JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.-H.
Right arrow Articles by Hwang, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.-H.
Right arrow Articles by Hwang, J.-L.

 Previous Article

Journal of Bacteriology, October 1998, p. 5279-5283, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Two Amino Acid Residues of Transposase Contributing to Differential Transposability of IS1 Elements in Escherichia coli

Jiann-Hwa Chen,* Wen-Ben Hsu, and Jiing-Luen Hwang

Institute of Molecular Biology, National Chung Hsing University, Taichung, Taiwan 402, Republic of China

Received 18 May 1998/Accepted 28 July 1998

    ABSTRACT
Top
Abstract
Text
References

Escherichia coli W3110 contains four types of IS1 elements in the chromosome. Using an insertion element entrapping system, we collected 116 IS1 plasmid insertion mutants, which resulted from a minimum of 26 independent IS1 insertion events. All of them had insertions of IS1 of the IS1A (IS1E and IS1G) type. Inspection of the transposase sequences of the four IS1 types and the IS1 of the resistance plasmid R100 showed that two amino acid residues, His-193 and Leu-217 of transposase, might contribute to differential transposability of IS1 elements in W3110. The two amino acid residues of the transposase in IS1A (IS1E and IS1G) were altered separately by site-directed mutagenesis, and each mutant was found to mediate transposition at a frequency about 30-fold lower than that of IS1A (IS1E and IS1G). Thus, the assumption that His-193 and Leu-217 of transposase contribute to differential transposability of IS1 elements in W3110 was confirmed.

    TEXT
Top
Abstract
Text
References

Escherichia coli K-12 strains contain 6 to 10 copies of insertion sequence 1 (IS1) in their chromosomes (10, 15). In W3110, seven IS1 copies have been identified, and six were mapped at loci is1A to is1F at 0.4, 6.3, 6.5, 22.3, 75.6, and 97.5 min, respectively (1, 23, 24). These six IS1 copies belong to four sequence types. IS1A and IS1E have identical nucleotide sequences, as do IS1B and IS1C. IS1B (IS1C) and IS1D each have 9 nucleotide (nt) substitutions, and IS1F has 73 nt substitutions (24). The seventh IS1 copy was initially thought to be located upstream of the citrate-dependent iron(III) transport fec genes at 7 min in a non-W3110 strain (25, 27). Since nucleotide sequences of this IS1 copy and its flanking host regions are identical to those of IS1F and its flanking host regions in W3110, and the fec genes are in fact located at 97.5' in W3110 (18, 19), it has been suggested that IS1F and its adjacent fec genes have undergone a DNA rearrangement(s), resulting in translocation at map position 7' in this non-W3110 strain (5). An IS1 copy later identified by Zuber and Schumann (27) at 49.6' in W3110, therefore, should be the seventh instead of the eighth IS1 copy. Only its terminal 21-bp sequence as well as the neighboring 120-bp host sequence was reported.

In our previous study (5), we PCR amplified this seventh IS1 copy in W3110, using primers homologous to the first 16-nt sequence of IS1A (IS1E) and the host sequence adjacent to the end of the seventh IS1 copy. We showed that it has a nucleotide sequence identical to that of IS1A (IS1E) and named it IS1G. A plasmid system carrying sucrose-sensitive sacR and sacB genes from Bacillus subtilis (7) was used to isolate IS1 plasmid insertion mutants in W3110. Ninety-four IS1 insertion mutants were isolated from six independent subcultures, and detailed restriction mapping revealed that all had insertions of IS1 of the IS1A (IS1E and IS1G) type. In this study, we isolated 22 IS1 plasmid insertion mutants by the same method and confirmed that all were insertions of IS1 of the IS1A (IS1E and IS1G) type. The deduced transposase sequence of IS1A (IS1E and IS1G) was compared with those of the other three IS1 types and the IS1 of the resistance plasmid R100, IS1R (16). Two amino acid residues seemed important for the transposition of IS1 elements in W3110. The two amino acid residues in IS1A (IS1E and IS1G) were altered separately by site-directed mutagenesis, and each mutant was shown to mediate transposition at a frequency about 30-fold lower than that of IS1A (IS1E and IS1G).

