![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Journal of Bacteriology, October 1998, p. 5003-5009, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Marine Science Institute, University of California, Santa Barbara, California 93106,1 and Diversa Corporation, San Diego, California 921212
Received 27 May 1998/Accepted 21 July 1998
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Molecular phylogenetic surveys have recently revealed an ecologically widespread crenarchaeal group that inhabits cold and temperate terrestrial and marine environments. To date these organisms have resisted isolation in pure culture, and so their phenotypic and genotypic characteristics remain largely unknown. To characterize these archaea, and to extend methodological approaches for characterizing uncultivated microorganisms, we initiated genomic analyses of the nonthermophilic crenarchaeote Cenarchaeum symbiosum found living in association with a marine sponge, Axinella mexicana. Complex DNA libraries derived from the host-symbiont population yielded several large clones containing the ribosomal operon from C. symbiosum. Unexpectedly, cloning and sequence analysis revealed the presence of two closely related variants that were consistently found in the majority of host individuals analyzed. Homologous regions from the two variants were sequenced and compared in detail. The variants exhibit >99.2% sequence identity in both small- and large-subunit rRNA genes and they contain homologous protein-encoding genes in identical order and orientation over a 28-kbp overlapping region. Our study not only indicates the potential for characterizing uncultivated prokaryotes by genome sequencing but also identifies the primary complication inherent in the approach: the widespread genomic microheterogeneity in naturally occurring prokaryotic populations.
| |
INTRODUCTION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Molecular phylogenetic surveys of mixed microbial populations have revealed the existence of many new lineages undetected by classical microbiological approaches (7, 25). Furthermore, quantitative rRNA hybridization experiments demonstrate that some of these novel prokaryotic groups represent major components of natural microbial communities. These molecular phylogenetic approaches have altered current views of microbial diversity and ecology and have demonstrated that traditional cultivation techniques may recover only a small, skewed fraction of naturally occurring microbes. However, phylogenetic identification using single gene sequences provides a limited perspective on other biological properties, particularly for novel lineages only distantly related to cultivated and characterized organisms. Consequently, additional approaches are necessary to better characterize ecologically abundant and potentially biotechnologically useful microorganisms, many of which resist cultivation attempts.
Nonthermophilic members of the kingdom Crenarchaeota are one of the more abundant, widespread, and frequently recovered prokaryotic groups revealed by molecular phylogenetic approaches. These microorganisms were originally detected in high abundance in temperate ocean waters and polar seas (6, 8, 10, 22, 23, 28). Representatives have now been reported to exist in terrestrial environments (2, 15, 19, 37) and freshwater lake sediments (14, 20, 31), indicating a widespread distribution. The ecological distribution of these organisms was initially surprising, since their closest cultivated relatives are all thermophilic or hyperthermophilic. No representative of this new archaeal group has yet been obtained in pure culture, and so the phenotypic and metabolic properties of these organisms as well as their impact on the environment and global nutrient cycling remain unknown. Since growth temperature and habitat characteristics vary so widely between nonthermophilic and the hyperthermophilic Crenarchaeota, these groups are likely to differ greatly with respect to specific physiology and metabolism.
To gain a better perspective on the genetic and physiological characteristics of nonthermophilic crenarchaeotes, we began a genomic study of Cenarchaeum symbiosum. This archaeon lives in specific association with the marine sponge Axinella mexicana off the coast of California (28), allowing access to relatively large amounts of biomass from this species. Our approach differs in several respects from now standard genomic characterization of cultivated organisms, and also from comparable studies of uncultivated obligate parasites or symbionts. C. symbiosum has not been completely physically separated from the tissues of its metazoan host. Therefore, its genetic material needs to be identified within the context of complex genomic libraries that contain significant amounts of eucaryotic DNA, as well as DNA derived from members of the domain Bacteria.
