This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagahashi, S.
Right arrow Articles by Bussey, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagahashi, S.
Right arrow Articles by Bussey, H.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 1998, p. 5020-5029, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Isolation of Candida glabrata Homologs of the Saccharomyces cerevisiae KRE9 and KNH1 Genes and Their Involvement in Cell Wall beta -1,6-Glucan Synthesis

Shigehisa Nagahashi,dagger Marc Lussier, and Howard Bussey*

Department of Biology, McGill University, Montréal, Quebec, Canada H3A 1B1

Received 18 May 1998/Accepted 28 July 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The Candida glabrata KRE9 (CgKRE9) and KNH1 (CgKNH1) genes have been isolated as multicopy suppressors of the tetracycline-sensitive growth of a Saccharomyces cerevisiae mutant with the disrupted KNH1 locus and the KRE9 gene placed under the control of a tetracycline-responsive promoter. Although a cgknh1Delta mutant showed no phenotype beyond slightly increased sensitivity to the K1 killer toxin, disruption of CgKRE9 resulted in several phenotypes similar to those of the S. cerevisiae kre9Delta null mutant: a severe growth defect on glucose medium, resistance to the K1 killer toxin, a 50% reduction of beta -1,6-glucan, and the presence of aggregates of cells with abnormal morphology on glucose medium. Replacement in C. glabrata of the cognate CgKRE9 promoter with the tetracycline-responsive promoter in a cgknh1Delta background rendered cell growth tetracycline sensitive on media containing glucose or galactose. cgkre9Delta cells were shown to be sensitive to calcofluor white specifically on glucose medium. In cgkre9 mutants grown on glucose medium, cellular chitin levels were massively increased.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Candida (Torulopsis) glabrata, an imperfect fungus, is a haploid yeast of the genus Candida and has been demonstrated to be a pathogen of opportunistic yeast infections (1). There are increasing concerns over C. glabrata, because it causes not only mucocutaneous but also systemic infections in transplant and immunosuppressed patients (21, 58, 59). Moreover, the extensive use of topical and systemic antifungal drugs has resulted in the appearance of azole-resistant infections with Candida species, including C. glabrata (41, 59). Thus, there is a need to develop new antifungal drugs with novel modes of action and broad spectra.

Fungal cell wall biosynthesis is one possible target for new antifungal drugs, since it is essential for fungal viability and does not occur in mammals (18, 19). Fungal cell wall biosynthesis has been studied quite extensively in Saccharomyces cerevisiae (11, 14, 30) and Candida albicans (5, 11, 19, 36, 37) but not in C. glabrata. However, in addition to the advantage of its haploidy in genetic manipulation, recent progress on the molecular biology of C. glabrata, including development of host-vector systems (28, 29, 60), a controllable gene expression system (40), and the isolation of several structural sequences (17, 28, 35, 44), provides us with an opportunity to study cell wall biosynthesis in this organism.

beta -1,6-Glucan is a component of fungal cell walls, where it occurs as a polymer covalently attached to glycoproteins (26, 38) and to other cell wall structural polymers such as beta -1,3-glucan and chitin (14, 30). In S. cerevisiae, many genes involved in beta -1,6-glucan synthesis were isolated through mutations (kre [killer resistant] mutations) that confer resistance to the K1 killer toxin, which kills sensitive yeast cells following binding to this beta -1,6-glucan polymer (4, 6, 8, 15, 34, 48, 49). While other genetic studies have identified additional genes affecting cellular levels of beta -1,6-glucan (24, 25, 46, 55), it still remains unclear how these genes, including the KRE genes, are concerned in beta -1,6-glucan biosynthesis. Among them, KRE9 and its homolog KNH1, genes encoding cell surface O glycoproteins, are required for beta -1,6-glucan synthesis in S. cerevisiae (6, 8, 15). The S. cerevisiae kre9Delta null mutant shows several phenotypes: resistance to K1 killer toxin; slow growth, especially on glucose media; an 80% reduction of alkali-insoluble beta -1,6-glucan; and defects in cell separation. Overexpression of KNH1 can partially suppress these phenotypes of a kre9Delta null mutant (15). Although a knh1Delta null mutant showed no obvious phenotype, disruption of both KRE9 and KNH1 was synthetically lethal (15). Further, the SKN7 gene encoding a yeast homolog of bacterial two-component regulators has also been isolated as a multicopy suppressor of the slow-growth phenotype of the kre9Delta null mutant (7, 9). Recently, a homolog of the KRE9 gene has been isolated from C. albicans (33).

Here we report isolation of the KRE9 and KNH1 homologs in C. glabrata and several lines of evidence, including the first analysis of cell wall components in C. glabrata, suggesting evolutionary conservation of these molecules as essential components of beta -1,6-glucan synthesis.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Strains, growth media, and procedures. The S. cerevisiae and C. glabrata strains used in this study are listed in Table 1. YPD and YPGal are complex yeast media with 2% glucose and 2% galactose, respectively, and YNB is a synthetic medium with either 2% glucose or 2% galactose and supplemented for auxotrophic requirements. Yeast transformations were carried out by the modified lithium acetate method (20, 23) and the one-step transformation method (12). Tetracycline assays were carried out as previously described (39). Seeded-plate assays for killer toxin sensitivity were performed as previously described (8). Spotting assays were performed as previously described (31). 5-Fluoro-orotic acid, G418 (Geneticin), and calcofluor white (CFW) were purchased from PCR Inc. (Gainesville, Fla.), GIBCO BRL (Grand Island, N.Y.), and Polysciences Inc. (Warrington, Pa.), respectively. Plasmid DNA was propagated in Escherichia coli XL-1-blue cells (Stratagene, La Jolla, Calif.).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Yeast strains used in this study

Manipulation of DNA. Techniques for manipulation of DNA were performed as previously described (52). Yeast genomic DNA was prepared as previously described (51). Southern blots were performed by using nylon membranes (Hybond N; Amersham Canada Limited, Oakville, Ontario, Canada) and following the instructions of the manufacturer. A PCR fragment harboring the entire coding sequence for S. cerevisiae KRE9 was used as a probe. DNA sequencing was performed by the dideoxy method (53) on an ABI 373A sequencer with Bluescript universal and reverse primers and synthetic oligonucleotides complementary to specific regions of CgKRE9 and CgKNH1.

Plasmids. A 0.7-kbp HindIII fragment harboring the tetO-HOP1 chimeric promoter and a 1.4-kbp NotI fragment harboring the kanamycin resistance gene (Kanr) were excised from p97t (39) and pKanMX2 (57), respectively, and systematically cloned into Bluescript SKII+ (Stratagene) to generate p97tKan. A 0.4-kbp SpeI-SacII fragment of pMPY-ZAP (54), harboring the hisG sequence, was blunted with T4 DNA polymerase (GIBCO BRL) and cloned into the EcoRV site of Bluescript SKII+ to construct phisG+ and phisG-. The latter plasmids have their hisG sequences in opposite orientations. A 0.4-kbp SmaI-EcoRV fragment of phisG+, a 1.1-kbp SmaI-HindIII fragment of pMPY-ZAP (harboring the S. cerevisiae URA3 gene), and a 0.4-kbp HindIII-SmaI fragment of phisG- were systematically cloned into Bluescript SKII+ to generate pSNZAP3, harboring a modified hisG-URA3-hisG module.

