNA operons of euryarchaeotes, which usually contain 5S RNA and tRNA genes (11). Another stable
RNA gene, coding for tRNATyr, is found separate from the
rRNA operon. This tRNA contains a 45 bp intron in the
vicinity of the anticodon loop. Of the 17 predicted protein-encoding
genes, 9 show significant matches to genes of assigned function from
the public databases. Three are homologous to hypothetical proteins
from other organisms (Table 1). In a number of cases, the highest
similarity of derived amino acid sequences is with known archaeal
proteins. In particular, DNA polymerase, TATA box-binding protein
(TBP), and triosephosphate isomerase gene sequences could be analyzed
in greater detail because several archaeal homologs are known. The DNA
polymerase shares highest overall similarity with the crenarchaeal
homologs from the extreme thermophiles Sulfolobus
acidocaldarius and Pyrodictium occultum (54 and 53%,
respectively) and exhibits all conserved motifs of B-(
-)type DNA
polymerases and 3'-5'-exonuclease motifs, both indicative of archaeal
polymerases. A more detailed phylogenetic analysis and biochemical
characterization of the C. symbiosum polymerase
has been published elsewhere (32). The TBP is
similar to other known archaeal TBPs and is N-terminally truncated
with respect to the eucaryal homologs. It shows 49% amino acid
similarity with TBP from Pyrococcus woesii. The
triosephosphate isomerase represents the first such
protein sequence reported for a crenarchaeote and has known
archaeal signature sequences and deletions which distinguish
archaeal triosephosphate isomerase genes from their eucaryal
and eubacterial homologues (data not shown). We identified an
ATP-dependent RNA helicase that is highly similar in sequence to
homologues found in the complete genome sequences of three euryarchaeotes (4, 17, 34). GSAT, also detected in an
rRNA operon containing genomic fragment of a
planktonic marine crenarchaeote (36), is also present.
The high conservation between the two chromosomal segments is not
entirely confined to coding regions but also extends into
adjacent
upstream sequences. Due to this upstream similarity,
and also because
the average G+C content of the sequences is relatively
high, it was
possible to readily identify putative transcriptional
(A+T-rich)
promoter elements. A signature corresponding to the
consensus of the
archaeal TATA box-like element ([C/T]TTA[T/A]A)
(
13) was
identified upstream of nearly all genes (Fig.
2). The
exceptions were the genes
encoding MenA and DNA polymerase, which
are located immediately
downstream of other ORFs and may therefore
be transcribed as
polycistronic mRNAs. In vivo and in vitro studies
of other archaea have
shown that initiation of transcription occurs
consistently 24 to 28 bp
downstream from the central T of this
motif (
13,
26). For 12 of the protein-encoding genes, the
promoter element was found 25 to 30 bp upstream of the ORF (Fig.
2), suggesting that transcriptional
initiation occurs near or
at the translational start codon.
View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the promoter regions of 17 genes identified
in both the A and B variants of C. symbiosum. The
distance from the TATA box to the start codon is indicated at the
right. The TATA box consensus sequence is shown below the alignment.
|
|
Distribution of C. symbiosum variants in
host-associated natural populations.
The unexpected finding of two
distinct but highly related genomic variants of
C. symbiosum in libraries derived from two different sponge isolates led us to investigate whether this variation occurred consistently in other samples. Sequence analysis of 590 bp of the 16S
rRNA gene revealed two variant positions (175 and 183.7, E. coli numbering [Table 3]). These
signature nucleotides were used to determine the presence of the
variants in natural populations of A. mexicana by direct
sequencing of 16S rDNA PCR products from 16 different sponge
individuals collected from different locations and at different times.
In 15 cases, U/C ambiguities were found at the signature positions,
indicating the presence of both variants (Table 3). Only one sponge
(s4) yielded an unambiguous sequence identical to that of variant A,
but variant B was detected in this individual by another criterion.
The second approach detected variation in LSU rRNA, using
oligonucleotides uniquely specific for each variant type. In the
majority of host individuals examined, the presence of both LSU
rRNA variants was observed (Table 3), again suggesting that the
specific association of C. symbiosum with its host
typically involves the presence of both variants.