In the course of our study, we identified the presence of at least two major variants or strains of C. symbiosum that coexist inside the sponge tissues. This complexity of the C. symbiosum population was not detected in initial studies based solely on direct sequencing of PCR-amplified small-subunit (SSU) rRNA genes (28). This natural variation would also have been lost upon isolation of a pure culture. One component of our genomic analysis involved the sequencing and comparison of large, overlapping chromosomal regions from the two dominant naturally co-occurring C. symbiosum variants. The variability and distribution of the variants within different sponge individuals were also investigated.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Enrichment for C. symbiosum cells from sponge tissue, DNA extraction, and preparation of fosmid libraries. Preparation of archaeal cells for the first fosmid (16) library has been previously described (28). A small individual of A. mexicana was incubated in calcium- and magnesium-free artificial seawater (ASW) containing pronase (0.25 mg/ml); the tissue was then homogenized and enriched for archaeal cells by differential centrifugation. For the second library, prepared from a different sponge individual, this cell fraction was further incubated for 1 h at 4°C in 10 mM Tris-HCl (pH 8)-200 mM EDTA. This additional incubation step was found to increase the lysis of sponge cells, which resulted in an enhanced separation of archaeal and eucaryotic cells in the Percoll gradient. The cells were then pelleted and subsequently purified on a 15% Percoll (Sigma) cushion in ASW. Archaeal cells banded in the light, upper fraction after centrifugation at 2,500 rpm in a Beckman SS34 rotor. This cell fraction was washed in ASW and resuspended in TE buffer (10 mM Tris-HCl [pH 8], 0.1 mM EDTA). Quantitative hybridization experiments using a domain-specific oligonucleotide (6) indicated that 25 to 30% of the total rRNA from this fraction was derived from archaea. DNA extraction, preparation of the fosmid libraries, and PCR-based screening were performed as previously described (28, 36). The first fosmid library yielded 7 unique C. symbiosum rRNA operon-containing clones out of a total 10,236 recombinant fosmids (0.07%). The second fosmid library yielded eight unique C. symbiosum rRNA operon-containing clones out of 2,100 recombinants (0.38%).
Fosmid sequencing. Small (1- to 2-kbp)-insert plasmid libraries were prepared by cloning partial restriction enzyme digests of purified fosmids. Plasmids were sequenced by using Applied Biosystems Inc. (ABI; Foster City, Calif.) Prism dye terminator FS reaction mix. Direct sequencing from fosmids was used for gap filling and resequencing to ensure accuracy. Fosmid sequencing was performed by using DNA from a single 3-ml overnight culture purified on an Autogen 740 automated plasmid isolation system. Each reaction consisted of one preparation of DNA directly resuspended by the addition of 16 µl of H2O, 8 µl of oligonucleotide primer (1.4 pmol/µl), and 16 µl of ABI Prism dye terminator FS reaction mix. Cycle sequencing was performed with a 3-min preincubation at 96°C followed by 25 cycles of the sequence 96°C for 20 s-50°C for 20 s-60°C for 4 min and a 5-min postcycling incubation at 60°C. Sequencing reaction products were analyzed on ABI 377 sequencers.
Direct sequencing of PCR fragments. PCRs with two archaeon-specific 16S rDNA primers (21F and 958R [6], one biotinylated) were used to amplify a 950-bp fragment from total nucleic acids of 16 different sponge individuals. Primers 21F and 459R-LSU (CTTTCCCTCACGGTA) were used to amplify the 16S-23S spacer region from fosmids. The PCR products were purified and sequenced as described previously (28), with primer 519R for 16S rDNA and primer SP23rev (CTA TTG CCG TCT TTA CACC) for the spacer region.
rRNA hybridization. Two oligonucleotides specific for each variant type were designed from the 23S rDNA gene sequences (positions 283 to 303, E. coli numbering) of fosmids 101G10 and 60A5. The probes differ by three point mutations: L-St-C.symA-283-a-A-19 (variant A), ACACTTCAACTATTTCCTG; and L-St-C.symB-283-a-A-19 (variant B), ACACTTTGACTATTTCGTG. Nucleic acids from sponges (300 ng) and controls (fosmids 101G10 and 60A5, 50 ng of each) were denatured, bound to nylon membranes (Hybond-N; Amersham), hybridized with the labeled probes (22), and washed at 41.5°C. Hybridization was analyzed by autoradiography.