A 1.0-kbp EcoRI-HindIII fragment harboring the entire CgKRE9 sequence was generated by PCR from C. glabrata genomic DNA with a pair of primers (5'-AAAGAATTCGGATCCAACACGCCTGTTGTG-3', 5'-TTTCTCAAGCTTTTGGAAGATGGGAGGAC-3'), cloned into pUC118, and subjected to replacement of the region between KpnI and SalI sites with the C. glabrata TRP1 (CgTRP1) sequence (28) to generate pCGK9Delta T (Fig. 1A). The 5' portion of the CgKNH1 sequence was generated by PCR with a pair of primers (5'-ATATGGTACCAATCAAATGCTCTCG-3', 5'-CGTTGGGCCCGACACTCTGCGACACTTC-3') as a 0.3-kbp KpnI-SmaI fragment. The 3' portion of the CgKNH1 sequence was generated by PCR with a pair of primers (5'-ATATGGATCCTTACGGGGAACAGAACGG-3', 5'-AAGAGAGCTCAGTAAGTAGAGTGAATATAC-3') as a 0.4-kbp BamHI-SacI fragment. These two fragments and a 1.0-kbp XhoI fragment harboring the C. glabrata HIS3 (CgHIS3) gene (28) were cloned into Bluescript SKII+ to generate pCGK1Delta H (Fig. 1B). A portion of the CgKRE9 sequence including the start codon was generated by PCR with pSB2-1 as a template and a pair of primers (5'-CCATCGATGAATTCATGCTGCTGCTGGCTATACTGCTATC-3', 5'-TTTCTCAAGCTTTTGGAAGATGGGAGGAC-3') as a 0.3-kbp EcoRI-KpnI fragment. This fragment and a 1.4-kbp SacI-BamHI fragment of pSB2-1 were cloned into p97t (39) to generate pCGK9tetAB (Fig. 2A).


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1.   Disruption of CgKRE9 and CgKNH1 and morphological effects of the deletions. (A) Disruption of CgKRE9. A PCR-amplified fragment (double-headed arrow) from pCGK9Delta T (Materials and Methods) was used for the one-step gene replacement. (B) Disruption of CgKNH1. A KpnI-SacI fragment of pCGK1Delta H (Materials and Methods) was used for the one-step gene replacement. Homologous recombination between the two regions (hatched boxes) resulted in disruption of the chromosomal copy. The wild-type strain, 2001HTU (C), cgkre9Delta deletion strain SNBG1-7-7 (D), and cgknh1Delta deletion strain SNBG2-26 (E) as viewed by Normarski optics are shown. Cells precultured on galactose medium were cultured on glucose medium.


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2.   Construction of a tetracycline-sensitive mutant of CgKRE9 (Tets CgKRE9). (A) Scheme for replacement of the cognate CgKRE9 promoter region with the tetracycline-responsive promoter. A PCR-amplified fragment (double-headed arrow) from pCGK9tetAB (Materials and Methods) was used for the one-step gene replacement. The solid arrow indicates the ORF of CgKRE9. Open and shaded boxes indicate the S. cerevisiae URA3 gene and the tetracycline-responsive promoter, 97t, respectively. Homologous recombination between the two regions (hatched boxes) resulted in generation of the Tets CgKRE9 mutant. (B) Growth inhibition by tetracycline on the Tets CgKRE9 mutants. A total of 104 cells were inoculated and were cultured on YPD (solid bars) or on YPGal (open bars) for 20 h at 30°C. Growth of cells with tetracycline (50 µg/ml) is expressed as percent of optical density at 600 nm of cells without tetracycline. As the wild type (WT), strain ACG22 (Table 1) was used. Error bars, standard deviations.

pRS424 (13) was used to clone fragments for deletional analysis of the inserts of pSB2-1 and pSBG9-1. A 4.4-kbp PstI fragment of pSB2-1 (Fig. 3A) and a 3.2-kbp SacI-EcoRI fragment of PstI fragment-deleted pSBG9-1 (Fig. 3B) were used for construction of plasmids derived from pRS316, pRS416 (56), pCgACT-14, and pCgACH-3 (29).


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3.   Restriction maps and deletional analysis of inserts of C. glabrata genomic DNA on pSB2-1 and pSBG9-1. Open bars indicate the inserts on pSB2-1 (A) and pSBG9-1 (B). Fragments used for deletional analysis are represented by solid bars. The presence and absence of complementation activity in Tets KRE9 knh1Delta cells are indicated as + and -, respectively. Arrows indicate ORFs of CgKRE9 (A) and CgKNH1 (B). Hatched bars indicate regions with homology to the syntenic S. cerevisiae genes.

Construction of tetracycline-sensitive mutants of S. cerevisiae KRE9 (Tets KRE9). Replacement of the cognate KRE9 promoter with the tetracycline-responsive promoter, 97t (39), was achieved by the one-step gene replacement method (3, 54) with slight modifications. A DNA fragment was amplified by PCR using p97tKan as a template and a pair of primers (5'-GAATAGAACAGGAGTCTCAAAGCATTCTTGAAGCCAGATTGCAACAGCTATGACCATG-3', 5'-AAAGCACATATGATGGAATTTCTTTGTAAACGCATTATGAATTCT TTTCTGAGATAAAG-3') and subsequently was used for transformation of the S. cerevisiae strain FAHAP4, which harbors the tetR-HAP4AD fusion activator gene (39). After selection on G418-containing plates, the correct integration was confirmed by PCR and the strain was designated SNB50-1. Disruption of the KNH1 gene in SNB50-1 was achieved by using a DNA fragment amplified by PCR using pSNZAP3 as a template and a pair of primers (5'-CTGATAGTATTATTCTTAACATTATTTTGTTCGGTAGTGTTCCGTAAAACGACGGCC AGT-3', 5'-CATTATCTGTGCCTCAAAGCATTAACTTTTCTTGCAGTCAGAGAAACAGCTATGACCATG-3'). The correct integration was confirmed by PCR. The strain was subjected to 5-fluoro-orotic acid selection and finally designated SNB54-5 after the elimination of the URA3 gene was confirmed by PCR.

Cloning of C. glabrata KRE9 and KNH1 genes. SNB54-5 cells were transformed with a pRS424-based C. glabrata subgenomic bank, harboring EcoRI 4- to 7-kbp fragments of C. glabrata genomic DNA, and spread onto both YNB-glucose and YNB-galactose plates containing tetracycline (50 µg/ml). After incubation at 30°C for 3 days, colonies appeared on the plates, cells were collected, and plasmid DNA was recovered from them.

Disruption of CgKRE9 and CgKNH1 and construction of tetracycline-sensitive mutants of CgKRE9 (Tets CgKRE9). Disruption of CgKRE9 in strain 2001HTU was achieved by using a DNA fragment amplified by PCR using pCGK9Delta T as a template and a pair of primers (5'-CCATCGATGAATTCATGCTGCTGCTGGCTATACTGCTATC-3', 5'-CAACTGGACAAATATCTAAC-3') (Fig. 1). The correct integration was confirmed by PCR, and the strain was designated SNBG1-7-7. A KpnI-SacI fragment of pCGK1Delta H was used to disrupt CgKNH1 (Fig. 1) in strain 2001HTU. The correct integration was confirmed by PCR, and the strain was designated SNBG2-26.