Collection and analysis of plasmid IS1 insertion mutants. In our previous study, we collected 94 IS1 plasmid insertion mutants from six independent subcultures which were mapped into five restriction fragments (BamHI-EcoRI, EcoRI-DraI, DraI-DraI, DraI-HindIII, and HindIII-BstEII) in the target 2.6-kb sacR and sacB region (Fig. 1). In order to understand the nature of the 94 IS1 insertions, we further mapped them with HincII and randomly picked six mutants each from the 28 DraI-HindIII insertions in subculture 3, the 18 HincII-DraI insertions in subculture 4, and the 10 DraI-HindIII insertions in subculture 10 for IS1 junction sequence determination. The result shows that five of the six insertions in subculture 4 and all six insertions in both subcultures 3 and 10 had the same insertion locations (data not shown), indicating that most of the insertions in these regions in the three subcultures were probably siblings. Thus, we counted all IS1 insertions in one restriction fragment in a subculture as a single independent event.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1.   Distribution of the 116 IS1 insertions isolated from eight independent subcultures in the 2.6-kb sacR-and-sacB-containing BamHI-PstI DNA fragment. The top line represents the 2.6-kb fragment, which is further divided into eight restriction fragments according to nucleotide sequence (22). For the indicated subcultures, numbers in parentheses above each restriction fragment indicate how many IS1 insertions were detected in that fragment. Insertions from subcultures 1, 3, 4, 6, 7, and 10 were isolated and mapped previously (5), but in this study they were also mapped with HincII. An insertion in subculture 6 was found mapped at a specific HincII recognition site and is indicated by an asterisk. Insertions from subcultures 11 and 12 were isolated and mapped in this study.

To increase the sampling size resulting from IS1-independent insertions, two more independent subcultures were collected and analyzed according to the method used in our previous study (5). Briefly, a pACYC177 derivative carrying a sucrose-sensitive sacB gene and the regulatory sequence sacR from B. subtilis (pS177; Table 1) was transformed into W3110, and serial dilutions of cultures of the transformant were plated onto a sucrose-containing plate. Plasmid DNA of all survivor colonies on one dilution plate was analyzed by restriction mapping and Southern hybridization, with radiolabelled IS1 DNA fragment as the probe. By this method we found 7 IS1 and 15 IS5 plasmid insertion mutants from the 33 survivor colonies in one subculture (subculture 11) and 15 IS1 and one IS30 plasmid insertion mutants and 19 plasmid deletion mutants from the 41 survivor colonies in the other subculture (subculture 12). The rest of the mutants did not have sizable changes in their plasmids. Detailed restriction mapping indicated that the 22 IS1 insertions were insertions of IS1 of the IS1A (IS1E and IS1G) type, as in the previous study. Together with the result obtained in the previous study, this result indicated that, of the 338 mutant plasmids analyzed, 135 (40%) had mutations without any sizable change, 22 (7%) had deletions, and 180 (53%) had insertions, 116 (34%) of which had insertions of chromosomal IS1 of the IS1A (IS1E and IS1G) type, 53 (16%) of which had insertions of chromosomal IS5, and 11 (3%) of which had insertions of chromosomal IS30. The 22 deletions were not mediated by IS1 elements that had been transposed onto the plasmid, as evidenced by Southern hybridization with the IS1 probe, despite the fact that IS1-mediated adjacent deletions have been reported to occur at a high frequency (17, 21). Figure 1 illustrates the distribution of the 116 IS1 insertions. A minimum of 26 independent IS1 insertions were analyzed based on their locations in different restriction fragments in mutants of a single subculture or on their isolation from different subcultures.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Bacterial strains and plasmids