RFLP analysis of PCR fragments. Primers 21F (6) and 459R-LSU for amplification of 2.2 kbp of the ribosomal operon, primers GSAT810F (GAATCCGCCCCCGACTATCTT) and 16S37REV (CATGGCTTAGTATCAATC) for amplification of the 16S RNA-glutamate semialdehyde aminotransferase (GSAT) region (2.2 kbp), and primers Cenpol357F (ACITACAACGGIGACGAYTTTGA) and Cenpol735R (CACCCCGAARTAGTTYTTYTT) for an internal DNA polymerase fragment (of 1,134 bp) were used in PCRs with 5 ng of purified fosmids. The PCR products were cut with TaqI and HpaII (16S-23S RNA), HaeIII and RsaI (GSAT-16S RNA), or HaeIII and AvaII (polymerase) and analyzed on 2% agarose gels. If the pattern did not exactly match but closely resembled the restriction fragment length polymorphism (RFLP) of either type A or B, it was denoted by a lowercase letter (a or b [Table 1]), meaning that at least three of four or three of five bands created by restriction digest appear identical in size to the ones from either type A or B.
Nucleotide sequence accession numbers. The sequences described in this report have been deposited in GenBank under accession no. AF083072 (fosmid 101G10) and AF083071 (fosmid 60A5).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Isolation and comparison of fosmid clones from two environmental libraries. We constructed two environmental fosmid libraries from tissue preparations of the A. mexicana-C. symbiosum association that were enriched for archaeal cells. These libraries yielded 15 unique C. symbiosum rRNA operon-containing fosmids. Partial sequence and RFLP analysis of the SSU RNA genes of all 15 fosmids revealed the presence of two variants, termed A and B, that differed by only two point mutations over a 590-bp region. Southern blotting of restriction digests of entire fosmids also confirmed the presence of two classes of rRNA operon-containing clones (data not shown). A total of 10 clones were identified as variant A, and 5 clones represented variant B (Table 1). The A/B variant recovery ratios were 4:3 in the first library and 6:2 in the second library.
|
|
|
Analysis of the 28-kbp genomic fragment from C. symbiosum.
The average G+C contents in the fosmid inserts were
55.6% for variant A and 57.1% for variant B in protein coding regions but were significantly lower in the gene for the hypothetical protein
01 and in the repetitive element of variant A (Fig. 1). Genes appear as
densely packed in C. symbiosum as they are in other
sequenced archaeal genomes (4, 17, 34). The rRNA operon is composed of the genes for 16S and 23S RNAs separated by spacer of 131 bp. This organization is typical of crenarchaeotes and
differs from that of rRNA operons of euryarchaeotes, which usually contain 5S RNA and tRNA genes (11). Another stable
RNA gene, coding for tRNATyr, is found separate from the
rRNA operon. This tRNA contains a 45 bp intron in the
vicinity of the anticodon loop. Of the 17 predicted protein-encoding
genes, 9 show significant matches to genes of assigned function from
the public databases. Three are homologous to hypothetical proteins
from other organisms (Table 1). In a number of cases, the highest
similarity of derived amino acid sequences is with known archaeal
proteins. In particular, DNA polymerase, TATA box-binding protein
(TBP), and triosephosphate isomerase gene sequences could be analyzed
in greater detail because several archaeal homologs are known. The DNA
polymerase shares highest overall similarity with the crenarchaeal
homologs from the extreme thermophiles Sulfolobus
acidocaldarius and Pyrodictium occultum (54 and 53%,
respectively) and exhibits all conserved motifs of B-(
-)type DNA
polymerases and 3'-5'-exonuclease motifs, both indicative of archaeal
polymerases. A more detailed phylogenetic analysis and biochemical
characterization of the C. symbiosum polymerase
has been published elsewhere (32). The TBP is
similar to other known archaeal TBPs and is N-terminally truncated
with respect to the eucaryal homologs. It shows 49% amino acid
similarity with TBP from Pyrococcus woesii. The
triosephosphate isomerase represents the first such
protein sequence reported for a crenarchaeote and has known
archaeal signature sequences and deletions which distinguish
archaeal triosephosphate isomerase genes from their eucaryal
and eubacterial homologues (data not shown). We identified an
ATP-dependent RNA helicase that is highly similar in sequence to
homologues found in the complete genome sequences of three euryarchaeotes (4, 17, 34). GSAT, also detected in an
rRNA operon containing genomic fragment of a
planktonic marine crenarchaeote (36), is also present.