A KpnI-ClaI fragment harboring target sequences for CgKRE9 and S. cerevisiae URA3 was excised from pCGK9tetAB and used for replacement of the CgKRE9 promoter region with the tetracycline-responsive promoter, 97t (39, 40), in the C. glabrata strain ACG22 (40) (Fig. 2A). After the correct integration was confirmed by PCR, the strain was designated SNBG3-10. To construct SNBG4-49, a KpnI-SacI fragment of pCGK1Delta H was used to disrupt CgKNH1 in SNB3-10. The correct integration was confirmed by PCR.

Cell wall component analysis. The levels of cell wall alkali-insoluble beta -glucan were determined as previously described (15). The alkali-soluble and alkali-insoluble Zymolyase-resistant cell wall fractions were subjected to a dot blot analysis by using anti-beta -1,6-glucan antibody as previously described (33) with standardization by cell wall dry weight. The content of cellular chitin was determined as previously described (10) with Streptomyces griseus chitinase (Sigma, St. Louis, Mo.) and standardization by cell dry weight.

Sequence analysis and homology search. Sequence analysis was performed by using GeneWorks (Intelligenetics, Mountain View, Calif.) and GeneJockey (Biosoft, Cambridge, United Kingdom) software. A homology search for C. glabrata sequences against S. cerevisiae sequences was performed by using the WU-BLAST2 program in the Saccharomyces Genome Database (Stanford University).

Nucleotide sequence accession numbers. The nucleotide sequence data reported in this paper have been submitted to the GenBank database. The accession numbers of the C. glabrata KRE9 (CgKRE9) and KNH1 (CgKNH1) genes are AF064251 and AF064252, respectively.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Construction of tetracycline-sensitive mutants of the S. cerevisiae KRE9 gene. To isolate the S. cerevisiae KRE9 homolog from C. glabrata, we performed complementation screening. As convenient hosts for the screening, tetracycline-sensitive mutants of the S. cerevisiae KRE9 gene (Tets KRE9) were constructed. The KRE9 promoter region was replaced with a tetracycline-responsive promoter in a strain, FAHAP4, harboring the tetR-HAP4AD fusion activator gene for tetracycline-controllable gene expression (39). As shown in Fig. 4, addition of tetracycline (50 µg/ml) inhibited growth of cells of Tets KRE9 mutant strain SNB50-1 on glucose medium but not on galactose medium. These observations resemble and are consistent with the finding that an S. cerevisiae kre9Delta mutant grows extremely slowly on glucose medium while growing somewhat better on galactose medium (15) and suggest that the concentration of tetracycline used in the present study is sufficient to repress the expression of KRE9 driven by the tetracycline-responsive promoter. The tetracycline sensitivity of the Tets KRE9 mutant was complemented by introduction of an extragenic copy of KRE9 on pRS316 (6) (data not shown). Disruption of KNH1 in a Tets KRE9 mutant rendered cell growth tetracycline sensitive on glucose or galactose media (Fig. 4). This result is consistent with the known synthetic lethality between kre9Delta and knh1Delta mutations in S. cerevisiae (15). This Tets KRE9 knh1Delta mutant strain, SNB54-5, was used for complementation cloning of a C. glabrata homolog(s).


View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4.   Growth of S. cerevisiae Tets KRE9 knh1Delta cells harboring either pSB2-1 or pSBG9-1. About 104 cells were inoculated and cultured on YNB-glucose for 20 h (solid bars) or on YNB-galactose for 40 h (open bars) at 30°C. Cells were grown with or without tetracycline (50 µg/ml), and growth on tetracycline is expressed as the percentage of optical density at 600 nm of cells grown without tetracycline. The strain FAHAP4 (Table 1) was used as the wild type (WT). Error bars, standard deviations.

Cloning of C. glabrata KRE9 and KNH1 genes. By genomic Southern hybridization using the S. cerevisiae KRE9 sequence as a probe, 5- and 6-kbp EcoRI fragments of C. glabrata genomic DNA were shown to contain sequences hybridizing to S. cerevisiae KRE9 (data not shown). This result allowed us to make a subgenomic C. glabrata bank harboring EcoRI fragments ranging from 4 to 7 kbp to assist in their cloning by functional complementation.

After screening Tets KRE9 knh1Delta cells transformed with the subgenomic bank on plates containing glucose as a carbon source and tetracycline (50 µg/ml), pSB2-1 harboring the 6-kbp EcoRI fragment was isolated as a plasmid which allowed the mutant cells to grow as well as wild-type cells. However, plasmids harboring the 5-kbp EcoRI fragment, which also gave a hybridization signal in Southern analysis, were not isolated. Since the expression of KNH1 is induced by galactose in S. cerevisiae (15), we screened a population of transformed cells for growth on plates containing galactose as a carbon source. In this way, pSBG9-1, a plasmid harboring the 5-kbp EcoRI fragment was isolated, as well as pSB2-1. As shown in Fig. 4, while the tetracycline sensitivity of Tets KRE9 knh1Delta cells was complemented by pSBG9-1 partially on glucose medium but completely on galactose medium, pSB2-1 completely complemented the tetracycline sensitivity of Tets KRE9 knh1Delta cells on both media.

Deletional analysis of the inserts of the two plasmids demonstrated that a 1.4-kbp BamHI-PstI fragment of pSB2-1 and a 3.0-kbp PstI-EcoRI fragment of pSBG9-1 were sufficient for the complementation activity (Fig. 3). DNA sequencing determined that the two plasmids harbored distinct open reading frames (ORFs). The ORF on pSB2-1 was predicted to encode a protein (276 amino acids) similar to S. cerevisiae Kre9p with 53% overall identity, and the protein (265 amino acids) deduced from the ORF on pSBG9-1 revealed 48% overall identity with S. cerevisiae Knh1p (Fig. 5). We designated the genes on pSB2-1 and pSBG9-1 CgKRE9 and CgKNH1, respectively. Both predicted gene products showed features characteristic of their S. cerevisiae counterparts: putative N-terminal signals for secretion, a high proportion of serine/threonine residues (22% in both proteins) that could be potential sites for O glycosylation, and C termini rich in basic amino acid residues (Fig. 5).


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 5.   Sequence comparisons of CgKre9p and CgKnh1p with their S. cerevisiae counterparts. (A) Alignment of the putative Kre9p and Knh1p amino acid sequences deduced from the C. glabrata (CgKRE9 and CgKNH1) and S. cerevisiae (KRE9 and KNH1) nucleotide sequences. The residues with conserved identity in all proteins are underlined in the consensus sequence. The putative N-terminal signals for secretion are underlined in each protein. Gaps (shown as dashes) were introduced to improve alignment. (B) Sequence identities between Kre9p and Knh1p proteins.

Extensive sequencing on 3' flanking regions of both CgKRE9 and CgKNH1 identified additional regions similar to the genes flanking the KRE9 and KNH1 genes in the S. cerevisiae genome. On pSB2-1, two sequences homologous to the RFA3 and CPS1 genes, respectively, which are located in the 3' region of the KRE9 locus on chromosome X of S. cerevisiae, were found (Fig. 3A). A sequence homologous to the YLA1 gene, located in the 3' region of the KNH1 locus on chromosome IV, was found on pSBG9-1 (Fig. 3B).

Complementation activity of either CgKRE9 or CgKNH1 on a yeast centromeric plasmid, pRS416 (56), was also examined in the Tets KRE9 knh1Delta mutant. The tetracycline sensitivity of the mutant cells on glucose or galactose medium was complemented by introducing a plasmid, CgKRE9-pRS416, whereas CgKNH1-pRS416 complemented the sensitivity only on galactose medium (Fig. 6), suggesting that expression of CgKNH1 is induced by galactose in S. cerevisiae.

Complementation of the killer phenotype of the S. cerevisiae kre9 mutant by CgKRE9 and CgKNH1. Mutations in KRE9 confer resistance to the K1 killer toxin in S. cerevisiae (6, 8). In order to test whether multiple copies of CgKRE9 and CgKNH1 could complement this phenotype, pSB2-1 and pSBG9-1 were transformed into the S. cerevisiae kre9Delta null mutant strain HAB813 (Table 1) and the killer sensitivities of the transformants were examined by measuring zones of killing in a seeded-plate assay (8). The kre9Delta mutant cells are known to show no killer zone in the assay, since the mutant has an 80% reduction of beta -1,6-glucan, which is necessary for the toxin binding. As shown in Table 2, cells harboring pSB2-1 formed killer zones when grown on glucose or galactose plates while cells harboring pSBG9-1 did so only when grown on galactose plates. The killer zone sizes, however, were smaller than those of wild-type strain SEY6210 cells, suggesting that the complementation was partial. We also examined complementation activity of either CgKRE9 or CgKNH1 on a single-copy plasmid as assayed via the killer resistance. Cells harboring CgKRE9-pRS416 formed killer zones in the seeding assay on glucose or galactose plates to the same extent as those harboring multiple copies of CgKRE9 (Table 2), whereas cells harboring CgKNH1-pRS416 failed to form killer zones (data not shown). To show that the partial complementation of the killer phenotype of kre9Delta mutant was due to restoration of beta -1,6-glucan levels, alkali-insoluble beta -1,6-glucan levels in the mutant cells harboring either pSB2-1 or pSBG9-1 were determined. As shown in Table 2, although cells harboring pSBG9-1 showed no restoration, in cells harboring pSB2-1, the alkali-insoluble beta -1,6-glucan level was partially elevated over that of the mutant when the cells were grown on glucose medium.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Killer phenotypes of alkali-insoluble beta -glucan levels of the S. cerevisiae kre9 cells harboring either CgKRE9 or CgKNH1d

Disruption of CgKRE9 and CgKNH1 genes and construction of tetracycline-sensitive mutants of CgKRE9 (Tets CgKRE9). To explore the physiological essentialness of CgKRE9 and CgKNH1, each gene was disrupted with the C. glabrata TRP1 (CgTRP1) and HIS3 (CgHIS3) genes, respectively (Fig. 1). Transformation for disruption of CgKRE9 was performed on plates containing either glucose or galactose as a carbon source. cgkre9Delta mutants were obtained from only galactose plates, whereas cgknh1Delta mutants were obtained from glucose plates. This carbon source dependency on the growth of cgkre9Delta mutant was confirmed by spotting cells precultured on galactose medium onto plates containing either 2% galactose, 2% glucose, or 2% glucose and galactose. Although cgknh1Delta cells on all plates and cgkre9Delta cells on the galactose containing plate grew as well as wild-type cells, the growth of cgkre9Delta cells was severely impaired on plates containing glucose as a carbon source (data not shown). These results suggest that the presence of glucose is involved in the slow-growth phenotype of the cgkre9Delta mutant. As shown in Fig. 1D, microscopic examination of cgkre9Delta cells transferred from galactose to glucose medium revealed the presence of aggregates of cells with abnormal morphology, which are also observed in the S. cerevisiae kre9Delta null mutant (6). However, cgknh1Delta cells showed no morphological change compared to the wild type (Fig. 1C and E).

To test for a possible synthetic lethality between cgkre9 and cgknh1 mutations, a C. glabrata tetracycline-controllable gene expression system (40) was applied to control the expression of CgKRE9. This system uses the same tetracycline-responsive promoters and tetR fusion activator as the system for S. cerevisiae. As shown in Fig. 2A, a tetracycline-sensitive mutant (Tets CgKRE9) was generated by replacing the cognate CgKRE9 promoter region with the tetracycline-responsive promoter in C. glabrata ACG22, harboring the tetR-GAL4AD fusion activator gene (40). Consistent with the growth phenotype of a cgkre9Delta mutant, tetracycline (50 µg/ml) inhibited the growth of Tets CgKRE9 cells specifically on glucose medium (Fig. 2B). This glucose-specific tetracycline sensitivity was complemented by introducing an extragenic copy of CgKRE9 on pCgACH-3 (29), a centromeric plasmid for C. glabrata (data not shown). When CgKNH1 was disrupted in a Tets CgKRE9 mutant, cells failed to grow on glucose or galactose media in the presence of tetracycline (Fig. 2B). This result indicates that the disruption of both CgKRE9 and CgKNH1 is synthetically lethal in C. glabrata.


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 6.   Growth of S. cerevisiae Tets KRE9 knh1Delta cells harboring a single copy of either CgKRE9 or CgKNH1. About 104 cells were inoculated and cultured on YNB-glucose for 20 h (solid bars) or on YNB-galactose for 40 h (open bars) at 30°C. Growth of cells with tetracycline (50 µg/ml) is expressed as percent of optical density at 600 nm of cells without tetracycline. FAHAP4 (Table 1) was used as the wild-type. Error bars, standard deviations.

Killer phenotypes and beta -1,6-glucan levels of cgkre9Delta and cgknh1Delta mutants. Although cgkre9Delta cells showed severe growth defects on glucose medium, spontaneous second-site suppressor mutations partially restoring growth arose when the cells were cultured by serial passage on glucose medium. Since it is known in S. cerevisiae that those second-site suppressors have no effects on the killer phenotypes except for enhanced growth of the original mutants (4, 8, 34, 48), we used such growth-suppressed cgkre9Delta mutants for further analysis as described below.

To address the killer phenotypes of cgkre9Delta and cgknh1Delta mutants, we asked whether C. glabrata was sensitive to the K1 killer toxin. C. glabrata wild-type strain 2001HTU (Table 1) was found to be sensitive to the toxin on plates containing glucose or galactose as carbon sources, as measured by killer zones formed in a seeded-plate assay (Table 3). When mutant cells were assayed, growth-suppressed cgkre9Delta cells clearly formed smaller killer zones than those of wild-type cells, whereas cgknh1Delta cells formed slightly larger killer zones than those of wild-type cells (Table 3). We also examined the killer sensitivity of cgkre9Delta cells which had been stored on galactose medium to prevent second-site suppressor mutations. Although such mutant cells grew extremely slowly on glucose plates, sizes of killer zones of the cells were the same as those of growth-suppressed cgkre9Delta cells (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Alkali-insoluble glucan and cellular chitin levels in C. glabrata cells grown on either glucose or galactosee

To establish that the killer toxin resistance seen in the growth-suppressed cgkre9Delta cells was directly due to decreased levels in beta -1,6-glucan, we attempted to determine beta -1,6-glucan levels in C. glabrata cells. Following the method used in S. cerevisiae, alkali-insoluble cell wall fractions were digested with Zymolyase, a commercial beta -1,3-glucanase preparation, and residual polymers were measured as hexose. As shown in Table 3, in growth-suppressed cgkre9Delta cells, hexose levels in the alkali-insoluble Zymolyase-resistant fraction were reduced to 40 and 50% of wild-type levels in cells grown on glucose and galactose medium, respectively. To verify the presence of beta -1,6-linkage in these fractions, alkali-soluble and alkali-insoluble Zymolyase-resistant fractions from all three strains grown on glucose medium were subjected to a dot blot analysis using affinity-purified anti-beta -1,6-glucan polyclonal antibody (33). In cgkre9Delta cells, the amount of material recognized by the antibody in both fractions was estimated at less than 50% of those of wild-type by comparing signals from serially diluted spotted samples (data not shown). These results strongly suggest that disruption of CgKRE9 results in a more than 50% reduction of cell wall beta -1,6-glucan independent of the carbon source used for growth.

Sensitivity to CFW and cellular chitin levels in cgkre9 and cgknh1 mutants. CFW, a negatively charged fluorescent dye that preferentially binds to nascent chains of chitin and interferes with cell wall assembly (16, 50), is a useful compound for surveying a broad range of cell wall defects in S. cerevisiae (32, 46). To test for cell wall defects in cgkre9Delta and cgknh1Delta mutants, CFW sensitivities of both growth-suppressed cgkre9Delta and cgknh1Delta cells were determined by a spotting assay (31) on plates containing glucose or galactose as a carbon source. Although cgknh1Delta cells grew as well as wild-type cells even in the presence of 25-µg/ml CFW, growth-suppressed cgkre9Delta failed to grow at this concentration of CFW when glucose was used as a carbon source (Table 3).

In S. cerevisiae, kre9Delta mutant cells gave strong fluorescence when stained by CFW (6). This evidence and glucose-specific CFW sensitivity of growth-suppressed cgkre9Delta cells led us to determine cellular chitin levels in C. glabrata cells. As shown in Table 3, on glucose medium, more than fourfold more cellular chitin was detected in growth-suppressed cgkre9Delta cells than in wild-type cells, while cgknh1Delta cells had almost the same amount of chitin as wild-type cells. On galactose medium, no significant difference was seen in chitin levels among these three strains.

To assess a possible correlation between this chitin increase and the second-site mutations suppressing the growth defect on glucose medium, we measured cellular chitin levels in cgkre9Delta cells without such suppressor mutations. For this purpose, two different strategies were taken. In one, a Tets CgKRE9 mutant was used. In the other, cgkre9Delta cells, which had been stored on galactose medium, were switched from galactose to glucose medium. As shown in Fig. 7A, although the repression of CgKRE9 expression is expected to be partial since the inoculum for the tetracycline assay was increased to permit sufficient cells to be obtained for the chitin measurement, addition of tetracycline resulted in an ~17-fold increase of chitin levels in the Tets CgKRE9 mutant cells while there was no obvious change in cells of the parent strain, ACG22. When cgkre9Delta cells were transferred from galactose to glucose medium, cellular chitin levels increased by >15-fold (Fig. 7B). These results suggest that a considerable amount of chitin is present in cgkre9Delta cells grown in the presence of glucose and that such levels are unrelated to second-site mutations leading to growth suppression.


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 7.   Cellular chitin levels in cgkre9 mutants of C. glabrata. (A) Effects of addition of tetracycline on cellular chitin levels in Tets CgKRE9 mutants. About 106 cells were cultured on YPD with (solid bars) or without (open bars) tetracycline (50 µg/ml) at 30°C for 20 h, and the cellular chitin levels were measured. As the wild type (WT), strain ACG22 (Table 1) was used. (B) Effect of switching the carbon source on cellular chitin levels in cgkre9Delta mutant. Cells precultured on YPGal were inoculated onto either YPD (solid bars) or YPGal (hatched bars) and cultured at 30°C for 20 h, and the cellular chitin levels were measured. As the wild type (WT), strain 2001HTU (Table 1) was used. Error bars, standard deviations.

Overexpression of CgKNH1 and S. cerevisiae KRE9 in cgkre9Delta cells. We asked if multiple copies of either CgKNH1 or S. cerevisiae KRE9 could complement the phenotypes of a cgkre9Delta mutant. CgKNH1 was cloned into pRS316 (56), which is known to be a multicopy plasmid for C. glabrata (60). CgKNH1-pRS316 and KRE9-pRS316 (6) were transformed into growth-suppressed cgkre9Delta cells. As summarized in Table 4, the killer sensitivities and beta -1,6-glucan levels of the mutant cells were partially restored by multiple copies of S. cerevisiae KRE9 whereas multiple copies of CgKNH1 showed no effect. Further, multiple copies of either CgKNH1 or S. cerevisiae KRE9 allowed growth-suppressed cgkre9Delta cells to grow as well as wild-type cells on plates containing glucose and CFW (25 µg/ml). In the cells harboring CgKNH1-pRS316, the chitin increase was slightly suppressed (Table 4).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Effects of multiple copies of either CgKNH1 or S. cerevisiae KRE9 on the phenotypes of growth-suppressed cgkre9Delta  cellsf

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The CgKRE9 and CgKNH1 genes have been identified by functional screening using an S. cerevisiae Tets KRE9 knh1Delta mutant. Both C. glabrata gene products have significant overall identity with their S. cerevisiae counterparts (Fig. 5B). Partial restoration of the killer sensitivity and beta -1,6-glucan levels of kre9Delta mutant cells harboring multiple copies of CgKRE9 (Table 2) clearly indicates that CgKRE9 is an ortholog of S. cerevisiae KRE9. Furthermore, a single copy of CgKRE9 was sufficient to partially complement the killer phenotype of the kre9Delta mutant (Table 2). This result also supports the argument for the functional similarity between Kre9p and CgKre9p and implies that the promoter activity of CgKRE9 and the N-terminal signal for secretion of CgKre9p are active in S. cerevisiae.

Disruption of CgKRE9 resulted in cells with phenotypes similar to that of the S. cerevisiae kre9Delta null mutant (6): a severe growth defect on glucose medium, resistance to the K1 killer toxin, a reduction of beta -1,6-glucan, and the presence of aggregates of cells with abnormal morphology on glucose medium (Table 3; Fig. 1D). Some of these phenotypes were partially complemented by multiple copies of S. cerevisiae KRE9 (Table 4). Recent cloning of the C. albicans KRE9 (CaKRE9) gene has demonstrated that CaKre9p is also required for beta -1,6-glucan synthesis in C. albicans (33). These lines of evidence indicate that the function of Kre9p as an essential component for beta -1,6-glucan biosynthesis is conserved at least among S. cerevisiae, C. albicans, and C. glabrata.

cgknh1Delta mutants, however, had no phenotype beyond a slightly increased sensitivity to the K1 killer toxin. Further, multiple copies of CgKNH1 failed to restore the killer sensitivity and alkali-insoluble beta -1,6-glucan levels in cgkre9Delta cells grown on glucose medium (Table 4). However, in addition to the synthetic lethality suggested by the tetracycline sensitivity of Tets CgKRE9 cgknh1Delta mutant (Fig. 6B), its ability to complement a range of kre9 defects in S. cerevisiae and C. glabrata implies that CgKnh1p is related to Kre9p/CgKre9p and is an ortholog of S. cerevisiae Knh1p. These complementation abilities include S. cerevisiae kre9 mutant phenotypes (Fig. 4 and Table 2), CFW sensitivity, and chitin increase of growth-suppressed cgkre9Delta cells (Table 4).

We have demonstrated that cellular chitin levels were significantly increased in cgkre9 mutants on glucose medium (Table 3 and Fig. 7). It is known that chitin levels are also increased in several cell wall mutants of S. cerevisiae such as gas1Delta , fks1Delta , and knr4Delta mutants (22, 27, 45, 47). Based on genetic interaction between gas1Delta and chs3Delta mutations and the sensitivity to nikkomycin Z (a competitive inhibitor of chitin synthases) of a gas1Delta mutant, it has been hypothesized that such a chitin increase is essential for growth as a compensation mechanism to support the impaired cell wall integrity of these mutants (27, 45, 47). However, the increase of chitin in cgkre9 cannot simply be concluded to be the result of such a compensation mechanism, since it is correlated with a severe growth defect on glucose medium and is independent of the reduction of beta -1,6-glucan. This idea that increased chitin levels slow the growth of cgkre9 mutants is supported by several observations in the present study. First, considerable amounts of cellular chitin were detected in both tetracycline-treated Tets CgKRE9 cells grown on glucose medium (Fig. 7A) and cgkre9Delta cells transferred from galactose to glucose medium (Fig. 7B). Second, there was no obvious increase in chitin levels in cgkre9Delta cells grown on galactose medium (Table 3 and Fig. 7B), on which they grew as well as the wild type did, in spite of a 50% reduction of alkali-insoluble beta -1,6-glucan (Tables 3 and 4).

The mechanism and physiological relevance of the chitin increase in cgkre9 mutants and its apparent glucose dependence remain to be elucidated. In S. cerevisiae, at least five genes have been known to be involved in the chitin synthase activity (11, 14). Cloning of these homologs and an enzymatic analysis of chitin synthesis in C. glabrata will be helpful in addressing this question. It will be useful to see if a chitin increase is common to S. cerevisiae kre9 and other kre mutants, since second-site mutations suppressing growth defects have been isolated in many kre mutants and act without restoration of killer sensitivity or beta -1,6-glucan levels (4, 8, 34, 48). Glucose-specific cross-linking changes in the cell wall of cgkre9Delta cells may result in elevated chitin levels and a severe growth defect on glucose medium.

Extensive sequencing of regions around both the CgKRE9 and CgKNH1 loci show that genomic organization in the 3' regions of both homologs is conserved between C. glabrata and S. cerevisiae (Fig. 3). This synteny in regions of two chromosomes further indicates a close evolutionary relationship between C. glabrata and S. cerevisiae, consistent with the phylogenetic trees deduced from comparison of 5S (2) and 18S (43) rRNA genes. Further, CgKre9p and CgKnh1p have lower overall identity between themselves than to their orthologous S. cerevisiae counterparts (Fig. 5B). This observation implies that the duplication of the KRE9 and KNH1 genes took place before the divergence of these two fungi from a common ancestor. In contrast, no chromosomal conservation between S. cerevisiae and C. albicans was found in the 8-kbp fragment containing the CaKRE9 locus (data not shown). This result supports the idea of a more distant relationship of C. albicans and S. cerevisiae based on phylogenetic trees deduced from the distribution of the serine-tRNA gene (42, 43) and comparison of rRNA genes (2, 43). Although the presence of a KNH1 homolog in C. albicans still remains a possibility, this result suggests that extensive genomic reorganization around the CaKRE9 locus has occurred since its divergence from a common ancestor with S. cerevisiae. For example, it is possible that the duplication event leading to the KRE9 and KNH1 pair in S. cerevisiae and C. glabrata occurred after the divergence of these yeast lineages from that of C. albicans.

In summary, although the molecular functions of the Kre9p/Knh1p proteins still remain to be characterized, the evolutionary conservation of the essentiality of these proteins supports the idea that compounds that interfere with their functions would be new antifungal drugs affecting a broad spectrum of pathogenic fungi. Our data also indicate that C. glabrata is a useful model pathogenic fungus for understanding biological processes, including cell wall biosynthesis.

    ACKNOWLEDGMENTS

We thank K. Kitada and H. Nakayama for the C. glabrata strains and plasmids, P. Philippsen for KanMX2, A. B. Futcher for pMPY-ZAP, G. P. J. Dijkgraaf and T. Ketela for critical comments throughout this study, A.-M. Sdicu and S. Veronneau for technical assistance, and S. Shahinian for anti-beta -1,6-glucan polyclonal antibody and suggestions.

S.N. acknowledges continuous support from Nippon Roche and H. Yamada-Okabe. This work was supported in part by an operating grant from the Natural Sciences and Engineering Research Council of Canada. H.B. is a Canadian Pacific Professor.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Biology, McGill University, 1205 Dr. Penfield Ave., Montréal, Quebec, Canada H3A 1B1. Phone: (514) 398-6439. Fax: (514) 398-2595. E-mail: hbussey{at}monod.biol.mcgill.ca.

dagger Present address: Department of Mycology, Nippon Roche Research Center, Kamakura, Kanagawa 247-8530, Japan.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Aisner, J., S. C. Schimpff, J. C. Sutherland, V. M. Young, and P. H. Wiernik. 1976. Torulopsis glabrata infections in patients with cancer: increasing incidence and relationship to colonization. Am. J. Med. 61:23-28[Medline].
2. Barns, S. M., D. J. Lane, M. L. Sogin, C. Bibeau, and W. G. Weisburg. 1991. Evolutionary relationships among pathogenic Candida species and relatives. J. Bacteriol. 173:2250-2255[Abstract/Free Full Text].
3. Baudin, A., K. O. Ozier, A. Denouel, F. Lacroute, and C. Cullin. 1993. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 21:3329-3330[Free Full Text].
4. Boone, C., S. S. Sommer, A. Hensel, and H. Bussey. 1990. Yeast KRE genes provide evidence for a pathway of cell wall beta -glucan assembly. J. Cell Biol. 110:1833-1843[Abstract/Free Full Text].
5. Boone, C., A.-M. Sdicu, M. Laroche, and H. Bussey. 1991. Isolation from Candida albicans of a functional homolog of the Saccharomyces cerevisiae KRE1 gene, which is involved in cell wall beta -glucan synthesis. J. Bacteriol. 173:6859-6864[Abstract/Free Full Text].
6. Brown, J. L., and H. Bussey. 1993. The yeast KRE9 gene encodes an O glycoprotein involved in cell surface beta -glucan assembly. Mol. Cell. Biol. 13:6346-6356[Abstract/Free Full Text].
7. Brown, J. L., S. North, and H. Bussey. 1993. SKN7, a yeast multicopy suppressor of a mutation affecting beta -glucan assembly, encodes a product with domains homologous to prokaryotic two-component regulators and to heat shock transcription factors. J. Bacteriol. 175:6908-6915[Abstract/Free Full Text].
8. Brown, J. L., Z. Kossaczka, B. Jiang, and H. Bussey. 1993. A mutational analysis of killer toxin resistance in Saccharomyces cerevisiae identifies new genes involved in cell wall (1-6)-beta -glucan synthesis. Genetics 133:837-849[Abstract].
9. Brown, J. L., H. Bussey, and R. C. Stewart. 1994. Yeast Skn7p functions in a eukaryotic two-component regulatory pathway. EMBO J. 13:5186-5194[Medline].
10. Bulawa, C. E., M. Slater, E. Cabib, J. Au-Young, A. Sburlati, W. L. Adair, Jr., and P. W. Robbins. 1986. The S. cerevisiae structural gene for chitin synthase is not required for chitin synthesis in vivo. Cell 48:213-225.
11. Bulawa, C. E. 1993. Genetics and molecular biology of chitin synthesis in fungi. Annu. Rev. Microbiol. 47:505-534[Medline].
12. Chen, D. C., B. C. Yang, and T. T. Kuo. 1992. One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].
13. Christianson, T. W., R. S. Sikorski, M. Dante, J. H. Shero, and P. Hieter. 1992. Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[Medline].
14. Cid, V. J., A. Durán, F. del Ray, M. P. Snyder, C. Nombela, and M. Sánchez. 1995. Molecular basis of cell integrity and morphogenesis in Saccharomyces cerevisiae. Microbiol. Rev. 59:345-386[Abstract/Free Full Text].
15. Dijkgraaf, G. J. P., J. L. Brown, and H. Bussey. 1996. The KNH1 gene of Saccharomyces cerevisiae is a functional homolog of KRE9. Yeast 12:683-692[Medline].
16. Elorza, M. V., H. Rico, and R. Sentandreu. 1983. Calcofluor white alters the assembly of chitin fibrils in Saccharomyces cerevisiae and Candida albicans cells. J. Gen. Microbiol. 129:1577-1582[Abstract/Free Full Text].
17. Geber, A., C. A. Hitchcock, J. E. Swartz, F. S. Pullen, K. E. Marsden, K. J. Kwon-Chung, and J. E. Bennett. 1995. Deletion of the Candida glabrata ERG3 and ERG11 genes: effect on cell viability, cell growth, sterol composition, and antifungal susceptibility. Antimicrob. Agents Chemother. 39:2708-2717[Abstract].
18. Georgopapadakou, N. H., and J. S. Tkacz. 1995. The fungal cell wall as a drug target. Trends Microbiol. 3:98-104[Medline].
19. Georgopapadakou, N. H., and T. J. Walsh. 1996. Antifungal agents: chemotherapeutic targets and immunologic strategies. Antimicrob. Agents Chemother. 40:279-291[Medline].
20. Gietz, R. D., R. H. Schiestl, A. R. Willems, and R. A. Woods. 1995. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355-360[Medline].
21. Hickey, W. F., L. H. Sommerville, and F. J. Schoen. 1983. Disseminated Candida glabrata---report of a uniquely severe infection and a literature review. Am. J. Clin. Pathol. 80:724-727[Medline].
22. Hong, Z., P. Mann, K. J. Shaw, and B. DiDomenico. 1994. Analysis of beta -glucans and chitin in a Saccharomyces cerevisiae cell wall mutant using high-performance liquid chromatography. Yeast 10:1083-1092[Medline].
23. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168[Abstract/Free Full Text].
24. Jiang, B., A. F. J. Ram, J. Sheraton, F. M. Klis, and H. Bussey. 1995. Regulation of cell wall beta -glucan assembly: PTC1 negatively affects PBS2 action in a pathway that includes modulation of EXG1 transcription. Mol. Gen. Genet. 248:260-269[Medline].
25. Jiang, B., J. Sheraton, A. F. J. Ram, G. J. P. Dijkgraaf, F. M. Klis, and H. Bussey. 1996. CWH41 encodes a novel endoplasmic reticulum membrane N-glycoprotein involved in beta 1,6-glucan assembly. J. Bacteriol. 178:1162-1171[Abstract/Free Full Text].
26. Kapteyn, J. C., R. C. Montijn, E. Vink, J. De La Cruz, A. Llobelle, J. E. Douwes, H. Shimoi, P. N. Lipke, and F. M. Klis. 1996. Retention of Saccharomyces cerevisiae cell wall proteins through a phosphodiester-linked beta 1,3-/beta 1,6-glucan heteropolymer. Glycobiology 6:337-345[Abstract/Free Full Text].
27. Kapteyn, J. C., A. F. J. Ram, E. M. Groos, R. Kollar, R. C. Montijn, H. Van Den Ende, A. Llobell, E. Cabib, and F. M. Klis. 1997. Altered extent of cross-linking of beta 1,6-glucosylated mannoproteins to chitin in Saccharomyces cerevisiae mutants with reduced cell wall beta 1,3-glucan content. J. Bacteriol. 179:6279-6284[Abstract/Free Full Text].
28. Kitada, K., E. Yamaguchi, and M. Arisawa. 1995. Cloning of the Candida glabrata TRP1 and HIS3 genes, and construction of their disruptant strains by sequential integrative transformation. Gene 165:203-206[Medline].
29. Kitada, K., E. Yamaguchi, and M. Arisawa. 1996. Isolation of a Candida glabrata centromere and its use in construction of plasmid vectors. Gene 175:105-108[Medline].
30. Klis, F. M. 1994. Review: cell wall assembly in yeast. Yeast 10:851-869[Medline].
31. Lussier, M., A.-M. Sdicu, E. Winnett, D. H. Vo, J. Sheraton, A. Düsterhöft, R. K. Storms, and H. Bussey. 1997. Completion of the Saccharomyces cerevisiae genome sequence allows identification of KTR5, KTR6 and KTR7 and definition of the nine-membered KRE2/MNT1 mannosyltransferase gene family in this organism. Yeast 13:267-274[Medline].
32. Lussier, M., A.-M. White, J. Sheraton, T. di Paolo, J. Treadwell, S. B. Southard, C. I. Horenstein, J. Chen-Weiner, A. F. J. Ram, J. C. Kapteyn, T. W. Roemer, D. H. Vo, D. C. Bondoc, J. Hall, W. W. Zhong, A.-M. Sdicu, J. Davies, F. M. Klis, P. W. Robbins, and H. Bussey. 1997. Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae. Genetics 147:435-450[Abstract].
33. Lussier, M., A.-M. Sdicu, S. Shahinian, and H. Bussey. The Candida albicans KRE9 gene is required for cell wall beta-1,6-glucan synthesis and is essential for growth on glucose. Proc. Natl. Acad. Sci. USA, in press.
34. Meaden, P., K. Hill, J. Wagner, D. Slipetz, S. S. Sommer, and H. Bussey. 1990. The yeast KRE5 gene encodes a probable endoplasmic reticulum protein required for (1right-arrow6)-beta -D-glucan synthesis and normal cell growth. Mol. Cell. Biol. 10:3013-3019[Abstract/Free Full Text].
35. Mehra, R. K., J. L. Thorvaldsen, I. G. Macreadi, and R. R. Winge. 1992. Cloning system for Candida glabrata using elements from the metallothionein IIa encoding gene that confer autonomous replication. Gene 113:119-124[Medline].
36. Mio, T., T. Yamada-Okabe, T. Yabe, T. Nakajima, M. Arisawa, and H. Yamada-Okabe. 1997. Isolation of the Candida albicans homologs of Saccharomyces cerevisiae KRE6 and SKN1: expression and physiological function. J. Bacteriol. 179:2363-2372[Abstract/Free Full Text].
37. Mio, T., M. Adachi-Shimizu, Y. Tachibana, H. Tabuchi, S. B. Inoue, T. Yabe, T. Yamada-Okabe, M. Arisawa, T. Watanabe, and H. Yamada-Okabe. 1997. Cloning of the Candida albicans homolog of Saccharomyces cerevisiae GSC/FKS1 and its involvement in beta -1,3-glucan synthesis. J. Bacteriol. 179:4096-4105[Abstract/Free Full Text].
38. Montijn, R. C., J. van Rinsum, F. A. van Schagen, and F. M. Klis. 1994. Glucomannoproteins in the cell wall of Saccharomyces cerevisiae contain a novel type of carbohydrate side chain. J. Biol. Chem. 269:19338-19342[Abstract/Free Full Text].
39. Nagahashi, S., H. Nakayama, K. Hamada, H. Yang, M. Arisawa, and K. Kitada. 1997. Regulation by tetracycline of gene expression in Saccharomyces cerevisiae. Mol. Gen. Genet. 255:372-375[Medline].
40. Nakayama, H., M. Izuta, S. Nagahashi, E. Yamaguchi-Sihta, Y. Sato, T. Yamazaki, M. Arisawa, and K. Kitada. A controllable gene expression system in the pathogenic fungus Candida glabrata. Microbiology, in press.
41. Newman, S. L., T. P. Flanigan, A. Fisher, M. G. Rinaldi, M. Stein, and K. Vigilante. 1994. Clinically significant mucosal candidiasis resistant to fluconazole treatment in patients with AIDS. Clin. Infect. Dis. 19:684-686[Medline].
42. Ohama, T., T. Suzuki, M. Mori, S. Osawa, T. Ueda, K. Watanabe, and T. Nakase. 1993. Non-universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res. 21:4039-4045[Abstract/Free Full Text].
43. Pesole, G., M. Lotti, L. Alberghina, and C. Saccone. 1995. Evolutional origin of nonuniversal CUGSer codon in some Candida species as inferred from a molecular phylogeny. Genetics 141:903-907[Abstract].
44. Petter, R., and K. J. Kwon-Chung. 1996. Disruption of the SNF1 gene abolishes trehalose utilization in the pathogenic yeast Candida glabrata. Infect. Immun. 64:5269-5273[Abstract].
45. Popolo, L., D. Gilardelli, P. Bonfante, and M. Vai. 1997. Increase in chitin as an essential response to defects in assembly of cell wall polymers in the ggp1Delta mutant of Saccharomyces cerevisiae. J. Bacteriol. 179:463-469[Abstract/Free Full Text].
46. Ram, A. F. J., A. Wolters, R. Ten Hoopen, and F. M. Klis. 1994. A new approach for isolating cell wall mutants in Saccharomyces cerevisiae by screening for hypersensitivity to calcofluor white. Yeast 10:1019-1030[Medline].
47. Ram, A. F. J., J. C. Kapteyn, R. C. Montijn, L. H. P. Caro, J. E. Douwes, W. Baginsky, P. Mazur, H. Van Den Ende, and F. M. Klis. 1998. Loss of the plasma membrane-bound protein Gas1p in Saccharomyces cerevisiae results in the release of beta 1,3-glucan into the medium and induces a compensation mechanism to ensure cell wall integrity. J. Bacteriol. 180:1418-1424[Abstract/Free Full Text].
48. Roemer, T., and H. Bussey. 1991. Yeast beta -glucan synthesis: KRE6 encodes a predicted type II membrane protein required for glucan synthesis in vivo and for glucan synthase activity in vitro. Proc. Natl. Acad. Sci. USA 88:11295-11299[Abstract/Free Full Text].
49. Roemer, T., S. Delaney, and H. Bussey. 1993. SKN1 and KRE6 define a pair of functional homologs encoding putative membrane proteins involved in beta -glucan synthesis. Mol. Cell. Biol. 13:4039-4048[Abstract/Free Full Text].
50. Roncero, C., and A. Durán. 1985. Effect of Calcofluor White and Congo red on fungal cell wall morphogenesis: in vivo activation of chitin polymerization. J. Bacteriol. 163:1180-1185[Abstract/Free Full Text].
51. Rose, M. D., F. Winston, and P. Hieter. 1990. Methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
52. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
53. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
54. Schneider, B. L., B. Steiner, W. Seufert, and A. B. Futcher. 1996. pMPY-ZAP: a reusable polymerase chain reaction-directed gene disruption cassette for Saccharomyces cerevisiae. Yeast 12:129-134[Medline].
55. Shahinian, S., G. J. P. Dijkgraaf, A.-M. Sdicu, D. Y. Thomas, C. A. Jakob, M. Aebi, and H. Bussey. 1998. Involvement of protein N-glycosyl chain glucosylation and processing in the biosynthesis of cell wall beta -1,6-glucan of Saccharomyces cerevisiae. Genetics 149:843-856[Abstract/Free Full Text].
56. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27[Abstract/Free Full Text].
57. Wach, A., A. Brachat, R. Pöhlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808[Medline].
58. Wingard, J. R., W. G. Merz, M. G. Rinaldi, C. B. Miller, J. E. Karp, and R. Saral. 1993. Association of Torulopsis glabrata infections with fluconazole prophylaxis in neutropenic bone marrow transplant patients. Antimicrob. Agents Chemother. 37:1847-1849[Abstract/Free Full Text].
59. Wingard, J. R. 1995. Importance of Candida species other than C. albicans as pathogens in oncology patients. Clin. Infect. Dis. 20:115-125[Medline].
60. Zhou, P., M. S. Szczypka, R. Young, and D. J. Thiele. 1994. A system for gene cloning and manipulation in the yeast Candida glabrata. Gene 142:135-140[Medline].


Journal of Bacteriology, October 1998, p. 5020-5029, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Kitamura, A., Higuchi, S., Hata, M., Kawakami, K., Yoshida, K., Namba, K., Nakajima, R. (2009). Effect of {beta}-1,6-Glucan Inhibitors on the Invasion Process of Candida albicans: Potential Mechanism of Their In Vivo Efficacy. Antimicrob. Agents Chemother. 53: 3963-3971 [Abstract] [Full Text]  
  • Aimanianda, V., Clavaud, C., Simenel, C., Fontaine, T., Delepierre, M., Latge, J.-P. (2009). Cell Wall {beta}-(1,6)-Glucan of Saccharomyces cerevisiae: STRUCTURAL CHARACTERIZATION AND IN SITU SYNTHESIS. J. Biol. Chem. 284: 13401-13412 [Abstract] [Full Text]  
  • Kitamura, A., Someya, K., Hata, M., Nakajima, R., Takemura, M. (2009). Discovery of a Small-Molecule Inhibitor of {beta}-1,6-Glucan Synthesis. Antimicrob. Agents Chemother. 53: 670-677 [Abstract] [Full Text]  
  • Dubytska, L., Godfrey, H. P., Cabello, F. C. (2006). Borrelia burgdorferi ftsZ Plays a Role in Cell Division.. J. Bacteriol. 188: 1969-1978 [Abstract] [Full Text]  
  • Stoyan, T., Carbon, J. (2004). Inner Kinetochore of the Pathogenic Yeast Candida glabrata. Eukaryot Cell 3: 1154-1163 [Abstract] [Full Text]  
  • Weig, M., Haynes, K., Rogers, T. R., Kurzai, O., Frosch, M., Muhlschlegel, F. A. (2001). A GAS-like gene family in the pathogenic fungus Candida glabrata. Microbiology 147: 2007-2019 [Abstract] [Full Text]  
  • Ketela, T., Green, R., Bussey, H. (1999). Saccharomyces cerevisiae Mid2p Is a Potential Cell Wall Stress Sensor and Upstream Activator of the PKC1-MPK1 Cell Integrity Pathway. J. Bacteriol. 181: 3330-3340 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagahashi, S.
Right arrow Articles by Bussey, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagahashi, S.
Right arrow Articles by Bussey, H.