Sequence comparison of the four IS1 types and the IS1 of the plasmid R100. An IS1 found in the resistance plasmid R100, called IS1R, contains seven base substitutions compared with the IS1A (IS1E and IS1G) sequence (16, 24). Genetic studies with IS1R and IS1K, an IS1 of the IS1A (IS1E and IS1G) type, indicated that both code for two consecutive partly overlapping open reading frames, insA and insB', and that the functional InsAB' transposase protein is generated by a -1 frameshifting mechanism at an A6C motif located at the 3' end of the upstream insA frame (13, 20). Compared with the IS1A (IS1E and IS1G) sequence, IS1F contains 73 nt mismatches, including a G-to-A transition at nt 542, generating nonsense codon TAG and leading to premature termination of the InsAB' transposase protein (24). Despite this, an IS1 of the IS1F type (called IS1T) was found to be capable of transposition in a supE44 background and likely to be involved in an insertion mutation in lacZ (4, 14). On the other hand, IS1B (IS1C) and IS1D each have only nine mismatches, and their transposition activities have not been detected previously or in our studies.

The nine mismatches in IS1B (IS1C) lead to six conservative changes (Tyr-24, Tyr-69, Arg-82, His-83, Gly-113, and Tyr-114) and three amino acid changes in the transposase sequence, Leu-81right-arrowPhe, Ser-130right-arrowArg, and Leu-217right-arrowGln. The nine mismatches in IS1D include a G-to-T substitution at bp 50, five conservative changes (Tyr-24, Arg-82, His-83, Gly-113, and Tyr-114), and three amino acid changes in the transposase sequence (Leu-81right-arrowPhe, Ser-130right-arrowArg, and His-193right-arrowTyr). The G-to-A substitution at bp 50 is located between the Shine-Dalgarno sequence and the start codon for the transposase and is unlikely to play a role in IS1 transposability. IS1R, on the other hand, contains seven mismatches, leading to five conservative changes (Thr-69, Arg-82, His-83, Gly-113, and Thr-114) and two amino acid changes (Leu-81right-arrowPhe and Ser-130right-arrowArg) in the transposase sequence (Fig. 2). Since IS1R transposase has been previously shown to be functional (20), and because changes of Leu-81right-arrowPhe and Ser-130right-arrowArg are observed in IS1R, IS1B (IS1C), and IS1D, we hypothesized that these two changes have no effect on IS1 transposability and that the Leu-217right-arrowGln change in IS1B (IS1C) and the His-193right-arrowTyr change in IS1D separately contribute to the loss or reduction of transposability in W3110. The fact that IS1F also contains the Ser-130right-arrowArg change, a conservative change in Leu-217, and no change in Leu-81 and His-193 further supports our hypothesis.


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2.   (A) Alignment of the transposase amino acid sequences of IS1A (IS1E and IS1G), IS1B (IS1C), IS1D, IS1R, and IS1F (IS1T). An amber at position 164 in IS1F (IS1T), which could be suppressed in a supE44 background and result in a transposase of 232 amino acids, is indicated by an asterisk. (B) Structures of IS1A (IS1E and IS1G), IS1B (IS1C), IS1D, and IS1R and positions of the primers used in constructing the transposase mutants. The top two horizontal lines represent the two open reading frames insA and insB', encoded by the four IS1s, with the frames indicated in parentheses. The -1 frameshift A6C motif for generation of the InsAB' transposase protein is shown as a hatched box. The four IS1 elements (768 bp) are shown as horizontal lines, with filled triangles indicating the two terminal inverted repeats, IRL and IRR. For clarity, restriction enzyme recognition sites and the -1 frameshift A6C motif, present in all four IS1 elements, are shown only in IS1A (IS1E and IS1G). The number in parentheses above each restriction enzyme recognition site is the IS1 coordinate for that site. For IS1B (IS1C), IS1D, and IS1R, only bases different from IS1A (IS1E and IS1G) are shown. Vertical arrows indicate amino acid residues that are altered by the base substitutions. Primers are represented by horizontal arrows below their regions, according to the sequences. Primers IS1DLO and IS1DRO were designed according to the host sequences flanking IS1D, which are not shown. IS1F (IS1T) has 73 bases different from IS1A (IS1E and IS1G) and is not shown.