|
Distribution of C. symbiosum variants in host-associated natural populations. The unexpected finding of two distinct but highly related genomic variants of C. symbiosum in libraries derived from two different sponge isolates led us to investigate whether this variation occurred consistently in other samples. Sequence analysis of 590 bp of the 16S rRNA gene revealed two variant positions (175 and 183.7, E. coli numbering [Table 3]). These signature nucleotides were used to determine the presence of the variants in natural populations of A. mexicana by direct sequencing of 16S rDNA PCR products from 16 different sponge individuals collected from different locations and at different times. In 15 cases, U/C ambiguities were found at the signature positions, indicating the presence of both variants (Table 3). Only one sponge (s4) yielded an unambiguous sequence identical to that of variant A, but variant B was detected in this individual by another criterion. The second approach detected variation in LSU rRNA, using oligonucleotides uniquely specific for each variant type. In the majority of host individuals examined, the presence of both LSU rRNA variants was observed (Table 3), again suggesting that the specific association of C. symbiosum with its host typically involves the presence of both variants.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
We chose C. symbiosum as a representative of the nonthermophilic crenarchaeotes to begin characterization of this newly detected, ecologically widespread but phenotypically uncharacterized lineage. The specific association of C. symbiosum with the marine sponge A. mexicana provides a tractable experimental system, allowing access to these novel uncultivated microorganisms in an enriched form.
Environmental genomic analysis reveals a heterogenous population of C. symbiosum. Initial studies suggested that only one specific archaeal phylotype was associated with the sponge (28). The analysis presented here reveals heterogeneity at the subspecies level in C. symbiosum (see below), as a result of the higher resolution and more comprehensive nature of genome characterization compared to phylogenetic surveys based on a single genetic locus (e.g., SSU rRNA). We found two highly similar phylotypes (A and B) in two independently created libraries from the symbiotic association (Table 1) and have detected these consistently in nearly all sponge individuals analyzed (Table 3). By extending analyses outside the rRNA operon, we detected further divergence in less conserved protein coding and intergenic regions (Table 1; Fig. 1). Over the 28-kbp region analyzed, the variants showed >99.2% identity in their rRNA genes, approximately 87.8% overall DNA identity, an average of 91.6% similarity in ORF amino acid sequence, and complete colinearity of protein-encoding regions. Our data therefore suggest that the sponge-associated archaeal population consists of two major types, represented by fosmids 101G10 and 60A5, whose similarity is so great that by standard criteria (e.g., rRNA and genomic DNA similarity [38]) they could be considered different strains of a single species, C. symbiosum. Both variants also display further microheterogeneity, which is not evident on the rRNA level (Table 1).
