Previous Article | Next Article ![]()
Journal of Bacteriology, October 1998, p. 5273-5278, Vol. 180, No. 19
The Rockefeller University, New York, New
York 10021
Received 13 May 1998/Accepted 21 July 1998
The complete DNA sequence of the capsular locus 23F of
Streptococcus pneumoniae is presented. The 18.6-kb
cps23f locus is composed of 18 open reading frames flanked
at the 5' and 3' ends by the genes dexB and
aliA, an arrangement similar to those of some of the other
identified cps loci.
Capsular polysaccharides deposited
on the outermost surfaces of most clinical strains of
Streptococcus pneumoniae are major virulence factors
involved with evasion of the host immune system (1, 8). The
capsule is the main target of protective antibodies which are specific
for the particular polysaccharide (1, 32). Of the 90 different capsular types identified by immunological (17)
and chemical (39) techniques, genetic characterization of
the capsular biosynthetic genes (cps) is available only for a few capsular loci, namely, 1, 3, 14, 19F, and 19B (4, 9, 10, 14,
15, 19, 25, 27). Understanding the genetic determinants of the
capsular polysaccharides should help in unraveling their pathway of
biosynthesis which, in turn, could lead to the design of inhibitors
capable of blocking the expression of these important pneumococcal
virulence factors.
We describe here the complete DNA sequence of the cps locus
of a type 23F S. pneumoniae Him18, a recent clinical
isolate originating in Mexico. Analysis of a large number of
serotype 23F isolates from diverse geographic areas and with a wide
variety of isolation dates and chromosomal backgrounds confirmed that
all genes identified by sequencing (as well as their structural
organization) were conserved in each of the 23F isolates tested.
Bacterial strains, plasmids, and growth conditions.
S.
pneumoniae strains were obtained from the American Type Culture
Collection (11, 12) or were from the Rockefeller University collection. A semisynthetic medium (C+Y) (20) or tryptic soy agar plates (Difco, Detroit, Mich.) supplemented with 3% sterile sheep
blood and incubation at 37°C were used for growth.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Molecular Characterization of the Complete 23F
Capsular Polysaccharide Locus of Streptococcus
pneumoniae
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
PFGE. Chromosomal DNA fragments, generated by SmaI digestion, were separated and analyzed as described previously (36).
Southern blot hybridization. DNA fragments separated by PFGE or conventional gels were transferred to nylon membranes (Hybond-N+; Amersham, Little Chalfont, Buckinghamshire, United Kingdom) with the Vacuum Gene System (Pharmacia LKB Biotech, Uppsala, Sweden) in accordance with the manufacturer's instructions. Blots were hybridized to specific DNA probes labelled with the ECL Direct Labelling System (Amersham) in accordance with the manufacturer's recommendations. Hybridization conditions included a sodium chloride concentration of 0.5 M as recommended by the manufacturer.
Probe preparation. For the preparation of capsule 19F-specific probes, primers were designed from the published sequence of this capsular type (accession no. U09239) (24, 30) so that the generated probes resembled the ones used by Morona et al. (24). PCR was performed with strain OP5248 (serotype 19F) (13) as template and the GeneAmp system (Perkin-Elmer, Branchburg, N.J.) basically as described previously (28). Amplified products were visualized by agarose gel electrophoresis, and fragments of the expected size were purified by using the Wizard PCR Preps Purification System (Promega) in accordance with the manufacturer's recommendations. Preparation of serotype 23F-specific probes was based on the sequence determined in this study from the penicillin-resistant serotype 23F clinical isolate Him18 following the same procedure as described above.
Long PCR. Amplification of a region extending from the gene homologous to cps19fB to the one homologous to cps19fL of strain Him18 (serotype 23F) was accomplished by long PCR (5) with the GeneAmp XL system (Perkin-Elmer). The primers used were XL19Bd1 (AGGGGGTGCGAACCATTGTC) and XL19Lr1 (AGCCAAGCAAAGCCACGTCC). The reaction was performed in a DNA Thermal Cycler 480 (Perkin-Elmer) with a hot start (33), a magnesium acetate concentration of 1.1 mM, and primer and template concentrations of 1 ng/µl. The program used was the following: denaturation at 94°C for 2 min, 16 extension cycles of 94°C for 30 s and 68°C for 11 min, followed by 15 extension cycles of 94°C for 30 s and 68°C for 11 min, with an autoextension of 30 s per cycle.
Cloning of the 23F-specific region. Long PCR products were purified with the Wizard PCR Preps Purification System in accordance with the manufacturer's recommendations. The products were digested with either HindIII or PstI (New England Biolabs, Beverly, Mass.), ligated to pSP64, and transformed into E. coli HB101 by standard procedures (34). Colonies resistant to ampicillin were screened for the presence of fragments of correct size by using the procedure described by Corton and Gustafsson (7) with the following modifications. The primers used were pSP64fp (GATAGGGTCTGCTTCAGTAAGC) and pUC/M13F (CGCCAGGGTTTTCCCAGTCACGAC). No glycerol or cresol red was added to the PCR mixture, and LB with ampicillin was used instead of YT plus kanamycin. Clones with inserts of approximately 0.5, 2.4, and 1.3 kb after HindIII digestion and 0.6, 5.7, and 5.1 kb after digestion with PstI were isolated.
Nucleotide sequencing. Plasmid purified with the Wizard Plus Midiprep DNA Purification System (Promega) was used for automated sequencing. Sequencing of PCR products was performed after purification with the Wizard PCR Preps Purification System (Promega). All sequencing was done by primer walking with the TaqFS fluorescent dye terminator sequencing method run on a Perkin-Elmer Applied Biosystems Division model 377 automated sequencer.
Nucleotide and amino acid sequence analyses were performed with either the DNASTAR (Lasergene, Madison, Wis.) sequence analysis package, the GeneDoc program (29), or servers accessible via the Internet. Homology searches were performed with the Gapped BLAST or PSI-BLAST algorithms (2) or the COG system (37) available at the National Center for Biotechnology Information site, preliminary characterization and analysis of the open reading frames (ORFs) was performed with the GENEQUIZ (35) server, and sequence alignments were performed with the Clustal W (38) algorithm as implemented in DNASTAR or at the Clustal W server at the European Bioinformatics Institute. Promoter analysis was done using the NNPP (31) program available through the Baylor College of Medicine server.PCR. Based on the sequences of the clones and the published sequence information for dexB, cps19fA, cps19fB, cps19fL, cps19fM, cps19fN, cps19fO, and aliA genes, primers were designed to obtain a series of overlapping PCR products covering the entire region between the dexB and aliA genes.
Conventional gel electrophoresis. Total chromosomal DNA was prepared with a modified version of the procedure described by Marmur (21). Restriction was performed with one of the following: EcoRV, HaeIII, HincII, or a mixture of SpeI and HindIII restriction enzymes. All enzymes were obtained from New England Biolabs. Agarose gel electrophoresis was performed in accordance with standard procedures (34).
Nucleotide sequence accession number. The nucleotide sequences and predicted amino acid translations described in this communication have been submitted to GenBank and are available under accession no. AF057294.
Sequence of the complete type 23F capsular locus. In a previous study (24), it was shown that a strain of serogroup 23 carried genes with high homology to dexB, cps19fA, cps19fB, cps19fL, cps19fM, cps19fN, cps19fO, and aliA. Using PCR, we established that the organization of the homologous genes in the 23F locus was similar to the one found on serotype 19F, in agreement to what has since been reported by others (6). We therefore designed primers to amplify the region between the cps19fB and cps19fL homologues, which presumably contained sequence information specific for type 23F. A fragment of approximately 14 kb was obtained and subcloned into pSP64. The sequence of the clones was determined by primer walking. In order to confirm the accuracy of the obtained sequence and to close the gaps in the locus due to the cloning strategy, a series of overlapping PCR products covering the entire 23F capsular locus was generated and sequenced.
Computer analysis of the region located between the dexB and aliA homologues. Computer analysis of the region located between the dexB and aliA homologues revealed the existence of 19 ORFs (Fig. 1).
|
|
Analysis of other isolates expressing serotype 23F. In order to assess possible variations at the 23F locus, 11 strains from diverse genetic backgrounds (as defined by SmaI PFGE restriction profile) and different geographic origins (Brazil, United States, South Korea, and Bulgaria) were analyzed for their hybridization pattern to probes specific for the cps23f genes after enzymatic digestion. All ORFs identified in strain Him18, i.e., the strain used for the molecular characterization of the cps23f locus, were also present in all serotype 23F strains examined, and their organization was similar. Strain-to-strain differences were localized to the ends of the locus and were attributable to two factors: sequence variation in the genes (e.g., cps23fA, cps23fM, and cps23fR) and/or variation in the intergenic regions between cps23fR and aliA or dexB and cps23fA (data not shown). These results agree with findings recently reported by other authors (6), who found substantial variation in the regions flanking the cps locus among different pneumococcal isolates expressing serogroup 19 polysaccharides.
Structure of 23F capsular determinant of the Spanish/USA clone. The structure of the 23F capsular determinant of the widespread multiresistant Spanish/USA clone (26) was analyzed by using representatives of this clone recovered from different geographic sites but sharing a similar SmaI PFGE restriction pattern. We found that these isolates constituted a very homogeneous group (data not shown). Differences detected between the capsular determinant of this group and strain Him18 (whose sequence was determined in this study) could be explained solely by differences in the region between dexB and cps23fA.
Diversity of pneumococcal capsular loci. To examine the relationship between the genes found in the capsule 23F locus and other pneumococcal capsular determinants, individual genes of strain Him18 were used to probe Southern blots of restricted chromosomal DNA from strains belonging to 21 different serotypes and two nontypeable strains. The results obtained are summarized in Fig. 2.
|
23.4 Kcal). Taken together, these findings
suggest that the entire locus could be transcribed in a single 18.6-kb transcript.
The variable G+C composition of the locus and the location of
intergenic spaces suggest a modular organization in which different parts of the locus could have been acquired independently (Fig. 1). It
is noteworthy that the four genes responsible for the synthesis and
activation of rhamnose have the same organization and have a very high
sequence identity to genes identified in the serotypes 19F and 1 loci
(24, 27).
The 115-nucleotide sequence found upstream of cap1A and
conserved in all pneumococcal capsular loci (27) was also
found associated with the 23F locus (89.6% identity).
Analysis of isolates expressing the 23F serotype. The fact that isolates from unrelated genetic backgrounds (as defined by SmaI PFGE restriction profile) had homologues to all the genes identified in strain Him18 is in agreement with the hypothesis that these genes are essential for capsular biosynthesis. The observed differences could be explained by two phenomena: the loss in some strains of a HaeIII site near the 5' end of the cps23fO coding region and the variability in the regions flanking the cps genes. The highly variable nature of these regions is apparent from the cps loci sequenced to date (3, 6, 19, 23).
Relatedness of cps loci of S. pneumoniae. In agreement with other authors (26, 35), we found that sequences homologous to cps23fA were present in all strains with the exception of one of the nontypable isolates (Fig. 2). Sequences homologous to cps23fB were also detected in all isolates hybridizing to cps23fA. This observation is in apparent contradiction to results of a previous study (18), which found that strains expressing serotypes 9V, 11A, and 11B did not hybridize to the cps14B probe. However, the discrepancies may be explained by the nature of the probes used in the two studies. The probe used in the study described here spans nucleotides 99 to 389 of the coding region of cps23fB while the probe used in the previous analysis (18) covered the region from nucleotide 260 of the cps14B coding region to nucleotide 26 of the cps14C coding region. The 5' regions of the cpsB genes sequenced to date show a high sequence identity that rapidly degenerates as one passes the middle of the gene. Therefore, if the structure of the cpsB genes of these serotypes follows the same principles, but with an even higher divergence, the construction of the probes would explain the differences in results.
Genes homologous to at least some of the cps23fC to -E genes were also found in 11 other serotypes in agreement with their proposed functions (Table 1). Of the 21 different serotypes analyzed, 7 contained rhamnose. All strains with rhamnose containing polysaccharides had genes homologous to cps23fO to -Q similar to what was previously reported (24). It is interesting that isolates expressing serotypes 1 and 34, although having no rhamnose constituent, nevertheless carried a set of genes homologous to cps23fO to -Q. Dispensability of these genes for capsule 1 expression and their presence in a set of 19 different isolates of type 1 pneumococci were interpreted as evidence of a clonal origin of type 1 strains through recombination with DNA from an unknown origin (27). A similar phenomenon could explain the presence of these genes in serotype 34, which also does not have rhamnose as a capsule constituent. It is interesting that 23A, 23B, and 28F, which are serologically related to 23F (17), had the highest percentage of genes homologous to the 23F locus. The structure of type 28F is known to include rhamnose, glucose, and phosphoglycerol in common with type 23F. The chemical compositions of types 23A and 23B are unknown (39). Our results show that type 15B also has a large set of homologues with type 23F. Elucidation of the genetic determinants of capsules 23A, 23B, and 28F should provide insights into the structure of these polysaccharides.| |
ACKNOWLEDGMENTS |
|---|
These investigations received partial support from a grant from the National Institutes of Health (RO1AI37275) and the Aaron Diamond Fund.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: The Rockefeller University, 1230 York Ave., New York, NY 10021. Phone: (212) 327-8277. Fax: (212) 327-8688. E-mail: tomasz{at}rockvax.rockefeller.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alonsodevelasco, E.,
A. F. M. Verheul,
J. Verhoef, and H. Snippe.
1995.
Streptococcus pneumoniae: virulence factors, pathogenesis, and vaccines.
Microbiol. Rev.
59:591-603 |
| 2. |
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 3. | Arrecubieta, C., E. Garcia, and R. Lopez. 1995. Sequence and transcriptional analysis of a DNA region involved in the production of capsular polysaccharide in Streptococcus pneumoniae type 3. Gene 167:1-7[Medline]. |
| 4. |
Arrecubieta, C.,
R. Lopez, and E. Garcia.
1994.
Molecular characterization of cap3A, a gene from the operon required for the synthesis of the capsule of Streptococcus pneumoniae type 3: sequencing of mutations responsible for the unencapsulated phenotype and localization of the capsular cluster on the pneumococcal chromosome.
J. Bacteriol.
176:6375-6383 |
| 5. |
Cheng, S.,
C. Fockler,
W. M. Barnes, and R. Higuchi.
1994.
Effective amplification of long targets from cloned inserts and human genomic DNA.
Proc. Natl. Acad. Sci. USA
91:5695-5699 |
| 6. | Coffey, T. J., M. C. Enright, M. Daniels, J. K. Morona, R. Morona, W. Hryniewicz, J. C. Paton, and B. G. Spratt. 1998. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol. Microbiol. 27:73-83[Medline]. |
| 7. | Corton, J. C., and J. A. Gustafsson. 1997. Increased efficiency in screening large numbers of cDNA fragments generated by differential display. BioTechniques 22:802-804[Medline]. |
| 8. | Cross, A. S. 1990. The biologic significance of bacterial encapsulation. Curr. Top. Microbiol. Immunol. 150:87-95[Medline]. |
| 9. |
Dillard, J. P.,
M. W. Vandersea, and J. Yother.
1995.
Characterization of the cassette containing genes for type 3 capsular polysaccharide biosynthesis in Streptococcus pneumoniae.
J. Exp. Med.
181:973-983 |
| 10. | Dillard, J. P., and J. Yother. 1994. Genetic and molecular characterization of capsular polysaccharide biosynthesis in Streptococcus pneumoniae type 3. Mol. Microbiol. 12:959-972[Medline]. |
| 11. | Eddy, B. E. 1944. Cross reactions between the several pneumococcic types and their significance in the preparation of polyvalent antiserum. Public Health Rep. 59:485-499. |
| 12. | Eddy, B. E. 1944. A study of cross reactions among the pneumococcic types and their application to the identification of the types. Public Health Rep. 59:451-468. |
| 13. | Figueiredo, A. M., R. Austrian, P. Urbaskova, L. A. Teixeira, and A. Tomasz. 1995. Novel penicillin-resistant clones of Streptococcus pneumoniae in the Czech Republic and in Slovakia. Microb. Drug Resist. 1:71-78. [Medline] |
| 14. | Garcia, E., P. Garcia, and R. Lopez. 1993. Cloning and sequencing of a gene involved in the synthesis of the capsular polysaccharide of Streptococcus pneumoniae type 3. Mol. Gen. Genet. 239:188-195[Medline]. |
| 15. |
Guidolin, A.,
J. K. Morona,
R. Morona,
D. Hansman, and J. C. Paton.
1994.
Nucleotide sequence analysis of genes essential for capsular polysaccharide biosynthesis in Streptococcus pneumoniae type 19F.
Infect. Immun.
62:5384-5396 |
| 16. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 17. | Henrichsen, J. 1995. Six newly recognized types of Streptococcus pneumoniae. J. Clin. Microbiol. 33:2759-2762[Abstract]. |
| 18. | Kolkman, M. A. 1997. Ph.D. thesis. University of Utrecht, Utrecht, The Netherlands. |
| 19. | Kolkman, M. A., W. Wakarchuk, P. J. Nuijten, and B. A. van der Zeijst. 1997. Capsular polysaccharide synthesis in Streptococcus pneumoniae serotype 14: molecular analysis of the complete cps locus and identification of genes encoding glycosyltransferases required for the biosynthesis of the tetrasaccharide subunit. Mol. Microbiol. 26:197-208[Medline]. |
| 20. | Lacks, S., and R. D. Hotchkiss. 1960. A study of the genetic material determining an enzyme activity in penumococcus. Biochim. Biophys. Acta 39:508-517[Medline]. |
| 21. | Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3:208-218. |
| 22. |
Melton, D. A.,
P. A. Krieg,
M. R. Rebagliati,
T. Maniatis,
K. Zinn, and M. R. Green.
1984.
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res.
12:7035-7056 |
| 23. |
Morona, J. K.,
A. Guidolin,
R. Morona,
D. Hansman, and J. C. Paton.
1994.
Isolation, characterization, and nucleotide sequence of IS1202, an insertion sequence of Streptococcus pneumoniae.
J. Bacteriol.
176:4437-4443 |
| 24. | Morona, J. K., R. Morona, and J. C. Paton. 1997. Characterization of the locus encoding the Streptococcus pneumoniae type 19F capsular polysaccharide biosynthetic pathway. Mol. Microbiol. 23:751-763[Medline]. |
| 25. |
Morona, J. K.,
R. Morona, and J. C. Paton.
1997.
Molecular and genetic characterization of the capsule biosynthesis locus of Streptococcus pneumoniae type 19B.
J. Bacteriol.
179:4953-4958 |
| 26. | Munoz, R., T. J. Coffey, M. Daniels, C. G. Dowson, G. Laible, J. Casal, R. Hakenbeck, M. Jacobs, J. M. Musser, B. G. Spratt, et al. 1991. Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae. J. Infect. Dis. 164:302-306[Medline]. |
| 27. | Munoz, R., M. Mollerach, R. Lopez, and E. Garcia. 1997. Molecular organization of the genes required for the synthesis of type 1 capsular polysaccharide of Streptococcus pneumoniae: formation of binary encapsulated pneumococci and identification of cryptic dTDP-rhamnose biosynthesis genes. Mol. Microbiol. 25:79-92[Medline]. |
| 28. | Nesin, M., M. Ramirez, and A. Tomasz. 1998. Capsular transformation of a multidrug-resistant Streptococcus pneumoniae in vivo. J. Infect. Dis. 177:707-713[Medline]. |
| 29. | Nicholas, K. B., H. B. Nicholas, Jr., and D. W. I. Deerfield. 1997. GeneDoc: analysis and visualization of genetic variation. EMBNET News 4:14. |
| 30. | Paton, J. C., J. K. Morona, and R. Morona. 1997. Characterization of the capsular polysaccharide biosynthesis locus of Streptococcus pneumoniae type 19F. Microb. Drug Resist. 3:89-99. [Medline] |
| 31. | Reese, M. G., N. L. Harris, and F. H. Eeckman. 1996. Presented at the Pacific Symposium on Biocomputing, Kona, Hawaii . |
| 32. | Robbins, J. B., R. Austrian, C. J. Lee, S. C. Rastogi, G. Schiffman, J. Henrichsen, P. H. Makela, C. V. Broome, R. R. Facklam, R. H. Tiesjema, et al. 1983. Considerations for formulating the second-generation pneumococcal capsular polysaccharide vaccine with emphasis on the cross-reactive types within groups. J. Infect. Dis. 148:1136-1159[Medline]. |
| 33. | Roux, K. H. 1995. Optimization and troubleshooting in PCR. PCR Methods Appl. 4:S185-S194[Medline]. |
| 34. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. | Scharf, M., R. Schneider, G. Casari, P. Bork, A. Valencia, C. Ouzounis, and C. Sander. 1994. Presented at the Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology . |
| 36. | Soares, S., K. G. Kristinsson, J. M. Musser, and A. Tomasz. 1993. Evidence for the introduction of a multiresistant clone of serotype 6B Streptococcus pneumoniae from Spain to Iceland in the late 1980s. J. Infect. Dis. 168:158-163[Medline]. |
| 37. |
Tatusov, R. L.,
E. V. Koonin, and D. J. Lipman.
1997.
A genomic perspective on protein families.
Science
278:631-637 |
| 38. |
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680 |
| 39. | Van Dam, J. E., A. Fleer, and H. Snippe. 1990. Immunogenicity and immunochemistry of Streptococcus pneumoniae capsular polysaccharides. Antonie Leeuwenhoek 58:1-47[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»