We also examined the possibility of an even greater diversity of
variants, as opposed to a symbiont population composed strictly
of two variant types. Since the rRNA spacer region displays
greater
heterogeneity between the two variant types than the SSU
rRNA
sequence, we PCR amplified and sequenced the variable spacer
region
(containing 10 distinguishing signature nucleotides) from
11 unique
rRNA operon-containing fosmids. In all
cases, we found a sequence
identical to one or the other variant type
(i.e., type A [101G10]
or B [60A5] [Table
1]). We then amplified
fragments from less
highly conserved regions, i.e., an 1,150-bp
fragment covering
the 5' end of the GSAT gene and 16S gene and an
internal fragment
of 1,134 bp from the DNA polymerase gene. RFLP
patterns of these
fragments revealed that all fosmids analyzed could
again be assigned
to either the A or B type, but slight variations were
also detected
(lowercase letters in Table
1), suggesting that both
variants
exhibit further microheterogeneity which is detectable only in
protein coding and intergenic regions.
| |
DISCUSSION |
We chose C. symbiosum as a representative of the
nonthermophilic crenarchaeotes to begin characterization of this newly
detected, ecologically widespread but phenotypically
uncharacterized lineage. The specific association of C. symbiosum with the marine sponge A. mexicana
provides a tractable experimental system, allowing access to these
novel uncultivated microorganisms in an enriched form.
Environmental genomic analysis reveals a
heterogenous population of C. symbiosum.
Initial studies suggested that only one specific archaeal phylotype was
associated with the sponge (28). The analysis presented here
reveals heterogeneity at the subspecies level in C. symbiosum (see below), as a result of the higher resolution and
more comprehensive nature of genome characterization compared to
phylogenetic surveys based on a single genetic locus (e.g., SSU
rRNA). We found two highly similar phylotypes (A and B) in two
independently created libraries from the symbiotic association (Table
1) and have detected these consistently in nearly all sponge
individuals analyzed (Table 3). By extending analyses outside the
rRNA operon, we detected further divergence in less
conserved protein coding and intergenic regions (Table 1; Fig.
1). Over the 28-kbp region analyzed, the variants showed >99.2%
identity in their rRNA genes, approximately 87.8% overall DNA
identity, an average of 91.6% similarity in ORF amino acid sequence,
and complete colinearity of protein-encoding regions. Our data
therefore suggest that the sponge-associated archaeal
population consists of two major types, represented by fosmids 101G10
and 60A5, whose similarity is so great that by standard criteria
(e.g., rRNA and genomic DNA similarity
[38]) they could be considered different strains
of a single species, C. symbiosum. Both variants
also display further microheterogeneity, which is not evident on the
rRNA level (Table 1).
Generally, the concept of symbiosis implies a specific association
between a particular symbiont and a particular host. Very
few studies,
however, have analyzed the degree of diversity within
single symbiotic
populations (
21,
29,
30,
35) in single
host individuals. Our
finding of two distinguishable variants
in the archaeal-metazoan
symbiosis indicates that both variants
are concurrently stably
maintained in the sponge host. Their close
phylogenetic relationship
and the extremely high similarity of
protein-encoding regions, combined
with evidence for further microheterogeneity
of the two rRNA
variants, strongly suggests that a population
of strains or variants of
C. symbiosum is coevolving in the context
of the
sponge-archaeon association. If this is the case, then
transmission of
the symbionts to the next host generation probably
involves a
population of archaeal cells that is large enough to
maintain the
diversity that we observed within each particular
host individual. The
mode of transmission of
C. symbiosum, as
well as its
physical distribution within the sponge tissues, is
under investigation
in our laboratory. It is also possible that
there is another
environmental reservoir of
C. symbiosum and that
A. mexicana is selectively infected with closely related
strains.
Contemporary surveys of natural microbial assemblages now routinely use
cloning and analysis of phylogenetically informative
gene sequences
from mixed populations. Many novel and previously
undetected microbial
groups, including
C. symbiosum and other
previously
uncultivated archaea, have been discovered by using
this approach. A
consistent pattern that has emerged in virtually
all such studies among
widely disparate taxa is the recovery of
highly related but
distinct rRNA gene clades or clusters (
1,
6,
9,
12).
Several explanations have been suggested for
the high genetic
diversity found in rRNA gene surveys, including
PCR or
sequencing artifacts, variation within rRNA
operons in
a single chromosome, or variation in rRNA
genes among highly related,
co-occurring strains (
1,
9). The environmental distributions
of such highly related
rRNA genes (
9), as well as the expression
of rRNA
variation within individual cells (
1), indicates that
much
of the naturally occurring rRNA gene microheterogeneity may
be due
to authentic organismal genetic diversity. Our results
tend to
corroborate these findings, since the highly similar,
syntenic
chromosomal DNA fragments that we analyzed appear to
be derived from
naturally co-occurring but closely related strains.
How are such highly related sympatric strains, nearly
indistinguishable by SSU rRNA sequence, stably maintained in
their natural
habitat? Previous studies of diversity at the level
of protein-encoding
genes indicate that ecologically distinct bacterial
populations,
through the action of purging selection, form distinctive
clusters
at all genetic loci examined (
5). Furthermore,
ecologically
distinct species of highly related strains,
indistinguishable
by SSU rRNA sequences, do fall into separate
sequence similarity
clusters when their protein-encoding genes are
compared. Palys
et al., on the basis of theoretical
considerations and empirical
data, conclude that in cases where
sympatric species form distinct
similarity clusters, they must
certainly show ecological differences
(
27). A good example
of this is a recent report of naturally
co-occurring closely related
Proclorococcus 16S rRNA variants,
each adapted for
optimal growth at different light intensities
(
24).
One explanation of our data that is consistent with this
hypothesis is
that the symbiotic variants occupy different compartments
within
their sponge host, occupying different niches that allow
their stable
transmission. Another distinct possibility is the
evolution of a
metabolic interdependence between the two strains,
requiring the
cotransmission of both variants to maintain the
symbiosis. A third
possibility is that the differences between
the strains are currently
neutral, and although one is expected
to dominate eventually, there is
a period of time when both coexist.
Genomic analysis of C. symbiosum reveals typical
features of Archaea.
The sequence analysis of 28 kbp of
contiguous DNA from two C. symbiosum variants reveals
many features typical for Archaea, and particularly for
Crenarchaeota, confirming the phylogenetic affiliation
inferred from analysis of the SSU rRNA sequence
(28): the rRNA gene order, spacer region, and structure
are most similar to those found in the hyperthermophilic
Crenarchaeota. The GSAT gene, which is located directly
upstream of the ribosomal operon, was found in the same
relative location on a fosmid derived from a planktonic marine
crenarchaeote (36). Deduced amino acid sequences of proteins
all share highest overall similarity with archaeal proteins, whenever
known homologues are available.
The findings of a TBP gene and of promoter elements that follow the
archaeal TATA box consensus suggest a typical archaeal
transcription
mechanism. Interestingly, most of the
C. symbiosum promoters that we identified were located such that transcription
initiation must occur close to the translational start codon,
allowing
no space for a ribosomal binding site in an untranslated
mRNA leader. A
similar observation has been made for 30 of the
predicted 100 strong
and medium promoters from 156-kbp sequence
of
Sulfolobus
solfataricus (
33). Transcription initiation at
or near
the translational start codons has been mapped for some
genes in
Halobacterium salinarium (
3) and
S. solfataricus (
18),
and alternative mechanisms for
initial mRNA-ribosome contact in
Archaea have been
hypothesized (
3).
The analysis of 28 kbp from
C. symbiosum has
identified genes indicative of several metabolic pathways (Table
2).
As our
study progresses, we expect to gain more critical
information
on the physiological potential of the organism. We have
already
identified overlapping fosmids that represent ca. 90 kbp
of the
C. symbiosum genome (unpublished data).
While serving as a model
for the development of environmental
genomic approaches to characterize
uncultivated organisms, the
C. symbiosum genome analysis also
highlights the
complications inherent in such studies that arise
from the widespread
genomic heterogeneity in natural populations,
even those
occupying a well-defined symbiotic niche. Our study
represents a
departure from pure-culture genomics. This approach
provides a
clearer view of the characteristics of naturally occurring
genomic variability.
Environmental genomics has the potential to elucidate the
physiologies of organisms that have resisted cultivation in the
laboratory. The true test of our understanding of the field of
genomics will be our ability to infer an organism's physiology
solely from its genome sequence.
| |
ACKNOWLEDGMENTS |
We thank Shane Andersen and Chris Gottschalk for their expert
diving and collecting assistance; Kathy Foltz for use of aquarium facilities; Anna Lenox, Bill Young, and Monnette Aujay for DNA sequencing; and Jeff Stein for comments on the manuscript.
This work was supported by Diversa Corporation and by NSF grants
OCE95-29804 and OPP94-18442 to E.E.D. C.S. was supported by a
fellowship from the Deutsche Forschungsgemeinschaft.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Diversa
Corporation, 10665 Sorrento Valley Rd., San Diego, CA 92121. Phone: (619) 623-5156. Fax: (619) 623-5120. E-mail:
rswanson{at}diversa.com.
Present address: Institute for Microbiology, Technical University
of Darmstadt, 64287 Darmstadt, Germany.
Present address: Monterey Bay Aquarium Research Institute, Moss
Landing, CA 95039.
| |
REFERENCES |
| 1.
|
Amann, R.,
J. Snaidr,
M. Wagner,
W. Ludwig, and K. H. Schleifer.
1996.
In situ visualization of high genetic diversity in a natural microbial community.
J. Bacteriol.
178:3496-3500[Abstract/Free Full Text].
|
| 2.
|
Bintrim, S. B.,
T. J. Donohue,
J. Handelsman,
G. P. Roberts, and R. M. Goodman.
1997.
Molecular phylogeny of Archaea from soil.
Proc. Natl. Acad. Sci. USA
94:277-282[Abstract/Free Full Text].
|
| 3.
|
Brown, J. W.,
C. J. Daniels, and J. N. Reeve.
1989.
Gene structure, organization, and expression in archaebacteria.
Crit. Rev. Microbiol.
16:287-337[Medline].
|
| 4.
|
Bult, C.,
O. White,
G. J. Olsen,
L. Zhou,
R. D. Fleischmann,
G. G. Sutton,
J. A. Blake,
L. M. FitzGerald,
R. A. Clayton,
J. D. Gocayne,
A. R. Kerlavage,
B. A. Dougherty,
J. F. Tomb,
M. D. Adams,
C. I. Reich,
R. Overbeek,
E. F. Kirkness,
K. G. Weinstock,
J. M. Merrick,
A. Glodek,
J. L. Scott,
N. S. M. Geoghagen,
J. F. Weidman,
J. L. Fuhrman,
D. Nguyen,
T. R. Utterback,
J. M. Kelley,
J. D. Peterson,
P. W. Sadow,
M. C. Hanna,
M. D. Cotton,
K. M. Roberts,
M. A. Hurst,
B. P. Kaine,
M. Borodovsky,
H. P. Klenk,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1996.
Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii.
Science
273:1058-1073[Abstract].
|
| 5.
|
Cohan, F. M.
1994.
The effects of rare but promiscuous genetic exchange on evolutionary divergence in prokaryotes.
Am. Nat.
143:956-986.
|
| 6.
|
DeLong, E. F.
1992.
Archaea in coastal marine environments.
Proc. Natl. Acad. Sci. USA
89:5685-5689[Abstract/Free Full Text].
|
| 7.
|
DeLong, E. F.
1997.
Marine microbial diversity: the tip of the iceberg.
Trends Biotechnol.
15:2-9.
|
| 8.
|
DeLong, E. F.,
K. Y. Wu,
B. B. Prezelin, and R. V. M. Jovine.
1994.
High abundance of Archaea in Antarctic marine picoplankton.
Nature
371:695-697[Medline].
|
| 9.
|
Field, K. G.,
D. Gordon,
T. Wright,
M. Rappe,
E. Urbach,
K. Vergin, and S. J. Giovannoni.
1997.
Diversity and depth-specific distribution of SAR11 cluster rRNA genes from marine planktonic bacteria.
Appl. Environ. Microbiol.
63:63-70[Abstract].
|
| 10.
|
Fuhrmann, J. A.,
K. McCallum, and A. A. Davis.
1992.
Novel major archaebacterial group from marine plankton.
Nature
356:148-149[Medline].
|
| 11.
|
Garrett, R. A.,
J. Dalgaard,
N. Larsen,
J. Kjems, and A. S. Mankin.
1991.
Archaeal rRNA operons.
Trends Biochem. Sci.
16:22-26[Medline].
|
| 12.
|
Giovannoni, S. J.,
T. B. Britschgi,
C. L. Moyer, and K. G. Field.
1990.
Genetic diversity in Sargasso Sea bacterioplankton.
Nature
345:60-63[Medline].
|
| 13.
|
Hain, J.,
W. D. Reiter,
U. Huedepohl, and W. Zillig.
1992.
Elements of an archaeal promoter defined by mutational analysis.
Nucleic Acids Res.
20:5423-5428[Abstract/Free Full Text].
|
| 14.
|
Hershberger, K. L.,
S. M. Barns,
A. L. Reysenbach,
S. C. Dawson, and N. R. Pace.
1996.
Wide diversity of Crenarchaeota.
Nature
384:420[Medline].
|
| 15.
|
Jurgens, G.,
K. Lindstroem, and A. Saano.
1997.
Novel group within the kingdom Crenarchaeota from boreal forest soil.
Appl. Environ. Microbiol.
63:803-805[Abstract].
|
| 16.
|
Kim, U.-J.,
H. Shizuya,
P. J. de Jong,
B. Birren, and M. I. Simon.
1992.
Stable propagation of cosmid sized human DNA inserts in an F factor based vector.
Nucleic Acids Res.
20:1083-1085[Abstract/Free Full Text].
|
| 17.
|
Klenk, H. P.,
R. A. Clayton,
J. F. Tomb,
O. White,
K. E. Nelson,
K. A. Ketchum,
R. J. Dodson,
M. Gwinn,
E. K. Hickey,
J. D. Peterson,
D. L. Richardson,
A. R. Kerlavage,
D. E. Graham,
N. C. Kyrpides,
R. D. Fleischmann,
J. Quackenbush,
N. H. Lee,
G. G. Sutton,
S. Gill,
E. F. Kirkness,
B. A. Dougherty,
K. McKenney,
M. D. Adams,
B. Loftus,
S. Peterson,
C. I. Reich,
L. K. McNeil,
J. H. Badger,
A. Glodek,
L. Zhou,
R. Overbeek,
J. D. Gocayne,
J. F. Weidman,
L. McDonald,
T. Utterback,
M. D. Cotton,
T. Spriggs,
P. Artiach,
B. P. Kaine,
S. M. Sykes,
P. W. Sadow,
K. P. D'Andrea,
C. Bowman,
C. Fujii,
S. A. Garland,
T. M. Mason,
G. J. Olsen,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1997.
The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus.
Nature
390:364-370[Medline].
|
| 18.
|
Klenk, H. P.,
C. Schleper,
V. Schwass, and R. Brudler.
1993.
Nucleotide sequence, transcription and phylogeny of the gene encoding the superoxide dismutase of Sulfolobus acidocaldarius.
Biochim. Biophys. Acta
1174:95-98[Medline].
|
| 19.
|
Kudo, Y.,
S. Shibata,
T. Miyaki,
T. Tono, and H. Oyaizu.
1997.
Peculiar archaea found in Japanese paddy soils.
Biosci. Biotechnol. Biochem.
61:917-920[Medline].
|
| 20.
|
MacGregor, B. J.,
D. P. Moser,
E. W. Alm,
K. H. Nealson, and D. Stahl.
1997.
Crenarchaeota in Lake Michigan sediment.
Appl. Environ. Microbiol.
63:1178-1181[Abstract].
|
| 21.
|
Martinez-Romero, E., and J. Caballero-Mellado.
1996.
Rhizobium phylogenies and bacterial genetic diversity.
Crit. Rev. Plant Sci.
15:113-140.
|
| 22.
|
Massana, R.,
A. E. Murray,
C. M. Preston, and E. F. DeLong.
1997.
Vertical distribution and phylogenetic characterization of marine planktonic archaea in the Santa Barbara Channel.
Appl. Environ. Microbiol.
63:50-56[Abstract].
|
| 23.
|
McInerney, J. O.,
M. Wilkinson,
J. W. Patching,
T. M. Embley, and R. Powell.
1995.
Recovery and phylogenetic analysis of novel archaeal rRNA sequences from a deep-sea deposit feeder.
Appl. Environ. Microbiol.
61:1646-1648[Abstract].
|
| 24.
|
Moore, L. R.,
G. Rocap, and S. W. Chisholm.
1998.
Physiology and molecular phylogeny of coexisting Prochlorococcus ecotypes.
Nature
393:464-467[Medline].
|
| 25.
|
Pace, N. R.
1997.
A molecular view of microbial diversity and the biosphere.
Science
276:734-740[Abstract/Free Full Text].
|
| 26.
|
Palmer, J. R., and C. J. Daniels.
1995.
In vivo definition of an archaeal promoter.
J. Bacteriol.
177:1844-1849[Abstract/Free Full Text].
|
| 27.
|
Palys, T.,
L. K. Nakamura, and F. M. Cohan.
1997.
Discovery and classification of ecological diversity in the bacterial world: the role of DNA sequence data.
Int. J. Syst. Bacteriol.
47:1145-1156[Abstract/Free Full Text].
|
| 28.
|
Preston, C. M.,
K. Y. Wu,
T. F. Molinski, and E. F. DeLong.
1996.
A psychrophilic crenarchaeon inhabits a marine sponge: Cenarchaeum symbiosum gen. nov., sp. nov.
Proc. Natl. Acad. Sci. USA
93:6241-6246[Abstract/Free Full Text].
|
| 29.
|
Rowan, R., and N. Knowlton.
1995.
Intraspecific diversity and ecological zonation in coral-algal symbiosis.
Proc. Natl. Acad. Sci. USA
92:2850-2853[Abstract/Free Full Text].
|
| 30.
|
Ruby, E. G.
1996.
Lessons from a cooperative bacterial-animal association: the Vibrio fischeri-Eupreymna scolopes light organ symbioses.
Annu. Rev. Microbiol.
50:591-624[Medline].
|
| 31.
|
Schleper, C.,
W. Holben, and H. P. Klenk.
1997.
Recovery of crenarchaeotal ribosomal DNA sequences from freshwater-lake sediments.
Appl. Environ. Microbiol.
63:321-323[Abstract].
|
| 32.
|
Schleper, C.,
R. V. Swanson,
E. J. Mathur, and E. F. DeLong.
1997.
Characterization of a DNA polymerase from the uncultivated psychrophilic archaeon Cenarchaeum symbiosum.
J. Bacteriol.
179:7803-7811[Abstract/Free Full Text].
|
| 33.
|
Sensen, C. W.,
H. P. Klenk,
R. K. Singh,
G. Allard,
C. C. Chan,
Q. Y. Liu,
S. L. Penny,
F. Young,
M. E. Schenk,
T. Gaasterland,
W. F. Doolittle,
M. A. Ragan, and R. L. Charlebois.
1996.
Organizational characteristics and information content of an archaeal genome: 156 kb of sequence from Sulfolobus solfataricus P2.
Mol. Microbiol.
22:175-191[Medline].
|
| 34.
|
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J. I. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum  H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155[Abstract/Free Full Text].
|
| 35.
|
Souza, V.,
L. Eguiarte,
G. Avila,
R. Cappello,
C. Gallardo,
J. Montoya, and D. Pinero.
1994.
Genetic structure of Rhizobium etli biovar phaseoli associated with wild and cultivated bean plants (Phaseolus vulgaris and Phaseolus coccineus) in Morelos, Mexico.
Appl. Environ. Microbiol.
60:1260[Abstract/Free Full Text].
|
| 36.
|
Stein, J. L.,
T. L. Marsh,
K. Y. Wu,
H. Shizuya, and E. F. DeLong.
1996.
Characterization of uncultivated prokaryotes: isolation and analysis of a 40-kilobase-pair genome fragment from a planktonic marine archaeon.
J. Bacteriol.
178:591-599[Abstract/Free Full Text].
|
| 37.
|
Ueda, T.,
Y. Suga, and T. Matsuguchi.
1995.
Molecular phylogenetic analysis of a soil microbial community.
Eur. J. Soil Sci.
46:415-421.
|
| 38.
|
Wayne, L.,
D. J. Brenner,
R. R. Colwell,
P. A. D. Grimont,
O. Kandler,
M. I. Krichevsky,
L. H. Moore,
W. E. C. Moore,
R. G. E. Murray,
E. Stackebrandt,
M. P. Starr, and H. G. Truper.
1987.
Report of the ad hoc committee on reconciliation of approaches to bacterial systematics.
Int. J. Syst. Bacteriol.
37:463-464[Free Full Text].
|
Journal of Bacteriology, October 1998, p. 5003-5009, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Grzymski, J. J., Murray, A. E., Campbell, B. J., Kaplarevic, M., Gao, G. R., Lee, C., Daniel, R., Ghadiri, A., Feldman, R. A., Cary, S. C.
(2008). Metagenome analysis of an extreme microbial symbiosis reveals eurythermal adaptation and metabolic flexibility. Proc. Natl. Acad. Sci. USA
105: 17516-17521
[Abstract]
[Full Text]
-
Taylor, M. W., Radax, R., Steger, D., Wagner, M.
(2007). Sponge-Associated Microorganisms: Evolution, Ecology, and Biotechnological Potential. Microbiol. Mol. Biol. Rev.
71: 295-347
[Abstract]
[Full Text]
-
Konstantinidis, K. T, Ramette, A., Tiedje, J. M
(2006). The bacterial species definition in the genomic era. Phil Trans R Soc B
361: 1929-1940
[Abstract]
[Full Text]
-
Hallam, S. J., Konstantinidis, K. T., Putnam, N., Schleper, C., Watanabe, Y.-i., Sugahara, J., Preston, C., de la Torre, J., Richardson, P. M., DeLong, E. F.
(2006). Genomic analysis of the uncultivated marine crenarchaeote Cenarchaeum symbiosum. Proc. Natl. Acad. Sci. USA
103: 18296-18301
[Abstract]
[Full Text]
-
Grzymski, J. J., Carter, B. J., DeLong, E. F., Feldman, R. A., Ghadiri, A., Murray, A. E.
(2006). Comparative Genomics of DNA Fragments from Six Antarctic Marine Planktonic Bacteria. Appl. Environ. Microbiol.
72: 1532-1541
[Abstract]
[Full Text]
-
Schirmer, A., Gadkari, R., Reeves, C. D., Ibrahim, F., DeLong, E. F., Hutchinson, C. R.
(2005). Metagenomic Analysis Reveals Diverse Polyketide Synthase Gene Clusters in Microorganisms Associated with the Marine Sponge Discodermia dissoluta. Appl. Environ. Microbiol.
71: 4840-4849
[Abstract]
[Full Text]
-
Cubonova, L., Sandman, K., Hallam, S. J., DeLong, E. F., Reeve, J. N.
(2005). Histones in Crenarchaea. J. Bacteriol.
187: 5482-5485
[Abstract]
[Full Text]
-
Whitaker, R. J., Banfield, J. F.
(2005). Population Dynamics Through the Lens of Extreme Environments. Reviews in Mineralogy and Geochemistry
59: 259-277
[Full Text]
-
Handelsman, J.
(2004). Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiol. Mol. Biol. Rev.
68: 669-685
[Abstract]
[Full Text]
-
Schmeisser, C., Stockigt, C., Raasch, C., Wingender, J., Timmis, K. N., Wenderoth, D. F., Flemming, H.-C., Liesegang, H., Schmitz, R. A., Jaeger, K.-E., Streit, W. R.
(2003). Metagenome Survey of Biofilms in Drinking-Water Networks. Appl. Environ. Microbiol.
69: 7298-7309
[Abstract]
[Full Text]
-
Beja, O., Koonin, E. V., Aravind, L., Taylor, L. T., Seitz, H., Stein, J. L., Bensen, D. C., Feldman, R. A., Swanson, R. V., DeLong, E. F.
(2002). Comparative Genomic Analysis of Archaeal Genotypic Variants in a Single Population and in Two Different Oceanic Provinces. Appl. Environ. Microbiol.
68: 335-345
[Abstract]
[Full Text]
-
Kähler, M., Antranikian, G.
(2000). Cloning and Characterization of a Family B DNA Polymerase from the Hyperthermophilic Crenarchaeon Pyrobaculum islandicum. J. Bacteriol.
182: 655-663
[Abstract]
[Full Text]
-
DeLong, E. F., Taylor, L. T., Marsh, T. L., Preston, C. M.
(1999). Visualization and Enumeration of Marine Planktonic Archaea and Bacteria by Using Polyribonucleotide Probes and Fluorescent In Situ Hybridization. Appl. Environ. Microbiol.
65: 5554-5563
[Abstract]
[Full Text]
-
Vetriani, C., Jannasch, H. W., MacGregor, B. J., Stahl, D. A., Reysenbach, A.-L.
(1999). Population Structure and Phylogenetic Characterization of Marine Benthic Archaea in Deep-Sea Sediments. Appl. Environ. Microbiol.
65: 4375-4384
[Abstract]
[Full Text]
Top
Abstract
Introduction