Generally, the concept of symbiosis implies a specific association between a particular symbiont and a particular host. Very few studies, however, have analyzed the degree of diversity within single symbiotic populations (21, 29, 30, 35) in single host individuals. Our finding of two distinguishable variants in the archaeal-metazoan symbiosis indicates that both variants are concurrently stably maintained in the sponge host. Their close phylogenetic relationship and the extremely high similarity of protein-encoding regions, combined with evidence for further microheterogeneity of the two rRNA variants, strongly suggests that a population of strains or variants of C. symbiosum is coevolving in the context of the sponge-archaeon association. If this is the case, then transmission of the symbionts to the next host generation probably involves a population of archaeal cells that is large enough to maintain the diversity that we observed within each particular host individual. The mode of transmission of C. symbiosum, as well as its physical distribution within the sponge tissues, is under investigation in our laboratory. It is also possible that there is another environmental reservoir of C. symbiosum and that A. mexicana is selectively infected with closely related strains. Contemporary surveys of natural microbial assemblages now routinely use cloning and analysis of phylogenetically informative gene sequences from mixed populations. Many novel and previously undetected microbial groups, including C. symbiosum and other previously uncultivated archaea, have been discovered by using this approach. A consistent pattern that has emerged in virtually all such studies among widely disparate taxa is the recovery of highly related but distinct rRNA gene clades or clusters (1, 6, 9, 12). Several explanations have been suggested for the high genetic diversity found in rRNA gene surveys, including PCR or sequencing artifacts, variation within rRNA operons in a single chromosome, or variation in rRNA genes among highly related, co-occurring strains (1, 9). The environmental distributions of such highly related rRNA genes (9), as well as the expression of rRNA variation within individual cells (1), indicates that much of the naturally occurring rRNA gene microheterogeneity may be due to authentic organismal genetic diversity. Our results tend to corroborate these findings, since the highly similar, syntenic chromosomal DNA fragments that we analyzed appear to be derived from naturally co-occurring but closely related strains. How are such highly related sympatric strains, nearly indistinguishable by SSU rRNA sequence, stably maintained in their natural habitat? Previous studies of diversity at the level of protein-encoding genes indicate that ecologically distinct bacterial populations, through the action of purging selection, form distinctive clusters at all genetic loci examined (5). Furthermore, ecologically distinct species of highly related strains, indistinguishable by SSU rRNA sequences, do fall into separate sequence similarity clusters when their protein-encoding genes are compared. Palys et al., on the basis of theoretical considerations and empirical data, conclude that in cases where sympatric species form distinct similarity clusters, they must certainly show ecological differences (27). A good example of this is a recent report of naturally co-occurring closely related Proclorococcus 16S rRNA variants, each adapted for optimal growth at different light intensities (24). One explanation of our data that is consistent with this hypothesis is that the symbiotic variants occupy different compartments within their sponge host, occupying different niches that allow their stable transmission. Another distinct possibility is the evolution of a metabolic interdependence between the two strains, requiring the cotransmission of both variants to maintain the symbiosis. A third possibility is that the differences between the strains are currently neutral, and although one is expected to dominate eventually, there is a period of time when both coexist.Genomic analysis of C. symbiosum reveals typical features of Archaea. The sequence analysis of 28 kbp of contiguous DNA from two C. symbiosum variants reveals many features typical for Archaea, and particularly for Crenarchaeota, confirming the phylogenetic affiliation inferred from analysis of the SSU rRNA sequence (28): the rRNA gene order, spacer region, and structure are most similar to those found in the hyperthermophilic Crenarchaeota. The GSAT gene, which is located directly upstream of the ribosomal operon, was found in the same relative location on a fosmid derived from a planktonic marine crenarchaeote (36). Deduced amino acid sequences of proteins all share highest overall similarity with archaeal proteins, whenever known homologues are available.
The findings of a TBP gene and of promoter elements that follow the archaeal TATA box consensus suggest a typical archaeal transcription mechanism. Interestingly, most of the C. symbiosum promoters that we identified were located such that transcription initiation must occur close to the translational start codon, allowing no space for a ribosomal binding site in an untranslated mRNA leader. A similar observation has been made for 30 of the predicted 100 strong and medium promoters from 156-kbp sequence of Sulfolobus solfataricus (33). Transcription initiation at or near the translational start codons has been mapped for some genes in Halobacterium salinarium (3) and S. solfataricus (18), and alternative mechanisms for initial mRNA-ribosome contact in Archaea have been hypothesized (3). The analysis of 28 kbp from C. symbiosum has identified genes indicative of several metabolic pathways (Table 2). As our study progresses, we expect to gain more critical information on the physiological potential of the organism. We have already identified overlapping fosmids that represent ca. 90 kbp of the C. symbiosum genome (unpublished data). While serving as a model for the development of environmental genomic approaches to characterize uncultivated organisms, the C. symbiosum genome analysis also highlights the complications inherent in such studies that arise from the widespread genomic heterogeneity in natural populations, even those occupying a well-defined symbiotic niche. Our study represents a departure from pure-culture genomics. This approach provides a clearer view of the characteristics of naturally occurring genomic variability. Environmental genomics has the potential to elucidate the physiologies of organisms that have resisted cultivation in the laboratory. The true test of our understanding of the field of genomics will be our ability to infer an organism's physiology solely from its genome sequence.| |
ACKNOWLEDGMENTS |
|---|
We thank Shane Andersen and Chris Gottschalk for their expert diving and collecting assistance; Kathy Foltz for use of aquarium facilities; Anna Lenox, Bill Young, and Monnette Aujay for DNA sequencing; and Jeff Stein for comments on the manuscript.
This work was supported by Diversa Corporation and by NSF grants OCE95-29804 and OPP94-18442 to E.E.D. C.S. was supported by a fellowship from the Deutsche Forschungsgemeinschaft.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Diversa Corporation, 10665 Sorrento Valley Rd., San Diego, CA 92121. Phone: (619) 623-5156. Fax: (619) 623-5120. E-mail: rswanson{at}diversa.com.
Present address: Institute for Microbiology, Technical University
of Darmstadt, 64287 Darmstadt, Germany.
Present address: Monterey Bay Aquarium Research Institute, Moss
Landing, CA 95039.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Amann, R.,
J. Snaidr,
M. Wagner,
W. Ludwig, and K. H. Schleifer.
1996.
In situ visualization of high genetic diversity in a natural microbial community.
J. Bacteriol.
178:3496-3500 |
| 2. |
Bintrim, S. B.,
T. J. Donohue,
J. Handelsman,
G. P. Roberts, and R. M. Goodman.
1997.
Molecular phylogeny of Archaea from soil.
Proc. Natl. Acad. Sci. USA
94:277-282 |
| 3. | Brown, J. W., C. J. Daniels, and J. N. Reeve. 1989. Gene structure, organization, and expression in archaebacteria. Crit. Rev. Microbiol. 16:287-337[Medline]. |
| 4. | Bult, C., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, J. F. Weidman, J. L. Fuhrman, D. Nguyen, T. R. Utterback, J. M. Kelley, J. D. Peterson, P. W. Sadow, M. C. Hanna, M. D. Cotton, K. M. Roberts, M. A. Hurst, B. P. Kaine, M. Borodovsky, H. P. Klenk, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C. Venter. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073[Abstract]. |
| 5. | Cohan, F. M. 1994. The effects of rare but promiscuous genetic exchange on evolutionary divergence in prokaryotes. Am. Nat. 143:956-986. |
| 6. |
DeLong, E. F.
1992.
Archaea in coastal marine environments.
Proc. Natl. Acad. Sci. USA
89:5685-5689 |
| 7. | DeLong, E. F. 1997. Marine microbial diversity: the tip of the iceberg. Trends Biotechnol. 15:2-9. |
| 8. | DeLong, E. F., K. Y. Wu, B. B. Prezelin, and R. V. M. Jovine. 1994. High abundance of Archaea in Antarctic marine picoplankton. Nature 371:695-697[Medline]. |
| 9. | Field, K. G., D. Gordon, T. Wright, M. Rappe, E. Urbach, K. Vergin, and S. J. Giovannoni. 1997. Diversity and depth-specific distribution of SAR11 cluster rRNA genes from marine planktonic bacteria. Appl. Environ. Microbiol. 63:63-70[Abstract]. |
| 10. | Fuhrmann, J. A., K. McCallum, and A. A. Davis. 1992. Novel major archaebacterial group from marine plankton. Nature 356:148-149[Medline]. |
| 11. | Garrett, R. A., J. Dalgaard, N. Larsen, J. Kjems, and A. S. Mankin. 1991. Archaeal rRNA operons. Trends Biochem. Sci. 16:22-26[Medline]. |
| 12. | Giovannoni, S. J., T. B. Britschgi, C. L. Moyer, and K. G. Field. 1990. Genetic diversity in Sargasso Sea bacterioplankton. Nature 345:60-63[Medline]. |
| 13. |
Hain, J.,
W. D. Reiter,
U. Huedepohl, and W. Zillig.
1992.
Elements of an archaeal promoter defined by mutational analysis.
Nucleic Acids Res.
20:5423-5428 |
| 14. | Hershberger, K. L., S. M. Barns, A. L. Reysenbach, S. C. Dawson, and N. R. Pace. 1996. Wide diversity of Crenarchaeota. Nature 384:420[Medline]. |
| 15. | Jurgens, G., K. Lindstroem, and A. Saano. 1997. Novel group within the kingdom Crenarchaeota from boreal forest soil. Appl. Environ. Microbiol. 63:803-805[Abstract]. |
| 16. |
Kim, U.-J.,
H. Shizuya,
P. J. de Jong,
B. Birren, and M. I. Simon.
1992.
Stable propagation of cosmid sized human DNA inserts in an F factor based vector.
Nucleic Acids Res.
20:1083-1085 |
| 17. | Klenk, H. P., R. A. Clayton, J. F. Tomb, O. White, K. E. Nelson, K. A. Ketchum, R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L. Richardson, A. R. Kerlavage, D. E. Graham, N. C. Kyrpides, R. D. Fleischmann, J. Quackenbush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A. Dougherty, K. McKenney, M. D. Adams, B. Loftus, S. Peterson, C. I. Reich, L. K. McNeil, J. H. Badger, A. Glodek, L. Zhou, R. Overbeek, J. D. Gocayne, J. F. Weidman, L. McDonald, T. Utterback, M. D. Cotton, T. Spriggs, P. Artiach, B. P. Kaine, S. M. Sykes, P. W. Sadow, K. P. D'Andrea, C. Bowman, C. Fujii, S. A. Garland, T. M. Mason, G. J. Olsen, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C. Venter. 1997. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature 390:364-370[Medline]. |
| 18. | Klenk, H. P., C. Schleper, V. Schwass, and R. Brudler. 1993. Nucleotide sequence, transcription and phylogeny of the gene encoding the superoxide dismutase of Sulfolobus acidocaldarius. Biochim. Biophys. Acta 1174:95-98[Medline]. |
| 19. | Kudo, Y., S. Shibata, T. Miyaki, T. Tono, and H. Oyaizu. 1997. Peculiar archaea found in Japanese paddy soils. Biosci. Biotechnol. Biochem. 61:917-920[Medline]. |
| 20. | MacGregor, B. J., D. P. Moser, E. W. Alm, K. H. Nealson, and D. Stahl. 1997. Crenarchaeota in Lake Michigan sediment. Appl. Environ. Microbiol. 63:1178-1181[Abstract]. |
| 21. | Martinez-Romero, E., and J. Caballero-Mellado. 1996. Rhizobium phylogenies and bacterial genetic diversity. Crit. Rev. Plant Sci. 15:113-140. |
| 22. | Massana, R., A. E. Murray, C. M. Preston, and E. F. DeLong. 1997. Vertical distribution and phylogenetic characterization of marine planktonic archaea in the Santa Barbara Channel. Appl. Environ. Microbiol. 63:50-56[Abstract]. |
| 23. | McInerney, J. O., M. Wilkinson, J. W. Patching, T. M. Embley, and R. Powell. 1995. Recovery and phylogenetic analysis of novel archaeal rRNA sequences from a deep-sea deposit feeder. Appl. Environ. Microbiol. 61:1646-1648[Abstract]. |
| 24. | Moore, L. R., G. Rocap, and S. W. Chisholm. 1998. Physiology and molecular phylogeny of coexisting Prochlorococcus ecotypes. Nature 393:464-467[Medline]. |
| 25. |
Pace, N. R.
1997.
A molecular view of microbial diversity and the biosphere.
Science
276:734-740 |
| 26. |
Palmer, J. R., and C. J. Daniels.
1995.
In vivo definition of an archaeal promoter.
J. Bacteriol.
177:1844-1849 |
| 27. | Palys, T., L. K. Nakamura, and F. M. Cohan. 1997. Discovery and classification of ecological diversity in the bacterial world: the role of DNA sequence data. Int. J. Syst. Bacteriol. 47:1145-1156[Medline]. |
| 28. |
Preston, C. M.,
K. Y. Wu,
T. F. Molinski, and E. F. DeLong.
1996.
A psychrophilic crenarchaeon inhabits a marine sponge: Cenarchaeum symbiosum gen. nov., sp. nov.
Proc. Natl. Acad. Sci. USA
93:6241-6246 |
| 29. |
Rowan, R., and N. Knowlton.
1995.
Intraspecific diversity and ecological zonation in coral-algal symbiosis.
Proc. Natl. Acad. Sci. USA
92:2850-2853 |
| 30. | Ruby, E. G. 1996. Lessons from a cooperative bacterial-animal association: the Vibrio fischeri-Eupreymna scolopes light organ symbioses. Annu. Rev. Microbiol. 50:591-624[Medline]. |
| 31. | Schleper, C., W. Holben, and H. P. Klenk. 1997. Recovery of crenarchaeotal ribosomal DNA sequences from freshwater-lake sediments. Appl. Environ. Microbiol. 63:321-323[Abstract]. |
| 32. |
Schleper, C.,
R. V. Swanson,
E. J. Mathur, and E. F. DeLong.
1997.
Characterization of a DNA polymerase from the uncultivated psychrophilic archaeon Cenarchaeum symbiosum.
J. Bacteriol.
179:7803-7811 |
| 33. | Sensen, C. W., H. P. Klenk, R. K. Singh, G. Allard, C. C. Chan, Q. Y. Liu, S. L. Penny, F. Young, M. E. Schenk, T. Gaasterland, W. F. Doolittle, M. A. Ragan, and R. L. Charlebois. 1996. Organizational characteristics and information content of an archaeal genome: 156 kb of sequence from Sulfolobus solfataricus P2. Mol. Microbiol. 22:175-191[Medline]. |
| 34. |
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J. I. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum  H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155 |
| 35. |
Souza, V.,
L. Eguiarte,
G. Avila,
R. Cappello,
C. Gallardo,
J. Montoya, and D. Pinero.
1994.
Genetic structure of Rhizobium etli biovar phaseoli associated with wild and cultivated bean plants (Phaseolus vulgaris and Phaseolus coccineus) in Morelos, Mexico.
Appl. Environ. Microbiol.
60:1260 |
| 36. |
Stein, J. L.,
T. L. Marsh,
K. Y. Wu,
H. Shizuya, and E. F. DeLong.
1996.
Characterization of uncultivated prokaryotes: isolation and analysis of a 40-kilobase-pair genome fragment from a planktonic marine archaeon.
J. Bacteriol.
178:591-599 |
| 37. | Ueda, T., Y. Suga, and T. Matsuguchi. 1995. Molecular phylogenetic analysis of a soil microbial community. Eur. J. Soil Sci. 46:415-421. |
| 38. | Wayne, L., D. J. Brenner, R. R. Colwell, P. A. D. Grimont, O. Kandler, M. I. Krichevsky, L. H. Moore, W. E. C. Moore, R. G. E. Murray, E. Stackebrandt, M. P. Starr, and H. G. Truper. 1987. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Bacteriol. 37:463-464. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |
