TEXT

Top Abstract Text References

Escherichia coli K-12 strains contain 6 to 10 copies of insertion sequence 1 (IS1) in their chromosomes (10, 15). In W3110, seven IS1 copies have been identified, and six were mapped at loci is1A to is1F at 0.4, 6.3, 6.5, 22.3, 75.6, and 97.5 min, respectively (1, 23, 24). These six IS1 copies belong to four sequence types. IS1A and IS1E have identical nucleotide sequences, as do IS1B and IS1C. IS1B (IS1C) and IS1D each have 9 nucleotide (nt) substitutions, and IS1F has 73 nt substitutions (24). The seventh IS1 copy was initially thought to be located upstream of the citrate-dependent iron(III) transport fec genes at 7 min in a non-W3110 strain (25, 27). Since nucleotide sequences of this IS1 copy and its flanking host regions are identical to those of IS1F and its flanking host regions in W3110, and the fec genes are in fact located at 97.5' in W3110 (18, 19), it has been suggested that IS1F and its adjacent fec genes have undergone a DNA rearrangement(s), resulting in translocation at map position 7' in this non-W3110 strain (5). An IS1 copy later identified by Zuber and Schumann (27) at 49.6' in W3110, therefore, should be the seventh instead of the eighth IS1 copy. Only its terminal 21-bp sequence as well as the neighboring 120-bp host sequence was reported.

In our previous study (5), we PCR amplified this seventh IS1 copy in W3110, using primers homologous to the first 16-nt sequence of IS1A (IS1E) and the host sequence adjacent to the end of the seventh IS1 copy. We showed that it has a nucleotide sequence identical to that of IS1A (IS1E) and named it IS1G. A plasmid system carrying sucrose-sensitive sacR and sacB genes from Bacillus subtilis (7) was used to isolate IS1 plasmid insertion mutants in W3110. Ninety-four IS1 insertion mutants were isolated from six independent subcultures, and detailed restriction mapping revealed that all had insertions of IS1 of the IS1A (IS1E and IS1G) type. In this study, we isolated 22 IS1 plasmid insertion mutants by the same method and confirmed that all were insertions of IS1 of the IS1A (IS1E and IS1G) type. The deduced transposase sequence of IS1A (IS1E and IS1G) was compared with those of the other three IS1 types and the IS1 of the resistance plasmid R100, IS1R (16). Two amino acid residues seemed important for the transposition of IS1 elements in W3110. The two amino acid residues in IS1A (IS1E and IS1G) were altered separately by site-directed mutagenesis, and each mutant was shown to mediate transposition at a frequency about 30-fold lower than that of IS1A (IS1E and IS1G).

Collection and analysis of plasmid IS1 insertion mutants. In our previous study, we collected 94 IS1 plasmid insertion mutants from six independent subcultures which were mapped into five restriction fragments (BamHI-EcoRI, EcoRI-DraI, DraI-DraI, DraI-HindIII, and HindIII-BstEII) in the target 2.6-kb sacR and sacB region (Fig. 1). In order to understand the nature of the 94 IS1 insertions, we further mapped them with HincII and randomly picked six mutants each from the 28 DraI-HindIII insertions in subculture 3, the 18 HincII-DraI insertions in subculture 4, and the 10 DraI-HindIII insertions in subculture 10 for IS1 junction sequence determination. The result shows that five of the six insertions in subculture 4 and all six insertions in both subcultures 3 and 10 had the same insertion locations (data not shown), indicating that most of the insertions in these regions in the three subcultures were probably siblings. Thus, we counted all IS1 insertions in one restriction fragment in a subculture as a single independent event.

View larger version (18K): [in this window] [in a new window]   FIG. 1.   Distribution of the 116 IS1 insertions isolated from eight independent subcultures in the 2.6-kb sacR-and-sacB-containing BamHI-PstI DNA fragment. The top line represents the 2.6-kb fragment, which is further divided into eight restriction fragments according to nucleotide sequence (22). For the indicated subcultures, numbers in parentheses above each restriction fragment indicate how many IS1 insertions were detected in that fragment. Insertions from subcultures 1, 3, 4, 6, 7, and 10 were isolated and mapped previously (5), but in this study they were also mapped with HincII. An insertion in subculture 6 was found mapped at a specific HincII recognition site and is indicated by an asterisk. Insertions from subcultures 11 and 12 were isolated and mapped in this study.

Sequence comparison of the four IS1 types and the IS1 of the plasmid R100. An IS1 found in the resistance plasmid R100, called IS1R, contains seven base substitutions compared with the IS1A (IS1E and IS1G) sequence (16, 24). Genetic studies with IS1R and IS1K, an IS1 of the IS1A (IS1E and IS1G) type, indicated that both code for two consecutive partly overlapping open reading frames, insA and insB', and that the functional InsAB' transposase protein is generated by a 1 frameshifting mechanism at an A₆C motif located at the 3' end of the upstream insA frame (13, 20). Compared with the IS1A (IS1E and IS1G) sequence, IS1F contains 73 nt mismatches, including a G-to-A transition at nt 542, generating nonsense codon TAG and leading to premature termination of the InsAB' transposase protein (24). Despite this, an IS1 of the IS1F type (called IS1T) was found to be capable of transposition in a supE44 background and likely to be involved in an insertion mutation in lacZ (4, 14). On the other hand, IS1B (IS1C) and IS1D each have only nine mismatches, and their transposition activities have not been detected previously or in our studies.

View larger version (29K): [in this window] [in a new window]   FIG. 2.   (A) Alignment of the transposase amino acid sequences of IS1A (IS1E and IS1G), IS1B (IS1C), IS1D, IS1R, and IS1F (IS1T). An amber at position 164 in IS1F (IS1T), which could be suppressed in a supE44 background and result in a transposase of 232 amino acids, is indicated by an asterisk. (B) Structures of IS1A (IS1E and IS1G), IS1B (IS1C), IS1D, and IS1R and positions of the primers used in constructing the transposase mutants. The top two horizontal lines represent the two open reading frames insA and insB', encoded by the four IS1s, with the frames indicated in parentheses. The 1 frameshift A6C motif for generation of the InsAB' transposase protein is shown as a hatched box. The four IS1 elements (768 bp) are shown as horizontal lines, with filled triangles indicating the two terminal inverted repeats, IRL and IRR. For clarity, restriction enzyme recognition sites and the 1 frameshift A6C motif, present in all four IS1 elements, are shown only in IS1A (IS1E and IS1G). The number in parentheses above each restriction enzyme recognition site is the IS1 coordinate for that site. For IS1B (IS1C), IS1D, and IS1R, only bases different from IS1A (IS1E and IS1G) are shown. Vertical arrows indicate amino acid residues that are altered by the base substitutions. Primers are represented by horizontal arrows below their regions, according to the sequences. Primers IS1DLO and IS1DRO were designed according to the host sequences flanking IS1D, which are not shown. IS1F (IS1T) has 73 bases different from IS1A (IS1E and IS1G) and is not shown.

Generation of transposase mutants of IS1A (IS1E and IS1G). To prove our hypothesis, we planned to construct two IS1A (IS1E and IS1G) transposase mutants carrying either the Leu-217Gln mutation or the His-193Tyr mutation and to assay for their in vivo transposition activities. A mutagenic primer was specifically designed to construct the Leu-217Gln transposase mutant, which has a T-to-A mutation at bp 704 in the IS1A (IS1E and IS1G) sequence. Primer IS1Leu217 (5'GAGGACTTTGTCATGCTGCTCCACCGATTTTGA3') is complementary to bp 688 to 718 of the IS1A (IS1E and IS1G) sequence, including a Tth111I recognition site (underlined), except that trinucleotide GAG was added 5' to the Tth111I recognition site and the T-to-A mutation at bp 704 was incorporated into the center of the sequence (boldface). A pUC18 derivative carrying the IS1A (IS1E and IS1G) sequence (pJCA1; Table 1) was used as the template for PCR with primers IS1Leu217 and IS1L (5'GGTGATGCTGCCAACT3'), which is identical to the first 16 bases of the IS1A (IS1E and IS1G) sequence (Fig. 2). The 282-bp MluI-Tth111I fragment of the resulting 0.8-kb PCR fragment was cloned into pJCA1, generating plasmid pJCA2. DNA sequencing was carried out to confirm that pJCA2 carries only the T-to-A mutation at bp 704 in the IS1A (IS1E and IS1G) sequence (the Leu-217Gln change in the InsAB' transposase).

Assay of transposition activity of the transposase mutants. Transposition activities of the transposase mutants were determined by the standard mating out assay, which measures the cointegration frequency between an IS1 donor plasmid and a target plasmid (3, 6, 11). A conjugative plasmid, pCJ105, carrying a chloramphenicol resistance gene was used as the target replicon, and the plasmids carrying mutations in the IS1A (IS1E and IS1G) sequence constructed as described above were the IS1 donor plasmids. The IS1 donor plasmids were transformed into DH1 cells (streptomycin sensitive) harboring pCJ105, and the transformants were grown overnight in Luria broth supplemented with antibiotics at 30°C. The culture was diluted 200-fold in fresh medium without antibiotics, and growth was continued until it reached an A₄₅₀ of 0.7 to serve as the donor cells. Fresh-grown HB101 cells (streptomycin resistant) at the same density were mixed with an equal volume of the donor cells and incubated at 37°C without shaking for 2 more hours to allow conjugation to occur. The mating mixture was plated out onto selective plates. Initially, we used plasmids pJCA1 to pJCA6 as IS1 donor plasmids, and the mating mixtures were plated on plates containing ampicillin (50 µg/ml), chloramphenicol (25 µg/ml), and streptomycin (200 µg/ml) for selection of cointegrate-containing recipient cells and on plates containing chloramphenicol and streptomycin for selection of pCJ105-containing and cointegrate-containing recipient cells. Transposition frequency was calculated as the number of cointegrate-containing recipient cells divided by the number of pCJ105-containing and cointegrate-containing recipient cells to determine the transposition activity of the IS1 element in the donor plasmid. The experiment failed at the beginning, due to the many background colonies on the ampicillin-, chloramphenicol-, and streptomycin-containing plates. We then recloned the 0.8-kb IS1-containing BamHI-HindIII fragment of pJCA1 through pJCA6 into plasmid pOK12 (Km^r), generating plasmids pJCA11 through pJCA16 (Table 1). Selection for cointegrate-containing recipient cells was carried out on plates containing kanamycin (50 µg/ml), chloramphenicol, and streptomycin, and we did not observe background colonies. The results of three independent mating out assays are shown in Table 2.