Generation of transposase mutants of IS1A (IS1E and IS1G). To prove our hypothesis, we planned to construct two IS1A (IS1E and IS1G) transposase mutants carrying either the Leu-217right-arrowGln mutation or the His-193right-arrowTyr mutation and to assay for their in vivo transposition activities. A mutagenic primer was specifically designed to construct the Leu-217right-arrowGln transposase mutant, which has a T-to-A mutation at bp 704 in the IS1A (IS1E and IS1G) sequence. Primer IS1Leu217 (5'GAGGACTTTGTCATGCTGCTCCACCGATTTTGA3') is complementary to bp 688 to 718 of the IS1A (IS1E and IS1G) sequence, including a Tth111I recognition site (underlined), except that trinucleotide GAG was added 5' to the Tth111I recognition site and the T-to-A mutation at bp 704 was incorporated into the center of the sequence (boldface). A pUC18 derivative carrying the IS1A (IS1E and IS1G) sequence (pJCA1; Table 1) was used as the template for PCR with primers IS1Leu217 and IS1L (5'GGTGATGCTGCCAACT3'), which is identical to the first 16 bases of the IS1A (IS1E and IS1G) sequence (Fig. 2). The 282-bp MluI-Tth111I fragment of the resulting 0.8-kb PCR fragment was cloned into pJCA1, generating plasmid pJCA2. DNA sequencing was carried out to confirm that pJCA2 carries only the T-to-A mutation at bp 704 in the IS1A (IS1E and IS1G) sequence (the Leu-217right-arrowGln change in the InsAB' transposase).

To construct the His-193right-arrowTyr transposase mutant, we used a somewhat different strategy. Genomic DNA of W3110 was used as the template, and two primers (IS1DLO [5'TCGCATGGACAATACG3'] and IS1DRO [5'AAGCGTACGTATTGCA3']) identical to the outside host sequences adjacent to the left terminal inverted repeat (IRL) and the right terminal inverted repeat (IRR) of IS1D were used for PCR amplification of IS1D (24). The 267-bp BspEI-Tth111I fragment of the resulting 0.8-kb PCR fragment was cloned into pJCA1, generating plasmid pJCA3. DNA sequencing was carried out to confirm that pJCA3 carries only the His-193right-arrowTyr change in the sequence containing IS1A (IS1E and IS1G).

Transposition of IS1 occurs naturally at a very low frequency. It has been demonstrated that insertion of an A residue within the frameshift A6C motif or replacement of A6C with GA2GA3C, which would fuse the insA and insB' frames and lead to constitutive production of the InsAB' transposase, would increase the transposition frequency 40- to 100-fold (20, 21). To increase the assay sensitivity, a transposase-constitutive A7C mutant of pJCA1 was first constructed by the overlap extension technique with two pairs of PCR primers (9). Primer IS1L (5'GGTGATGCTGCCAACT3') is identical to the first 16 bases of IRL, and primer A7L (5'ACGTCACTTAAAAAAACTCAGGCCG3') is identical to bp 298 to 321 of the IS1A (IS1E and IS1G) sequence except that an A (boldface) is introduced into the motif containing A6C. Primer A7R (5'CGGCCTGAGTTTTTTTAAGTGACGT3') is complementary to A7L, and primer IS1R (5'GGTAATGACTCCAACT3') is complementary to the last 16 bp of the IS1A (IS1E and IS1G) sequence. With pJCA1 as the template, two separate PCRs were conducted with primers IS1L and A7R and primers A7L and IS1R, generating two PCR fragments with overlapping ends. The two fragments were gel purified and pooled together as a template for PCR with primers IS1L and IS1R. The 148-bp PstI-BstEII fragment of the resulting 0.8-kb PCR fragment was cloned into pJCA1, generating pJCA4. DNA sequencing was carried out to confirm that pJCA4 carries only the A7C mutation in the IS1A (IS1E and IS1G) sequence. The 386-bp BstEII-Tth111I DNA fragments of pJCA2 and pJCA3 were separately cloned into pJCA4 to yield pJCA5 and pJCA6. Plasmids pJCA5 and pJCA6 carry the Leu-217right-arrowGln mutation and the His-193right-arrowTyr mutation separately in a transposase-constitutive background, i.e., A7C; this was also confirmed by DNA sequencing. Figure 2 depicts the overall structures of IS1A (IS1E and IS1G), IS1B (IS1C), IS1D, and IS1R and the positions of the primers used in constructing the transposase mutants, whereas Table 1 describes the characteristics of the transposase mutants constructed as well as other plasmids and E. coli strains used in this study.

Assay of transposition activity of the transposase mutants. Transposition activities of the transposase mutants were determined by the standard mating out assay, which measures the cointegration frequency between an IS1 donor plasmid and a target plasmid (3, 6, 11). A conjugative plasmid, pCJ105, carrying a chloramphenicol resistance gene was used as the target replicon, and the plasmids carrying mutations in the IS1A (IS1E and IS1G) sequence constructed as described above were the IS1 donor plasmids. The IS1 donor plasmids were transformed into DH1 cells (streptomycin sensitive) harboring pCJ105, and the transformants were grown overnight in Luria broth supplemented with antibiotics at 30°C. The culture was diluted 200-fold in fresh medium without antibiotics, and growth was continued until it reached an A450 of 0.7 to serve as the donor cells. Fresh-grown HB101 cells (streptomycin resistant) at the same density were mixed with an equal volume of the donor cells and incubated at 37°C without shaking for 2 more hours to allow conjugation to occur. The mating mixture was plated out onto selective plates. Initially, we used plasmids pJCA1 to pJCA6 as IS1 donor plasmids, and the mating mixtures were plated on plates containing ampicillin (50 µg/ml), chloramphenicol (25 µg/ml), and streptomycin (200 µg/ml) for selection of cointegrate-containing recipient cells and on plates containing chloramphenicol and streptomycin for selection of pCJ105-containing and cointegrate-containing recipient cells. Transposition frequency was calculated as the number of cointegrate-containing recipient cells divided by the number of pCJ105-containing and cointegrate-containing recipient cells to determine the transposition activity of the IS1 element in the donor plasmid. The experiment failed at the beginning, due to the many background colonies on the ampicillin-, chloramphenicol-, and streptomycin-containing plates. We then recloned the 0.8-kb IS1-containing BamHI-HindIII fragment of pJCA1 through pJCA6 into plasmid pOK12 (Kmr), generating plasmids pJCA11 through pJCA16 (Table 1). Selection for cointegrate-containing recipient cells was carried out on plates containing kanamycin (50 µg/ml), chloramphenicol, and streptomycin, and we did not observe background colonies. The results of three independent mating out assays are shown in Table 2.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Transposition frequencies of the IS1 transposase mutants in three mating out assays

The results show that the transposase-constitutive construct of IS1A (IS1E and IS1G) demonstrated an increase in transposition activity of 21- to 34-fold, indicating that the sensitivity of the mating out assay can be increased about 30-fold with the transposase-constitutive construct. This result is consistent with the results of others (20, 21). The transposase-constitutive constructs of the Leu-217right-arrowGln mutant and the His-193right-arrowTyr mutant demonstrated transposition activities 15- to 43-fold lower than the activity of the IS1A (IS1E and IS1G) transposase-constitutive construct, indicating that the two mutations reduced the transposition activity about 30-fold. The fact that there was essentially no difference in transposition activities between the two mutants and their transposase-constitutive constructs also suggests that Leu-217right-arrowGln and His-193right-arrowTyr both abolish most, if not all, of the transposition activity of the IS1A (IS1E and IS1G) transposase. The fact that both mutants still showed low levels of transposition activities, similar to those of IS1A (IS1E and IS1G), is probably due to trans-complementation by the functional transposases of the chromosomal IS1 elements in DH1 cells. This does not conflict with the result that trans-complementation by IS1A (IS1E and IS1G) did not occur during our isolation of plasmid insertion mutants, because two separate IS1-mediated events were involved (i.e., cointegration between two replicons versus transposition from chromosome to plasmids).

Although studies have shown that transcription activity of the external host sequences could modulate IS1 activity (3), our results indicate that the Leu-217right-arrowGln change in IS1B (IS1C) and the His-193right-arrowTyr change in IS1D contribute to our failure to detect transposition of IS1B (IS1C) and IS1D in W3110. Serre et al. (21) found that His-200, Arg-203, and Tyr-231 residues of the IS1 transposase are important for activity. These three residues are conserved in the transposase sequences of the four IS1 types and IS1R. Together, our results and those of Serre et al. indicate the importance of amino residues in the C-terminal part of the transposase for activity.

    ACKNOWLEDGMENTS

We thank S. T. Hu for providing DH1/pCJ105.

This study was supported by a grant from the National Science Council of the Republic of China (NSC-83-0203-B005-006).

    FOOTNOTES

* Corresponding author. Mailing address: Institute of Molecular Biology, National Chung Hsing University, Taichung, Taiwan 402, Republic of China. Phone: 886-04-2851885. Fax: 886-4-2874879. E-mail: jhchen{at}dragon.nchu.edu.tw.

    REFERENCES
Top
Abstract
Text
References

1. Birkenbihl, R. P., and W. Vielmetter. 1989. Complete maps of IS1, IS2, IS3, IS4, IS5, IS30 and IS150 locations in Escherichia coli K12. Mol. Gen. Genet. 220:147-153[Medline].
2. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472[Medline].
3. Chandler, M., and D. J. Galas. 1983. Cointegrate formation mediated by Tn9. II. Activity of IS1 is modulated by external DNA sequences. J. Mol. Biol. 170:61-91[Medline].
4. Chen, J.-H., and R. D. Porter. 1988. Characterization of the types of mutational events that spontaneously occur in a plasmid system. Mutat. Res. 197:23-37[Medline].
5. Chen, J.-H., and H.-T. Yeh. 1997. The seventh copy of IS1 in Escherichia coli W3110 belongs to the IS1A (IS1E) type which is the only IS1 type that transposes from chromosome to plasmids. Proc. Natl. Sci. Counc. Repub. China 21:100-105.
6. Galas, D. J., and M. Chandler. 1982. Structure and stability of Tn9-mediated cointegrates. Evidence for two pathways of transposition. J. Mol. Biol. 154:245-272[Medline].
7. Gay, P., D. Le Coq, M. Steinmetz, T. Berkelman, and C. I. Kado. 1985. Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria. J. Bacteriol. 164:918-921[Abstract/Free Full Text].
8. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline].
9. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59[Medline].
10. Hu, M., and R. C. Deonier. 1981. Comparison of IS1, IS2 and IS3 copy number in Escherichia coli strains K-12, B and C. Gene 16:161-170[Medline].
11. Hu, S. T., and C. H. Lee. 1988. Characterization of the transposon carrying the STII gene of enterotoxigenic Escherichia coli. Mol. Gen. Genet. 214:490-495[Medline].
12. Joyce, C. M., and N. D. F. Grindley. 1984. Method for determining whether a gene of Escherichia coli is essential: application to the polA gene. J. Bacteriol. 158:636-643[Abstract/Free Full Text].
13. Luthi, K., M. Moser, J. Ryser, and H. Weber. 1990. Evidence of a role of translational frameshifting in the expression of transposition activity of the bacterial insertion element IS1. Gene 88:15-20[Medline].
14. Malamy, M. H., P. T. Rahaim, C. S. Hoffman, D. Baghdoyan, M. B. O'Connor, and J. F. Miller. 1985. A frameshift mutation at the junction of an IS1 insertion within lacZ restores beta -galactosidase activity via formation of an active lacZ-IS1 fusion protein. J. Mol. Biol. 181:551-555[Medline].
15. Nyman, K., K. Nakamura, H. Ohtsubo, and E. Ohtsubo. 1981. Distribution of the insertion sequence IS1 in Gram-negative bacteria. Nature 289:609-612[Medline].
16. Ohtsubo, H., and E. Ohtsubo. 1978. Nucleotide sequence of an insertion element, IS1. Proc. Natl. Acad. Sci. USA 75:615-619[Abstract/Free Full Text].
17. Reif, H. J., and H. Saedler. 1975. IS1 is involved in deletion formation in the gal region of E. coli K12. Mol. Gen. Genet. 137:17-28[Medline].
18. Rudd, K. E., W. Miller, C. Werner, J. Ostell, C. Tolstoshev, and S. G. Satterfield. 1991. Mapping sequenced E. coli genes by computer: software, strategies and examples. Nucleic Acids Res. 19:637-647[Abstract/Free Full Text].
19. Rudd, K. E. 1992. Alignment of E. coli DNA sequences to a revised, integrated genomic restriction map, p. 2.3-2.43. In J. H. Miller (ed.), A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
20. Sekine, Y., and E. Ohtsubo. 1989. Frameshifting is required for production of the transposase encoded by insertion sequence 1. Proc. Natl. Acad. Sci. USA 86:4609-4613[Abstract/Free Full Text].
21. Serre, M.-C., C. Turlan, M.-L. Bortolin, and M. Chandler. 1995. Mutagenesis of the IS1 transposase: importance of a His-Arg-Tyr triad for activity. J. Bacteriol. 177:5070-5077[Abstract/Free Full Text].
22. Steinmetz, M., D. Le Coq, S. Aymerich, G. Gonzy-Treboul, and P. Gay. 1985. The DNA sequence of the gene for the secreted Bacillus subtilis enzyme levansucrase and its genetic control sites. Mol. Gen. Genet. 200:220-228[Medline].
23. Umeda, M., and E. Ohtsubo. 1989. Mapping of insertion elements IS1, IS2 and IS3 on the Escherichia coli K-12 chromosome. Role of the insertion elements in formation of Hfrs and F' factors and in rearrangement of bacterial chromosomes. J. Mol. Biol. 208:601-614[Medline].
24. Umeda, M., and E. Ohtsubo. 1991. Four types of IS1 with differences in nucleotide sequence reside in the Escherichia coli K-12 chromosome. Gene 98:1-5[Medline].
25. van Hove, B., H. Staudenmaier, and V. Braun. 1990. Novel two-component transmembrane transcriptional control: regulation of iron dicitrate transport in Escherichia coli K-12. J. Bacteriol. 172:6749-6758[Abstract/Free Full Text].
26. Vieira, J., and J. Messing. 1991. New pUC-derived cloning vectors with different selectable markers and DNA replication origins. Gene 100:189-194[Medline].
27. Zuber, U., and W. Schumann. 1993. The eighth copy of IS1 in Escherichia coli W3110 maps at 49.6 minutes. J. Bacteriol. 175:1552[Free Full Text].


Journal of Bacteriology, October 1998, p. 5279-5283, Vol. 180, No. 19
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.-H.
Right arrow Articles by Hwang, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.-H.
Right arrow Articles by Hwang, J.-L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS