Previous Article | Next Article 
J Bacteriol, January 1998, p. 317-329, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Properties of the P-Type ATPases Encoded by the copAP
Operons of Helicobacter pylori and
Helicobacter felis
Denis
Bayle,1
Sabine
Wängler,2
Thomas
Weitzenegger,3
Wolfram
Steinhilber,2
Jürgen
Volz,4
Michael
Przybylski,4
Klaus P.
Schäfer,2
George
Sachs,1 and
Klaus
Melchers2,*
University of California
Los Angeles and
Wadsworth Veterans Affairs Medical Center, Los Angeles,
California,1 and
Department of
Molecular Biology, Byk Gulden Pharmaceuticals,2
Gesellschaft für Analyse-Technik und Consulting
GmbH,3 and
Department of Chemistry,
University of Konstanz,4 Konstanz, Germany
Received 5 August 1997/Accepted 3 November 1997
 |
ABSTRACT |
The cop operons of Helicobacter pylori and
Helicobacter felis were cloned by gene library screening.
Both operons contain open reading frames for a P-type ion pump
(CopA) with homology to Cd2+ and Cu2+ ATPases
and a putative ion binding protein (CopP), the latter representing a CopZ homolog of the copYZAB operon of
Enterococcus hirae. The predicted CopA
ATPases contained an N-terminal GMXCXXC ion binding motif and a
membrane-associated CPC sequence. A synthetic N-terminal
peptide of the H. pylori CopA ATPase bound to
Cu2+ specifically, and gene disruption mutagenesis of CopA
resulted in an enhanced growth sensitivity of H. pylori to Cu2+ but not to other divalent cations. As
determined experimentally, H. pylori CopA contains four
pairs of transmembrane segments (H1 to H8), with the ATP binding and
phosphorylation domains lying between H6 and H7, as found for another
putative transition metal pump of H. pylori (K. Melchers,
T. Weitzenegger, A. Buhmann, W. Steinhilber, G. Sachs, and K. P. Schäfer, J. Biol. Chem. 271:446-457, 1996). The
corresponding transmembrane segments of the H. felis CopA
pump were identified by hydrophobicity analysis and via sequence similarity. To define functional domains, similarly oriented regions of
the two enzymes were examined for sequence identity. Regions with high
degrees of identity included the N-terminal Cu2+ binding
domain, the regions of ATP binding and phosphorylation in the energy
transduction domain, and a transport domain consisting of the last six
transmembrane segments with conserved cysteines in H4, H6, and H7. The
data suggest that H. pylori and H. felis employ
conserved mechanisms of ATPase-dependent copper resistance.
 |
INTRODUCTION |
Helicobacter pylori is a
human gastric pathogen associated with chronic gastritis, peptic
ulcers, and gastric cancer (8, 16, 27, 30, 64).
Helicobacter felis, a related microorganism, was originally
isolated from the stomach of a cat (42) but can also survive
in the gastric environments of other mammalian species, such as mice.
Mice infected with H. felis are often used as a model
to study H. pylori colonization, pathogenicity, and
eradication. Therefore, survival mechanisms of both H. pylori and H. felis are of interest. The
specialized ecological niche of gastric Helicobacter spp.,
the mammalian stomach, is dominated by the gastric acid produced by the
H+/K+ ATPase of the parietal cells but also
presents a highly variable cationic environment for these
microorganisms. In bacteria, cation cellular homeostasis as well as
resistance to several transition metals is based on the action of both
proton-cation antiporters and transition metal P-type ion pumps
(36, 51). The ion pumps of H. pylori, as
well as those of other gastric Helicobacter species, may
participate in the survival mechanisms of the pathogenic bacterium.
Expression of these P-type ATPases is environmentally regulated.
Expression of some of these pumps is controlled either by a
two-component system, consisting of a sensor kinase and a response regulator with affinity for specific DNA sequences, or by small cytoplasmic cation binding proteins acting as repressors or activators of gene expression. An example of the former is the high-affinity K+ uptake ATPase encoded by the kdpABC
operon of Escherichia coli. This operon was shown to be
controlled by an adjacent operon containing two genes,
kdpDE, defining the sensor kinase and the corresponding response regulator of a two-component regulatory system (10, 25,
44, 63). While the KdpD sensor kinase protein is membrane associated, the KdpE regulator protein is cytoplasmic. The KdpDE proteins regulate expression of the kdp operon, apparently
as a function of cellular turgor pressure (26, 59). In
contrast, expression of the two copper-transporting P-type ATPases
in Enterococcus hirae, CopA and CopB (39, 55), is
thought to be controlled by two small cytoplasmic proteins, CopY and
CopZ (38). The copYZ genes, which encode small
transition metal binding proteins, precede the structural P-type
ATPase genes A and B as part of the enterococcal copYZAB
operon. Their protein products were postulated to act as repressors
(CopY) or activators (CopZ) regulating gene transcription of the
cop operon depending on the availability of Cu2+
(38). The CopAB P-type ATPases of Enterococcus
hirae belong to a family of transition metal ATPases
containing N-terminal ion binding motifs and a membrane-associated CPX
sequence, both suggested to play a role in ion binding and/or ion
transport (5, 29, 51, 52, 57).
Of special interest is the membrane topology of P-type ATPases,
which provides a structural basis for the ion transport pathway through
the membrane. Hydropathy profiles, as well as other computer-aided methods for detection of amphipathic helices in membrane proteins, have
been misleading, and therefore the determination of topology needs
experimental evaluation (7, 50). The first bacterial P-type
ATPase to have its transmembrane (TM) segments defined experimentally was the Mg2+ ATPase of Salmonella
typhimurium (54). This membrane pump was shown to
contain 10 membrane-spanning helices, with the large cytoplasmic ATP
binding and phosphorylation loop being between H4 and H5. This
ATPase therefore resembles the eukaryotic alkali metal P-type pumps
which transport alkali cations as well as Mg2+ and
Ca2+, the latter also being relatively small cations
(21). The amino acid sequences of transition metal
ATPases exhibit a different hydrophobicity profile, with two
additional hydrophobic domains in the N-terminal region and four fewer
in the C-terminal region. The core structure of six TM helices is
likely to be similar (28). The first transition metal
ATPase investigated experimentally for the number and orientation
of TM segments was an H. pylori P-type pump
(31) most closely related to the Cd2+ ATPase
of Staphylococcus aureus, CadA, the latter previously being
thought to contain only six TM segments (52, 53). However, the H. pylori ATPase was shown to contain a
membrane domain of eight TM helices comprising the additional
N-terminal pair of membrane spans followed by the core structure of six
membrane spanning segments with only one pair of C-terminal TM segments (31).
Here we describe the isolation of the copAP operons of
H. pylori 69A and H. felis ATCC 49179. They both carry two genes, one encoding another member of the bacterial
transition metal ion ATPase family, CopA, and the other encoding a
putative cation binding regulatory peptide of 66 amino acid residues,
CopP. The small CopP peptide is homologous to CopZ, encoded by the
E. hirae cop operon (38). In a previous
study using a truncated variant of the ATPase cloned from
H. pylori UA802, it was claimed that the pump is a
Cu2+ export ATPase (13). In this study, the
function of the H. pylori 69A-derived ATPase was
analyzed by knockout mutagenesis of H. pylori copA, and
we also investigated the N-terminal ion binding properties of the
putative Cu2+ ATPase by ion affinity chromatography and
electrospray ionization mass spectrometry (ESI-MS). Compared to the
other P-type pump cloned from H. pylori 69A
(31), the DNA-derived amino acid sequence of the CopA P-type
pumps discussed here contains additional hydrophobic segments, and
therefore a topological analysis was performed on the H. pylori CopA ATPase. The results obtained by experimental identification of membrane-inserted segments and the homology analysis
of the CopA pumps cloned from the two related microorganisms, H. pylori and H. felis, allowed
detection of domains of high amino acid sequence identity that have
perhaps been conserved to transport copper across the cytoplasmic
membrane in these gastric bacteria.
 |
MATERIALS AND METHODS |
Bacterial strains.
E. coli HB101 containing the
H. pylori gene library was a gift of Rainer Haas
(Tübingen, Germany). Replication of random pRH948-derived DNA
fragments in vector pTZ18R for subsequent DNA sequencing was performed
in E. coli KK186, a gift from I. Rasched (Konstanz,
Germany). E. coli MM294, supplied by the American Type Culture Collection (ATCC 32625), was used for plasmid cloning experiments. E. coli XL1-Blue MRF' and SOLR, both
obtained from Stratagene, were used for amplification of H. felis genomic library in the Lambda ZAP II vector or in vivo
excision of pBluescript phagemids with H. felis
insertion DNA (pHF) from lambda vectors. H. pylori
strains were from the American Type Culture Collection (ATCC 49503) or
from Rainer Haas (clinical isolate 69A). H. felis was
supplied by the American Type Culture Collection (ATCC 49179).
Culture conditions.
E. coli cells were grown in
Luria-Bertani (LB) broth or agar plates supplemented with 50 µg of
tetracycline per ml or 10 µg of kanamycin per ml as required. For
experiments with the H. felis gene library, the
E. coli strains used were grown as recommended by the
supplier of the strains (Stratagene). H. pylori cells
were grown in brain heart infusion (Difco) medium (BHI) supplemented with 6% horse serum and 0.25% yeast extract (Difco) in a
CO2 incubator (10% CO2) at 37°C in 10-ml
cell culture flasks. Growth was monitored by determination of the
optical density at 578 nm of aliquots of the bacterial cultures at
various time points. H. felis cells were grown in
Columbia EH broth (Difco) supplemented with 6% horse serum in GasPak
jars under microaerophilic conditions (Anaerocult C; Merck) at 37°C
in a shaker incubator.
Selection of DNA oligonucleotide sequences for detection of
P-type ATPases.
All known P-type ATPases from eukaryotic
and bacterial cells contain a highly conserved DKTGT(I/L)T
phosphorylation consensus sequence (11, 43). This sequence
can be encoded by a pool of 2,304 different 20-base oligonucleotides
(main pool) covering all possible sequences of the first six amino
acids of the phosphorylation consensus sequence as well as the AC of
the threonine codon. This pool of oligonucleotides was divided into
five chemically synthesized oligonucleotide subpopulations (subpools
I-405 to I-409). The DNA nucleotide sequences of the synthesized
subpools consisted of GA(TC) AA(AG) AC(AGCT) GG(AGCT) AC(AGTC) with a
3' extension of AT(TC) AC (for I-405), AT(CA) AC (for I-406), TT(AG) AC
(for I-407), CT(TC) AC (for I-408), or CT(AG) AC (for I-409). The
variable nucleotides are in parentheses. The DNA primers (MWG Biotech, Ebersberg, Germany) were labeled by using a digoxigenin (DIG) 3'-end
labeling kit (Boehringer Mannheim). Each of the primers listed above
was employed for genomic Southern blot analysis (58). Subsequently, primer I-408 was selected for Southern blot screening of
the H. pylori 69A library in plasmid pRH160 and plaque
screening of membrane filters obtained from the H. felis gene library in the Lambda ZAP II phage. I-408 was also used
for initial DNA sequencing to verify that positive plasmids contained
the DKTGT(I/L)(T) target sequence.
Preparation of DNA.
Genomic DNA of H. pylori
or H. felis was prepared by standard protocols as
previously described (1, 48). Plasmid DNA was isolated by
anion-exchange chromatography (Qiagen).
Southern blot analysis of H. pylori genomic DNA
with various DNA oligonucleotides.
The DNA of H. pylori was digested with the HindIII DNA
endonuclease. The digested DNA was separated by agarose gel
electrophoresis, denatured, and blotted onto nylon membranes. Each of
the Southern membranes containing the restriction endonuclease-digested
H. pylori DNA was hybridized with one of the
DIG-labeled DNA oligonucleotide mixtures (I-405 to I-409) in accordance
with a Boehringer Mannheim protocol. Hybridization was performed for
>6 h in a solution containing 5× standard saline citrate (SSC) buffer
(Maniatis) (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 1×
blocking agent, 0.02% (wt/vol) sodium dodecyl sulfate (SDS), and 0.1%
(wt/vol) N-laurylsarcosine at 45°C. Hybridized blots were
washed in 5× SSC buffer-0.01% (wt/vol) SDS at 45°C. Positive
restriction fragments were detected by chemiluminescence (Boehringer
Mannheim).
H. pylori 69A gene library.
The DNA library
was constructed by Rainer Haas. It contains genomic DNA fragments of
H. pylori 69A. The DNA fragments generated by partial
Sau3A digestion were cloned into the BglII
restriction site of the plasmid pRH160, also referred to as the pMin1
vector (18). The library was replicated in E. coli HB101. DNA inserts of pRH160, on average 3 × 103 to 4 × 103 bp in length, could be
removed by digestion with EcoRI and XhoI. The
plasmid harbors a tetracycline resistance gene (tetR).
H. felis gene library.
The H. felis library was prepared by Stratagene. Genomic DNA isolated
from H. felis ATCC 49179 was sheared by pulling and pushing the DNA through a needle. DNA fragments obtained (5 to 10 kbp)
were blunt ended with Klenow fragment of DNA polymerase. DNA was
methylated by EcoRI methylase. Methylated DNA was cloned into the EcoRI cloning site of the Lambda ZAP II phage
vector (Stratagene), providing the ability to excise the pBluescript SK(
) phagemid by using the M13 helper phage (Stratagene). A total of
3.7 × 106 primary plaques containing insertional
H. felis DNA fragments, 5 to 10 kbp in length, were
obtained. The library was amplified to a final titer of 1.3 × 1010 plaques/ml in E. coli XL1-Blue MRF'.
Screening of gene libraries for detection of P-type ATPases.
(i) Southern blot screening and isolation of pRH vectors containing
putative P-type ATPase genes of H. pylori.
Since
the phosphorylation consensus target site selected for screening is
present in all known P-type pumps, the H. pylori gene
library was screened on isolated plasmid DNA mixtures to avoid
contaminating signals from the E. coli genome. For
preparation of distinct plasmid DNA mixtures, an aliquot of the
library, 1.4 × 103 CFU, was diluted in LB broth
medium supplemented with 50 µg of tetracycline per ml. The bacterial
clones were used for inoculation of 20 cultures for subsequent
mixed-plasmid preparations. Inoculated vials, each containing
approximately 70 different plasmids of the library, were incubated
overnight in a shaker incubator at 37°C. Mixed plasmid DNA was
purified by ion-exchange chromatography (Qiagen). In addition, glycerol
was added to an aliquot of each of the mixed bacterial suspensions,
which were then stored at
70°C. The isolated plasmid DNA mixtures
were subjected to digestion with restriction endonucleases
EcoRI and XhoI. DNA fragments were separated on
1% (wt/vol) agarose gels and blotted onto nylon membranes (58). The membranes containing restriction enzyme-digested
DNA of the mixed-plasmid preparations were hybridized with DIG-labeled DNA oligonucleotide I-408 according to the protocol of Boehringer Mannheim as described above for genomic Southern blot analysis. Positive plasmid mixtures were detected by chemiluminescence
(Boehringer Mannheim). Aliquots taken from corresponding glycerol
stocks were plated out on LB agar plates containing 50 µg of
tetracycline per ml, and 60 colonies were selected for preparation of
clonal plasmid DNA, using anion-exchange columns (Qiagen) for detection of the clones which had been hybridized in the mixed plasmid
preparation. Plasmid DNAs were analyzed for sequences homologous to
primer I-408 by another cycle of Southern blot analysis as described above. Three distinct positive DNA clones containing H. pylori 69A DNA insertions flanked by EcoRI and
XhoI restriction sites of the pRH160 cloning vector were
isolated, namely pRH514, pRH539, and pRH948. These plasmids were
subjected to a cycle of DNA sequencing for detection of the DNA target
sequence corresponding to the phosphorylation consensus sequence.
(ii) Plaque filter hybridization and in vivo excision of pHF
vectors containing putative P-type ATPase genes of H. felis.
The H. felis gene library was screened by
conventional plaque filter hybridization. Nylon membranes (Amersham)
containing phage DNA from 2 × 103 plaques were
prepared by standard protocols (48). DNA-containing membranes were hybridized with primer I-408 under the same conditions used for Southern blot screening of the H. pylori 69A
gene library. From positive Lambda ZAP II phage clones, 10 pBluescript
SK(
) plasmids (pHF1 to pHF10) containing the corresponding
H. felis DNA fragments were isolated from E. coli SOLR by in vivo excision using M13 helper phages in
accordance with the manufacturer's protocol (Stratagene). As described
for pRH vectors, detected pHF plasmids were subjected to a cycle of DNA
sequencing for detection of the phosphorylation consensus sequences
used as target sites for screening.
DNA sequencing.
DNA sequencing was performed at the
Gesellschaft für Analyse-Technik und Consulting GmbH (GATC;
Konstanz, Germany) using Sequenase 2.0 from Amersham. Biotin-labeled
primers were obtained from MWG-Biotech (Eberberg, Germany). Plasmid DNA
was subjected to a DNA sequencing protocol employing a GATC 1500 sequencing system for direct-blotting electrophoresis (47).
Electroblotted DNA products were UV cross-linked to the nylon membranes
at 254 nm for 2 min prior to colorimetric detection with streptavidin and alkaline phosphatase, as described in detail elsewhere
(41). The sequencing data were manually digitized using a
digitizer board connected to an Atari ST1040 personal computer and
GFA-Basic software. Assembly of sequences obtained from the pRH948
shotgun library was done on an Apple Macintosh with DNA-Star/SeqMan
software.
Determination of partial DNA sequences.
For determination of
partial DNA sequences of I-408-positive clones, a biotin-labeled primer
containing the I-408 primer sequence used for screening was
synthesized. Sequencing reactions were carried out on DNA isolated from
pRH or pHF vectors and were subjected to the direct blotting procedure.
pRH539 as well as 6 of the pHF vectors (pHF3, -4, -5, -7, -9, and -10)
did not give any results in the I-408-primed DNA sequencing reaction,
whereas the two clones pRH514 and pRH948 and 4 of the 10 pHF vectors
(pHF1, -2, -6, and -8) did. The DNA sequence information was used for
synthesis of biotin-labeled primers of reverse orientation, allowing
sequencing back through the phosphorylation consensus sequence. This
reverse sequencing verified that pRH514, pRH948, and the four pHF
vectors contained the phosphorylation consensus sequence. The partial sequences obtained by this procedure showed that pRH514 contained the
H. pylori P-type ATPase isolated previously in our
laboratory (31) whereas the target sequence of pRH948 was
flanked by novel DNA sequences. DNA sequences found for the four pHF
vectors, all containing the phosphorylation consensus sequences of
P-type ATPases, were identical. pRH948 and pHF8 were selected for
DNA sequencing of H. pylori or H. felis
DNA insertions.
DNA sequencing of the insertions of pRH948 and pHF8.
A
shotgun library was constructed from vector pRH948 or pHF8. We used a
fast nebulization method to generate random, sequence-independent DNA
fragments ranging from 0.5 to 1 kbp (41). Agarose
gel-purified DNA fragments were blunt-end repaired with the Klenow
fragment and T4 DNA polymerase (Boehringer Mannheim). The DNA was then ligated into the HindII site of plasmid pTZ18R and
amplified in E. coli KK186. Single-stranded template
DNA of several clones was prepared with M13KO7 helper phage. The
sequencing procedure, using 5'-biotin-labeled universal and reverse
sequencing primers for plasmid pTZ18R, was performed as described
above, using Sequenase 2.0.
PCR.
DNA amplification of pRH948 plasmid DNA and chromosomal
H. pylori DNA was performed. PCRs were carried out in a
Perkin-Elmer Cetus thermal cycler. For each reaction, 1 µg of
chromosomal DNA or 5 ng of plasmid DNA was mixed with 10 pg of primer
DNA in a standard reaction volume of 50 µl. Twenty-five cycles of 1 min at 94°C, 1 min at 40°C, and 1.5 min at 72°C followed by an
extension reaction at 72°C for 10 min were performed in the presence
of 1 U of VentR polymerase in VentR buffer (both from New England BioLabs). PCR products were analyzed by agarose gel electrophoresis for
determination of their molecular sizes. When necessary, PCR products
were purified by using PCR purification kits (Qiagen).
Gene disruption mutagenesis of H. pylori copA.
For gene disruption mutagenesis of the copA gene, a
BamHI-derived kanamycin resistance cassette from plasmid
pUC4K was inserted into the copA gene of pRH948. A 498-bp
DNA fragment of pRH948 corresponding to the N-terminal region spanning
the amino acid sequence from Met-135 to His-300 and a DNA fragment of
732 bp encoding the C-terminal 244 amino acid residues (Gly-497 to
His-741) of the Cop ion pump were amplified using primer pairs
I-480-I-499 and I-481-I-500, respectively. PCR was carried out with
the pairs of DNA primers given in brackets. The DNA sequences of the
first pair of primers were ACCGAGTTGAATTCATGCATTGGGGG
for I-480, including the ATG/Met-135 codon of cop and
a preceding EcoRI restriction site (underlined), and
GTCTACGGATCCGTGGCTATTGAATGT for I-499, containing a BamHI recognition site. The DNA sequences of
the second pair of primers, used for amplification of the C-terminal Gly-497-to-His-741 region, were
GTCTACGGATCCGGCATCAGCGCTAAAACAG, carrying a
BamHI restriction site, for I-500 and
CTGCAACTCAAGCTTATGATCCTTAATTTT for I-481,
including a HindIII restriction site. The PCR products were cut with EcoRI-BamHI or
BamHI-HindIII and cloned into
EcoRI- and HindIII-digested pUC19 in
E. coli MM294. The cloning product was opened by
digestion with BamHI, and the kanamycin gene cassette, isolated by BamHI digestion of pUC4K, was inserted by ligation into the
truncated cop gene of pUC19. Ligation of DNA fragments was
performed by standard procedures (48).
Plasmid DNA was transformed into bacterial strain E. coli MM294 for replication of the cloning product, vector PY-123.
Plasmid DNA of PY-123 containing the truncated copA gene
with the internal kanamycin resistance cassette, localized in the
direction of cop gene transcription as determined by
EcoRI-HindIII digestion, was used for
transformation of H. pylori ATCC 49503 cells.
Transformation of H. pylori by
electroporation.
Cells of H. pylori ATCC 49503 grown in BHI broth medium were washed twice at 4°C in 10% (vol/vol)
glycerol by centrifugation and resuspended in 10% (vol/vol) glycerol
at about 109/ml. PY-123 DNA (2.5 µg) was added to 200 µl of H. pylori cell suspension. The mixture, after
incubation on ice for 10 min, was transferred into a prechilled 0.2-cm
cuvette (Bio-Rad) and subjected to single-pulse electroporation in a
Bio-Rad Gene Pulser. Cells were transferred to BHI agar plates for a
24-h incubation under microaerophilic conditions at 37°C. The cells
were subsequently transferred to BHI agar plates containing 10 µg of
kanamycin sulfate per ml and incubated for 5 days as described above.
Transformants obtained were grown in 10 ml of BHI-yeast extract-horse
serum medium supplemented with 10 µg of kanamycin sulfate per ml.
Verification of copA knockout mutants of
H. pylori by PCR.
Genomic DNAs of H. pylori mutant and parental strains were prepared according to
standard methods (1, 48). These were subjected to PCR for
analysis of the copA region. The DNA primers used for
amplification were I-480 and I-481, as employed for construction of the
hybrid copA-kanR plasmid PY-123, spanning a 1.8-kbp sequence of the cop gene. PCR products were analyzed by agarose gel
electrophoresis and ethidium bromide staining.
Effect of metal ions on growth of H. pylori.
To
determine the MICs of various divalent cations for H. pylori wild-type strain ATCC 49503 or its
copA-deficient derivative, cells were incubated in BHI broth
medium in the absence or presence of various concentrations of
Cu2+, Zn2+, Co2+, Ni2+,
or Mg2+ as the Cl
salt. Growth of the
bacterial cultures was monitored by measurement of optical density (578 nm) at various time points. Concentrations employed were 50 µM, 100 µM, 250 µM, 500 µM, and 1 mM for all cations listed above except
for Mg2+. Additional concentrations used were 2.5, 7.5, 15, and 25 µM for CuCl2 and 2 mM, 4 mM, and 6 mM for
NiCl2. Concentrations used to determine MICs of
MgCl2 were 5, 25, 50, and 75 mM.
Synthesis of the N-terminal peptide of the H. pylori CopA ATPase (amino acid residues 1 to 52).
A
25-µmol quantity of the ATPase peptide from the N-terminal
methionine to leucine-52 was synthesized by solid-phase peptide synthesis with an Abimed EPS221 automated peptide synthesizer (Abimed,
Langenfeld, Germany), using the fluorenylmethoxycarbonyl (Fmoc)
protection strategy (6, 12, 32). The
N
-protected leucine residue was carboxy-terminally
linked by 4-hydroxymethylphenoxyacetic acid to a graft polymer of
polyethylene glycol onto a polystyrene support (3) (NovaSyn
TGA resin; Novabiochem, Bad Soden, Germany). Benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphonium
hexafluorophosphate (PyBOP) activator and
N
-protected amino acids were also purchased from
Novabiochem (7a). Reagents and solvents were obtained from
Aldrich (N-methylmorpholine), Merck (dimethylformamide), and
Fluka (piperidine, trifluoroacetic acid, and triethylsilane).
Chain elongation was performed for 51 cycles in accordance with an
operational cycle protocol that included Fmoc deprotection with 20%
piperidine in dimethylformamide (45, 61) for 5 min at
20°C. Deprotection was followed by coupling. The time was increased from 40 min at the initial cycle to 50 min at the end of the synthesis. Coupling was performed in the presence of a 5-molar excess of PyBOP-activated (17) and Fmoc-protected amino acid relative to the peptide. Fmoc deprotection was monitored with a UVIDEC-100II UV
spectrometer (Jasco, Gross-Umstadt, Germany). After final Fmoc deprotection, cleavage from the support and deprotection of side chains
was carried out in a single step by treatment with trifluoroacetic acid
for 2 h at 20°C, using a triethylsilane scavenger. The crude peptide was isolated by precipitation with t-butylmethyl
ether (Fluka) and semipreparative high-performance liquid
chromatography (Waters Bondapak C18 column) with a linear
gradient of water and acetonitrile. The high-performance liquid
chromatography-purified peptide was subjected to matrix-assisted laser
desorption mass spectrometry (20, 45) and showed an average
molecular mass of 5,851 Da, which was in good agreement with the
molecular mass of 5,850.7 Da calculated from the amino acid sequence.
Metal ion binding by the N-terminal peptide of a synthetic
ATPase.
Ni2+ affinity chromatography (Qiagen,
Hilden, Germany) was used to study the ability of the first N-terminal
52 amino acids of the ATPase peptide (P95-030) to bind metal ions.
To exchange the Ni2+ ions for other divalent cations, 1 ml
of Ni2+-agarose suspension (equivalent to 500 µl of gel
bed) was loaded onto a column (3-cm Econo; Bio-Rad), which was
subsequently washed with 2 ml of H2O followed by 5 ml of
100 mM ethylenediaminetetraacetic acid (EDTA) to remove the
Ni2+ ions and then equilibrated with 2 ml of
H2O. The binding of the ions to be tested to the agarose
matrix was carried out by incubating the agarose matrix with 2 ml of a
100 mM solution of either NiCl2, CuSO4,
CoCl2, ZnCl2, CdCl2, or
MgCl2. After transfer to a reaction tube, the beads were
washed two times with 2 ml of H2O and three times with
binding buffer, pH 7.8 (50 mM NaH2PO4, 0.3 M
NaCl; pH adjusted with 1 N NaOH). A 100-µg sample of peptide P95-030 dissolved in 150 µl of binding buffer was added to 50 µl of the respective metal ion affinity matrix containing Ni2+,
Cu2+, Co2+, Zn2+, Cd2+,
or Mg2+ in a 1.5-ml reaction tube, and the mixture was
incubated for 1 h at room temperature on a roller incubator. After
this binding step, the supernatant was removed, and 30 µl was dried
in a vacuum concentrator and resuspended in 40 µl of
SDS-Tricine-polyacrylamide gel electrophoresis (PAGE) sample buffer.
The matrix was washed once with 5 volumes of binding buffer and
transferred to a 1.5-ml Mobitec column tube. Bound peptide was eluted
with 3 ml of binding buffer adjusted to pH 4 with 1 N HCl and collected
in two fractions of 1 and 2 ml.
PAGE of ATPase peptide.
The peptide of 52 amino acids
(M1-L52) contained in the 1-ml fraction obtained by elution of the
affinity agarose column was precipitated with 20% trichloroacetic acid
and resuspended in 40 µl of SDS-Tricine gel sample buffer. The
precipitates were separated by SDS-PAGE on a 15% polyacrylamide gel
with Tricine buffer (49). The gels were stained with 0.025%
Serva Blue G in 10% acetic acid for 1 h and destained in 10%
acetic acid.
ESI-MS of the ATPase peptide.
ESI spectra of the
N-terminal peptide of the synthetic ATPase were recorded on a
Vestec 201 A single-quadrupole mass spectrometer (Vestec Corp.,
Houston, Tex.). The temperature of the ionization region was kept at
approximately 40°C, while the voltage between the collimator and
skimmer was maintained at 40 V during any measurement. Other
instrumental conditions were as described previously (44). Peptide solutions (50 µM) were prepared in 5 mM ammonium acetate in
water-methanol (9:1) at pH 4. A 10-molar excess of either
NiCl2 or CuCl2 was added to peptide solutions,
which were incubated for 30 min at 20°C and then immediately
subjected to ESI-MS analyses. Sample delivery to the electrospray
needle tip was performed with a Harvard-44 microinfusion pump (Harvard
Apparatus, South Natick, Mass.) through a fused-silica capillary tube
at a flow rate of 3 µl/min.
HK-M0 and HK-M1 vector construction and analysis.
Construction and function of the HK-M0 and HK-M1 cloning vectors have
been described in detail elsewhere (2, 31). Coupled transcription-translation of HK-M0 and HK-M1 vectors containing putative TM segments of membrane proteins have been employed for analyses of membrane topology of the gastric
H+/K+ ATPase (2), the
sarcoplasmic Ca2+ ATPase (4), and a member
of the bacterial transition ion P-type pumps cloned from H. pylori (31).
Hydropathy analysis was used for selection of putative
membrane-spanning segments of CopA with the algorithms of Rao and Argos
(
46), Eisenberg et al. (
9), and Klein et al.
(
22). Selected
regions were amplified by PCR using DNA
primers targeted to DNA
sequences encoding the first 6 (sense) or last
6 (antisense) amino
acids of possible TM segments. The primers were
synthesized with
5' extensions containing
BglII (sense
primers) or a
HindIII (antisense
primers) restriction
sites for in-frame cloning into HK-M0 or
HK-M1 vectors (Table
1). HK-M0 and HK-M1 plasmid constructs
were
used for synthesis of
35S-labeled fusion proteins by
coupled transcription-translation
with a reticulocyte lysate system
(Promega). Reactions were carried
out in the absence or presence of
canine microsomes according
to the manufacturer's protocol (Promega).
35S-labeled fusion protein products were separated on
SDS-10% polyacrylamide
gels (
24). The gels were then
dried, and radioactivity was detected
by using a phosphorimager and
Ambis software (Image Acquisition
and Analysis).
Materials.
Helper phage M13KO7 as well as plasmids pUC4k,
pUC19, and pTZ18R were from Pharmacia. M13 helper phage (ExAssist) was
from Stratagene. Restriction enzymes were from Boehringer Mannheim. Chemicals used were all of analytical grade or higher.
Nucleotide sequence accession numbers.
The nucleotide
sequences reported in this paper have been submitted to the GenBank and
EMBL databases under accession no. U59625 (H. pylori
sequence) and AJ001932 (H. felis sequence).
 |
RESULTS |
Genomic Southern blot analyses.
A DNA oligonucleotide mixture
of 16 distinct 20-mer DNA molecules out of the 2,304 possible sequences
encoding the DKTGT(I/L)T phosphorylation consensus sequence had been
used previously to isolate an H. pylori P-type
ATPase (31). In this study, five DNA oligonucleotide
mixtures covering all possible DNA sequences of the phosphorylation
target sequence, I-405 to I-409, were used for Southern blot analyses
of H. pylori chromosomal DNA. Each of the synthesized
DNA oligonucleotide mixtures, consisting of similar DNA sequences, was
hybridized to membranes containing HindIII-restricted
genomic DNA. In all cases, a pattern of up to five major hybridization
bands was found, indicating a high degree of similarity but nonidentity
(Fig. 1). This shows that even the
phosphorylation site-specific DNA oligonucleotides of extended
complexity are able to detect putative P-type ATPase DNA clones
derived from H. pylori DNA. Since primer I-408 detected all of the major bands, this primer was selected for use in screening of the H. pylori 69A gene library. The same primer was
used for screening of an H. felis gene library.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Fluorogram of a Southern blot of chromosomal
H. pylori 69A DNA hybridized with various DNA
oligonucleotides targeted to the phosphorylation signature sequences of
P-type ATPases. The membranes containing
HindIII-restricted DNA were hybridized with
DIG-labeled primers I-405 (lane 1), I-406 (lane 2), I-407 (lane 3),
I-408 (lane 4), and I-409 (lane 5), as described in Materials and
Methods. Positive restriction fragments were detected by
chemiluminescence. Molecular sizes are given in kilobase pairs.
|
|
Isolation of Helicobacter copAP operons.
Since
E. coli DNA was also positive with each of the five DNA
oligonucleotide probes (data not shown), the H. pylori
69A library was screened by subjecting mixed-plasmid preparations to
Southern blot hybridization instead of the conventional colony filter
hybridization technique. Using probe I-408, plasmid pRH948 as well as
two additional DNA clones, pRH514 and pRH539, were isolated from the
H. pylori genomic DNA library present in pRH160 in
E. coli HB101. The lengths of the inserted
H. pylori DNA sequences of the plasmids were determined by restriction analysis to be within the range of 3 to 5 kbp (data not
shown).
DNA sequencing revealed that pRH948 contained a novel P-type ATPase
gene, whereas the DNA sequence of pRH514 showed identity
with the ion
pump isolated previously (
31), and pRH539 was not
susceptible to the DNA sequencing procedure using primer I-408.
Hence,
vector pRH948 was selected for sequencing of the complete
H. pylori DNA fragment by the direct blotting procedure as described
in Materials and Methods.
Primer I-408 was also used to screen an
H. felis gene
library cloned in the

ZAP II vector. Screening led to the
isolation
of 10 positive clones, pHF1 to pHF10. Partial sequencing
showed
that four of the clones isolated (pHF1, -2, -6, and -8)
were identical,
containing DNA sequences encoding a P-type
ATPase. pHF8 was selected
for DNA sequencing.
DNA sequence analysis of Helicobacter copAP operons and
flanking DNA.
DNA sequencing showed that the H. pylori DNA sequence in pRH948 was 4,472 bp in length. About 2.3 kbp of the pRH948 3' DNA sequence overlaps with a previously published
sequence predicted to contain the copAP
operon of H. pylori UA802 (13).
Since this published sequence encodes a membrane pump lacking an
N-terminal ion binding domain as well as the first pair of TM segments,
it was assumed that this earlier-cloned version of the H. pylori CopA ion pump was N-terminally truncated (31).
The DNA sequence inserted in pRH948 contained an additional 2.2 kbp of
the nucleotide sequence region upstream of the DNA reported previously
(13) before enclosing the N-terminal sequences not present
in the first version of CopA. The missing sequences of the
H. pylori UA802-encoded version of the CopA ion pump
have been published recently (14). Sequence identity between
the H. pylori 69A-derived DNA and the corresponding DNA
region of H. pylori UA802 was found to be about 94%.
The copAP locus, with a degree of DNA sequence identity
similar to that of the former operons, is also present in H. pylori 26695 (60).
The sequence of the pRH948 DNA strand spanning the distance between the
EcoRI cloning site and the
XhoI recognition site
of
the vector backbone was found to predict five open reading frames
(ORFs), whereas no ORF of any significant length was found on
the
reverse strand. The two ORFs located at the terminal regions
of the
inserted DNA fragment, ORF1 and ORF5, were interrupted
by the cloning
sites and therefore were incomplete. ORF1 encoding
an N-terminally
truncated version of the
H. pylori FtsH protein,
is
also present upstream of the
copAP operon in
H. pylori UA802
(
15). The next coding region (ORF2), which
was separated from
the preceding
ftsH sequence by a putative
transcriptional termination
signal, predicted a protein of 237 amino
acids. An N-terminal
overlap of 173 amino acid residues of this amino
acid sequence
showed the closest identity to the phosphatidylserine
synthase
of
Bacillus subtilis, a protein of 177 amino acids
(
40). ORF2
was followed by the largest ORF of pRH948, ORF3,
which contains
the P-type ATPase target sequence used for
screening. The P-type
gene of ORF3 (
copA) is immediately
followed by a small ORF4 encoding
a peptide of 66 amino acids (CopP).
The 3'-localized ORF of pRH948
(ORF5) is interrupted by vector
sequences immediately downstream.
The predicted N-terminal peptide of
27 amino acids, which is not
identical to the gene product predicted by
the corresponding region
in
H. pylori UA802
(
13), is of unknown homology. In Fig.
2,
a structural map of the pRH948
insertional DNA is given, showing
the organization of the
H. pylori copAP operon and of the ORFs
flanking the operon. Putative
transcription termination sequences
are present in the DNA sequence
downstream of the truncated
ftsH region and also downstream
of
copP, separating ORF4 and ORF5.
An AGGA Shine-Dalgarno
consensus sequence is located 7 bases upstream
of the
copP
gene, whereas
copA, in the corresponding region, contained
a
DNA sequence with little similarity to the Shine-Dalgarno consensus
motif (data not shown).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2.
Organization of the copAP operons and
flanking DNA cloned from H. pylori and H. felis. The figure shows the ORFs contained in plasmids pRH948
(H. pylori) and pHF8 (H. felis). The
ORFs detected by translation of the DNA in the three possible frames
(frames 1 to 3) are indicated by arrows. The ftsH gene and
ORF5 of pRH948 are truncated (open arrows), as is ORF6 in pHF8. The
locations of putative transcriptional termination sequences are
indicated by open circles. Terminal EcoRI (pHF8) and
XhoI-EcoRI (pRH948) restriction sites of plasmid
insertional DNA as well as a unique DraIII site present in
the DNA insertion of pRH948 are also displayed.
|
|
DNA sequencing of the
H. felis 5,909 kbp insertion of
pHF8 showed that this related organism also contained a
cop
operon consisting
of genes encoding a P-type ATPase (CopA) and a
small peptide with
possible transition metal ion binding properties
(CopP). Whereas
the ORFs of
copA and
copP in
H. pylori are separated by 3 nucleotides,
the ATG start
codon of
copP in
H. felis is located in
another
frame within the 3' coding region of the
copA gene.
The DNA preceding
the
CopAP region in pHF8 contained three
additional ORFs. The
amino acid sequence of ORF1 displayed some
similarity to ribosomal
protein L11 methyltransferases of bacteria
(data not shown). This
ORF was followed by a gene encoding a protein of
638 amino acids
with more than 90% sequence identity to the
H. pylori FtsH protein
(
15). The
ftsH locus is also contained in the corresponding
region of
H. pylori 69A, as described above. ORF3, downstream
of
the
H. felis ftsH gene in pHF8 (214 amino acids), shows
similarity
to phosphatidylserine synthases in the first N-terminal 160 amino
acids, as was found for ORF2 of the corresponding chromosomal
H. pylori 69A DNA. ORF3 of pHF8 is followed by the
copAP locus
(ORF4 and ORF5 of pHF8). The 3'-localized ORF of
the
H. felis DNA fragment contained in pHF8 (ORF6) was
truncated and is of
unknown homology. The organization of the genes
found on pHF8
DNA, including the
copAP operon, is also
depicted in Fig.
2.
Comparison of the DNA sequences contained in pRH948 and pHF8 shows that
the sequence identity is about 55 to 70% within the
region spanning
the
copAP operon and the ORF preceding the operon
(ORF2) of
pRH948 and ORF3 of pHF8). The degree of DNA sequence
identity in the
overlapping regions of the
ftsH loci was found
to be
significantly higher (>90% [data not shown]). The results
also show
that the genes immediately preceding the
copAP locus
are the
same in
H. felis and
H. pylori 69A as
well as in
H. pylori 26695 and UA802 (
13-15,
60). The sequence data are in the EMBL
and GenBank nucleotide
sequence data libraries under accession
no.
U49625 (pRH948) and
AJ001932 (pHF8).
Properties of CopP amino acid sequences.
The copP
gene products of H. pylori 69A and H. felis both consist of 66 amino acids and have about 60% identity
(Fig. 3). They both contain a CXXC-type
transition metal binding motif, suggesting that this protein may act as
a transition metal binding protein. This protein was also predicted
from the copAP loci of H. pylori UA802 and
H. pylori 26695 (13, 60). The CopP peptides of H. pylori and H. felis were found to
exhibit homology with other ion binding proteins, such as the
periplasmic mercury binding protein MerP of Serratia
marcescens, MerP of Shigella flexneri, and especially
the CopZ protein of Enterococcus hirae (33, 35, 38). Figure 3 displays a sequence alignment of enterococcal CopZ
(38), CopP from H. felis (this study), and
the CopP amino acid sequence variants cloned from H. pylori 69A (this study) and other H. pylori
strains (13, 60). They all contain a CXXC motif in amino
acid positions 12 to 15.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the amino acid sequences of CopZ from
Enterococcus hirae and the CopP peptides from
Helicobacter pylori (Hp) strains and Helicobacter
felis (Hf). The CopP sequences of 66 amino acid residues encoded
by plasmids pRH948 (H. pylori 69A) (this study) and
pBHpC8 (H. pylori UA802) (13) or detected by
H. pylori genome sequencing (H. pylori
26695) (60) have an overall identity of >95%. The CopP
peptide predicted from the small ORF of the copAP DNA
fragment of H. felis, also consisting of 66 amino
acids, showed a lower degree of identity with the H. pylori peptides (about 60%), but a stretch of 10 identical amino
acids is observed just after the CXXC motif. The degree of amino acid
sequence identity of CopP peptides and E. hirae CopZ
(69 amino acid residues) is still between 40 and 50%.
|
|
Properties of CopA amino acid sequences.
The
P-type pumps predicted by the Helicobacter cop operons
were 741 (CopA, H. pylori) or 732 (CopA, H. felis) amino acids in length, as shown in Fig.
4. The encoded proteins both contain a
DKTGTLT phosphorylation signature sequence and a GDGVND ATP binding
motif, as found in other P-type ion pumps (11, 43). There
are also consensus sequences characteristic of transition metal P-type
ATPases, such as an N-terminal GMXCXXC sequence motif and a CPC box
in the membrane domain (52, 57). The amino acid sequence of
the H. pylori 69A CopA protein exhibited 95% identity with the CopA protein products cloned from H. pylori
26695 (60) and H. pylori UA802, the latter
containing a CPS motif instead of the CPC found in the H. pylori 69A and 26695 CopA sequences (13).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of the CopA amino acid sequences of
H. pylori (HP) and H. felis (HF). The
CopA amino acid sequences are 741 (HP) or 732 (HF) amino acid residues
in length. The overall level of sequence identity between the two pumps
is about 55%. TM segments of H. pylori CopA,
determined experimentally in this study, are boxed and lightly shaded
(TM1 to TM8). Also in boxes are the putative membrane-spanning segments
of the H. felis pump. More darkly highlighted are
conserved sequence boxes: the putative N-terminal
Gly-Met-Thr-Cys-Thr/Ser-Ala-Cys metal ion binding motif, the
membrane-associated Cys-Pro-Cys sequence, the
Asp-Lys-Thr-Gly-Thr-Leu-Thr phosphorylation sequence, and a
Gly-Asp-Gly-Leu/Val-Asn-Asp-Ala-Pro motif for ATP binding.
|
|
Of the proteins currently available in the database, the
H. pylori 69A and
H. felis CopA exhibited the highest
degree of sequence
homology of the proteins currently available in the
database,
to another ATPase of
H. pylori cloned in
our laboratory (
31)
and to the various bacterial and
eukaryotic Cu
2+ and Cd
2+ ATPases. Prominent
members of this family are CopA and CopB of
Enterococcus
hirae (
39,
55); the Cd
2+ ATPase of
Staphylococcus aureus; CadA (
37), a putative
Synechococcus Cu
2+ ATPase (
19);
and the human Menkes and Wilson gene products
(
5,
62). From
the degree of amino acid sequence similarity
and the occurrence of both
GMXCXXC and CPC motifs, it was concluded
that the cloned pump is a
member of the transition metal ion pump
family, recently also referred
to as CPX-type ATPases (
57).
Function of the CopA ATPase.
The function of the cloned
CopA ATPase was determined by gene disruption mutagenesis of the
ATPase gene contained in pRH948 and subsequent generation of
H. pylori copA knockout mutants by homologous
recombination, as described in Materials and Methods. This methodology
is not yet available for H. felis. The wild-type strain
subjected to copA mutagenesis was H. pylori
ATCC 49503. In the mutant obtained, the copA ATPase gene
lacked an entire segment of the pump, from amino acid 301 to 496, which
was exchanged for a kanamycin resistance cassette, resulting in a
kanamycin resistance phenotype in the recipients of the PY-123
construct. Neither the growth kinetics of the ATPase-deficient
mutants nor their urease activities were different from that of the
parental strain, H. pylori ATCC 49503, showing that
this pump is not necessary for growth in vitro (data not shown).
However, the enzyme might still be essential for survival in the
stomach.
The mutant was susceptible to the same concentrations of
Ni
2+, Zn
2+, Co
2+, and
Mg
2+ as the wild-type strain but had a different
susceptibility to
Cu
2+. The wild-type strain had a
Cu
2+ MIC of 50 µM, whereas the mutant had a
Cu
2+ MIC of 7.5 µM, suggesting that the ATPase can
function as a Cu
2+ export pump (Table
2). A corresponding change in copper
sensitivity
was obtained when the pRH948-encoded CPC-type ATPase
was inactivated
in the genome of
H. pylori 69A by
transposon shuttle mutagenesis
(data not shown). Since a change in
Cu
2+ sensitivity was also found in
H. pylori UA802
copA knockout mutants
(
13), it
is evident that both of the natural CopA sequence variants,
the
CPC-type pump predicted by pRH948 and the CPS-containing sequence
predicted from the
copA gene cloned from
H. pylori UA802, are
able to export Cu
2+.
Metal binding characteristics of the N-terminal region of the
ATPase.
When the synthetic peptide representing the 52 N-terminal amino acids of H. pylori CopA containing the
GMXCXXC ion binding motif was adsorbed to affinity agarose equilibrated
with Ni2+, Co2+, Cd2+,
Mg2+, Zn2+, or Cu2+, the peptide
displayed binding mainly to Cu2+. A very weak binding
reaction was observed with Zn2+. These data are shown in
Fig. 5.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 5.
Ion binding affinity of a synthetic ATPase peptide
(P95-030) as determined by metal ion affinity chromatography. A
100-µg portion of peptide P95-030 was bound to a divalent-cation
column as described in Materials and Methods. Bound peptide was eluted
and separated by SDS-PAGE, using 15% acrylamide and Tricine buffer
under nonreducing conditions, and stained with Serva Blue G. Lane 1, 5 µg of peptide P95-030 (control); lanes 3 to 8, peptide eluted from
the matrix after binding to divalent ions and contained in 1 ml of the
3-ml elution volume. The column matrix was equilibrated with
CuCl2 (lane 3), NiCl2 (lane 4),
CoCl2 (lane 5), CdCl2 (lane 6),
MgCl2 (lane 7), or ZnCl2 (lane 8). The peptide
was able to form dimers, presumably due to the formation of
intermolecular Cys-Cys bonds (lanes 1, 3, and 8).
|
|
The spectra obtained by subjecting the N-terminal ATPase peptide to
ESI-MS are depicted in Fig.
6. ESI-MS
detected the three,
four, and fivefold positively charged ions of the
peptide. The
peptide was preincubated with CuCl
2 or
NiCl
2. When preincubated
in the presence of
CuCl
2, adducts of the peptide carrying up to
three copper
atoms were observed, as demonstrated in Fig.
6B.
Copper ion binding of
the peptide is in agreement with the data
obtained by ion affinity
chromatography. The data show that the
peptide was able to bind up to a
threefold molar excess of copper
ions. While the occurrence of copper
adducts was significant,
preincubation of the peptide with
NiCl
2 led to detection of faint
peaks with
m/z
increments of the magnitude expected for peptides
binding one or two
nickel atoms (Fig.
6C). The weak binding of
the peptide to
Zn
2+ observed in ion affinity chromatography was also
detected by
ESI-MS (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Electrospray mass spectra of synthetic ATPase
peptide (amino acids 1 to 52) in the absence and presence of
Cu2+ and Ni2+. (A) ESI spectra of unmodified
Cop ATPase peptide. Three, four, and fivefold positively charged
ions of the peptide were detected. (B) After preincubation with
CuCl2, 4.5-fold positively charged adducts of copper with
the peptide were observed. (C) When the peptide was preincubated with
NiCl2, complexes of the peptide with nickel seemed to be
detectable also, as indicated by the very faint peaks immediately
following the [M + 4H]4+ signal. Binding to
Ni2+, therefore, was much less significant than binding to
Cu2+ (C). M, peptide molecule; H, proton; m, mass; z,
charge of molecule.
|
|
Analysis of membrane topology.
The Kyte-Doolittle hydropathy
profiles (23) of the encoded CopA ion pump versions of
H. pylori and H. felis predict several membrane spanning sequences (Fig. 7) and
are very similar to those of the other transition metal P-type
ATPases, particularly the various Cu2+ and
Cd2+ ion pumps (5, 13, 14, 19, 36-39, 51, 52,
55-57) and the pRH439-encoded H. pylori P-type
ATPase. The membrane domain of the latter ATPase was shown by
in vitro translation to contain eight TM spanning sequences
(31).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 7.
Kyte-Doolittle hydropathy profiles of H. pylori (A) and H. felis (B) CopA ATPases. (A)
The putative TM segments determined by in vitro translation, H1 through
H8, are highlighted. Also marked are hydrophobic regions HX and HY,
which do not have membrane insertion activity. The localization of the
conserved phosphorylation sequence is also shown (P site). (B) The
membrane spanning segments of the H. felis pump are
highlighted based on similarity to the CopA P-type ATPase sequence
of H. pylori. As found for the H. pylori pump, the P site is between H6 and H7 in the CopA
ATPase of H. felis.
|
|
Putative TM sequences of the pRH948-predicted
H. pylori
CopA pump were selected by various hydropathy-based algorithms and
by
their sequence homology to hydrophobic segments found in the
H. felis CopA ATPase (Table
1 and Fig.
7).
PCR-amplified copies
of these segments of
H. pylori
CopA were assayed by coupled in
vitro transcription-translation of the
HK-M0-HK-M1 fusion proteins
to determine their ability to membrane
insert during translation.
The N-terminal parts of the fusion proteins
encoded by those vectors
consist of either the first 101 (M0) or the
first 139 (M1) amino
acids of the

subunit of the gastric proton
pump followed by
the putative TM domain of the CopA ATPase. The
C-terminal parts
of the HK-M0-HK-M1 fusion proteins contain the 177 terminal amino
acids of the

subunit of the gastric
H
+/K
+ ATPase carrying five putative
glycosylation sites. The presence
of glycosylation due to signal anchor
properties was evidenced
by the increase in the
Mr of the product when the HK-M0 vector
with
insert was translated in the presence of microsomal membranes.
In turn,
the presence of an insert encoding a stop transfer sequence
was shown
by inhibition of glycosylation of the HK-M1 fusion vector
in the
presence of microsomal membranes.
The first two hydrophobic regions, H1 (amino acid positions 84 to 104 [Fig.
8, lanes 1 to 4]) and H2 (amino
acid positions
118 to 139 [Fig.
8, lanes 5 to 8]), were both signal
anchor and
stop transfer sequences. This should be the first pair of
sequences
in the TM domain of this ATPase (Table
1). The signal
anchor
activity of H2 is weaker; this could be explained by a reverse
orientation in the vector compared to its natural folding.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 8.
Autoradiograph of an SDS-PAGE gel with products of in
vitro transcription-translation, in the absence and presence of
microsomes (Mic), of the HK-M0 and HK-M1 vectors containing the first
hydrophobic domain (lanes 1 to 4) and the second hydrophobic domain
(lanes 5 to 8) of the H. pylori CopA ATPase.
|
|
Sequences H3 (amino acid positions 159 to 180 [Fig.
9, lanes 1 to 4]) and H4 (amino acid
positions 183 to 205 [Fig.
9, lanes
5 to 8]) are also both signal
anchor and stop transfer sequences,
indicating that H3 and H4 comprise
the second pair of TM segments.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 9.
Autoradiograph of an SDS-PAGE gel with products of in
vitro transcription-translation, in the absence and presence of
microsomes (Mic), of the HK-M0 and HK-M1 vectors containing the third
hydrophobic domain (lanes 1 to 4) and the fourth hydrophobic domain
(lanes 5 to 8) of the H. pylori CopA ATPase.
|
|
The next hydrophobic region following H4 in the
H. pylori CopA ATPase is a sequence that has been named HX (amino
acid positions
241 to 261 [Fig.
10,
lanes 1 to 4]). Two segments of this region
were translated in the
vectors HK-M0 and HK-M1. Neither signal
anchor nor stop transfer
activity was found (Table
1). These
results suggest that this region is
not membrane inserted.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 10.
Autoradiograph of an SDS-PAGE gel with products of in
vitro transcription-translation, in the absence and presence of
microsomes (Mic), of the HK-M0 and HK-M1 vectors containing the HX
hydrophobic domain (lanes 1 to 4), the fifth hydrophobic domain (lanes
5 to 8), and the sixth hydrophobic domain (lanes 9 to 12) of the
H. pylori CopA ATPase.
|
|
The putative TM region H5 (amino acid positions 340 to 363 [Fig.
10,
lanes 5 to 8]) promoted a strong glycosylated band in
the HK-M0
vector, similar to the one obtained with the HK-M1 vector
control, and
also performed as a stop transfer sequence in HK-M1.
Six overlapping
segments coding for the putative TM domain H6
(between amino acids 368 and 400 [Table
1]) were inserted in
both HK-M0 and HK-M1. Most of
them were able to promote partial
glycosylation of the H/K ATPase

-subunit-derived sequences in
the HK-M0 vector, as did the segment
comprising amino acid positions
368 to 394 (Fig.
10, lanes 9 and 10).
All of them prevented the
glycosylation of the

-subunit sequences in
the HK-M1 vector,
therefore acting as a stop transfer sequence, which
is the membrane
insertion activity expected for this hydrophobic
segment in the
topological model (Fig.
10, lanes 11 and 12). These
results suggest
that H5 and H6 form the third pair of antiparallel
helices of
the CopA membrane domain.
The C-terminal region contains three main hydrophobic regions, HY, H7,
and H8, which were expressed in the HK-M0 and HK-M1
vectors (Table
1).
The results of the translation showed that
the region HY (amino acid
positions 629 to 646) could not act
as a signal anchor sequence. When
this region was translated in
the HK-M1 vector, partial inhibition of
glycosylation was observed.
Data are shown in Fig.
11, lanes 1 to 4. The hydrophobic
segment
H7 (amino acid positions 679 to 703), which was expected to act
as a signal anchor, was only a stop transfer sequence (Table
1;
Fig.
11, lanes 5 to 8). However, when the H7 segment is extended
upstream,
therefore including the HY region (amino acid positions
629 to 703),
translation in the HK-M0 vector showed a glycosylated
product (Fig.
12, lane 2), indicating that the
sequence preceding
the 684-to-703 segment is important for the membrane
insertion
of H7 as a signal anchor sequence. The putative TM domain H8
(amino
acid positions 708 to 728) acts as a stop transfer sequence, as
expected from the eight-segment model of transition ion pumps
(
31) (Table
1; Fig.
11, lanes 9 to 12). The addition of the
H8 coding region to the HY-H7 fragment suppressed the glycosylated
HK-M0-CopA ATPase (amino acid positions 629 to 728) fusion product
when expressed in the HK-M0 vector (Fig.
12, lane 4). Hence, the
HY
region helps to direct the membrane insertion of H7, and the
hydrophobic H8 sequence returns the C terminus to the cytoplasmic
side.
Thus, H7 and H8 constitute the fourth TM segment pair of
this
ATPase.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 11.
Autoradiograph of an SDS-PAGE gel with products of in
vitro transcription-translation, in the absence and presence of
microsomes (Mic), of the HK-M0 and HK-M1 vectors containing hydrophobic
regions HY (lanes 1 to 4), H7 (lanes 5 to 8), and H8 (lanes 9 to 12) of
the H. pylori CopA ATPase.
|
|

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 12.
Autoradiograph of an SDS-PAGE gel with products of in
vitro transcription-translation, in the absence and presence of
microsomes (Mic), of the HK-M0 vector containing regions encompassing
HY to H7 (lanes 1 and 2) and HY to H8 (lanes 3 and 4) of the
H. pylori CopA ATPase.
|
|
Transmembrane segments of the CopA ATPase of H. felis and regions of high-level sequence homology.
The
corresponding TM segments of the H. felis ATPase
were determined by hydrophobicity analysis and by their sequence
similarity to the H. pylori ATPase. The data
suggested that the H1 to H8 TM helices of the H. felis
pump are contained between positions L89 and L108 (H1), F119 and G136
(H2), L156 and T177 (H3), G184 and G200 (H4), V337 and L357 (H5), A465
and M483 (H6), N666 and A685 (H7), and I690 and L710 (H8) (Fig. 2). The
locations as well as the orientations of TM segments found in the
H. felis pump are predicted to be identical to those of
its H. pylori counterparts.
The overall identity of the amino acid sequences of the
H. felis and
H. pylori CopA ATPases was about
55%; considerable differences
in degrees of identity were found when
the corresponding TM segments
were compared. The identities found were
about 50% for H1 and
H2, 65% for H3, 85% for H4, 70% for H5, 90%
for H6 and H7, and
about 75% for H8 (Fig.
2). Thus, the three
N-terminal helices,
H1, H2, and H3, have reduced identity while
segments H4 to H8
exhibit greater amino acid identity, suggesting a
role for the
C-terminal TM segments in ion transport. There are other
regions
of high-level identity (>80%), namely in the N-terminal
segment
of ion binding around the GMXXCXXC motif, the small cytoplasmic
loop between H2 and H3, some sequences following H4, the sequences
around the conserved phosphorylation and ATP binding motifs, and
sequences preceding the last putative pair of TM helices.
 |
DISCUSSION |
A DNA oligonucleotide mixture encoding the DKTGT(I/L)T
phosphorylation consensus sequence had been used previously to isolate a putative transition metal P-type ATPase of H. pylori (31). Using a similar phosphorylation site
screening strategy, we have isolated the copAP operons from
gene libraries of H. pylori 69A and a related gastric
microorganism, H. felis (ATCC 49179). Cloning of the
copAP operons, therefore, provided evidence for the
coexistence of at least two of the bacterial single-subunit P-type
pumps in gastric Helicobacter species, the CopA ATPase
and the pRH439-predicted pump (31). A third member of this
class of membrane ATPases was observed in the genome of
H. pylori 26695 (60).
The cop operons of both H. pylori and
H. felis consist of only two genes, which encode a
P-type pump, CopA, and a small peptide, CopP, with putative ion binding
properties. Data obtained by insertion-deletion mutagenesis of the
pRH948 P-type gene in H. pylori ATCC 49503 show that
CopA may act as a copper export pump, as has been shown in
H. pylori UA802 by using a sequence variant of the
H. pylori copA gene (13) and in
Enterococcus hirae for the CopB ATPase (38, 39,
56).
The predicted protein products of DNA sequences preceding the cloned
copA gene are not homologous to proteins involved in ion transport or regulation of transport ATPase expression. In contrast, the copP gene immediately downstream of (in
H. pylori) or overlapping with (in H. felis) copA DNA sequences predicts a protein homologous
to the CopZ protein of the Enterococcus hirae Cu2+ ATPase operon (38). This suggests a
role for the CopP peptide in regulation of H. pylori
CopA ATPase expression rather than as a source of Cu2+
for the ATPase, as was suggested in a previous study
(13). The presence of a CopZ-homologous protein in the
Helicobacter copAP operon might also suggest that there are
similarities in regulation of cop gene expression in the
gastric microorganisms and Enterococcus hirae. On the other
hand, in H. pylori and H. felis,
copP is located downstream of a unique CopA
ATPase-encoding gene, and the cloned copAP operons lack
the equivalent of copY present in the enterococcal
copYZAB operon, which is postulated to be a repressor of
cop operon transcription (38). Given that the
pRH948- and pHF8-predicted pumps analyzed here represent
Cu2+ export ATPases, the Helicobacter
operons also lack the physiological equivalent of the
Enterococcus hirae copper import ATPase (38, 39,
55). However, there are additional genes contributing to
transport of transition metal cations elsewhere in the genome of
H. pylori, for example, the NixA Ni2+
transport protein (34, 60).
The ATPases predicted from the copAP operon, 741 (H. pylori CopA) and 732 (H. felis
CopA) amino acids in length, exhibit a strong overall sequence
similarity to the previously studied 75-kDa membrane ATPase of
H. pylori (31) and to the Cd2+
and Cu2+ P-type pumps of bacteria as well as mammalian
cells (5, 36-39, 52, 57, 62). As demonstrated for most of
the members of this family of ion pumps, the cloned CopA ATPases
have an N-terminal GMXCXXC ion binding motif (Cys box) and an
intramembrane CPC sequence consistent with a role for this enzyme in
transition metal transport (51, 52, 57). The GMXCXXC motif
is a variant of a consensus sequence in the other putative transition
metal ATPase isolated from H. pylori
(31). The latter pump contains an N-terminal HXHXXXCXXC ion
binding motif with affinity for Ni2+ ions, indicating, as
does the presence of clusters of cysteine and histidine residues
in the ATP binding and phosphorylation loop of the latter enzyme
(31), that the two CopA P-type ATPases expressed
in Helicobacter species and the membrane pump described previously have different ion specificities (31, 61).
Besides the data obtained by H. pylori copA gene
knockout mutagenesis, evidence of a possible role for CopP in
Cu2+-dependent gene regulation, and the
homologies of the copA gene-predicted enzymes
to the various Cd2+ and Cu2+ ATPases, there
is additional preliminary evidence of a role for the cloned
Helicobacter CopA pumps in binding as well as transport of
copper ions. As shown in the data presented above, Cu2+,
but not Co2+, Cd2+, or Mg2+, was
significantly bound by the N-terminal peptide of the H. pylori 69A CopA ATPase predicted by vector pRH948. The
selectivity of the peptide toward copper is most probably due to the
presence of the GMXCXXC ion binding motif, as shown very recently for
N-terminal domains of the human Wilson's and Menkes Cu2+
transport ATPases (29). Weak binding of the
H. pylori CopA peptide to Ni2+ and
Zn2+ is probably not important for the physiology of
H. pylori, since the CopA-deficient microorganism
showed unchanged and high levels of resistance to both Ni2+
and Zn2+ (Table 2). The latter might be due to the
existence of other proteins involved in metal ion resistance of
H. pylori (31, 60). The N-terminal copper
selectivity, as demonstrated for the H. pylori
ATPase peptide, is in agreement with the increased sensitivity of
H. pylori copA knockout mutants to Cu2+.
The N-terminal region around the GMXCXXC box has a high degree of amino
acid identity to various putative Cop ATPases, and a stretch of 22 amino acids in this region shows an identity of 91% when the CopA
pumps of H. felis and H. pylori are
compared, underlining a significant role of this domain in pump
function. However, whether the N-terminal ion binding properties of
P-type pumps contribute to the regulation of enzyme activity or to the transport of the ion itself is as yet unknown (28).
Structural features of these transition metal pumps must relate to
their function as copper transport enzymes. Since the membrane domain
contains the copper transport pathway, this domain was defined by in
vitro translation scanning using membrane insertion detection vectors.
In a previous study, this method was able, unequivocally, to detect
eight membrane segments, H1 through H8, ordered pairwise along the
polypeptide chain of the pRH439-predicted H. pylori
ATPase, placing the ATP binding and phosphorylation loop between H6
and H7 (31). The latter ATPase, with the highest degree
of homology to Cd2+ P-type pumps and binding affinity to
Ni2+ (31, 61), is most probably a resistance
pump transporting transition metals such as Cd2+ and
Zn2+ (30a). A comparison of the hydrophobicity
plots of the Cu2+ ATPases and the
Ni2+-binding ATPase (31) showed generally
similar profiles but two additional hydrophobic peaks in the
H. pylori CopA ion pump, designated as HX and HY. In
this study, the data obtained by in vitro translation showed that the
H. pylori CopA ATPase contains three pairs of membrane-spanning helices (H1 to H6) in the N-terminal half of the
enzyme and a fourth pair of antiparallel helices (H7 and H8) in the
C-terminal region. To our knowledge, these results present the first
experimental evidence that the membrane domain of Cu2+
P-type ATPases consists of eight TM segments. The additional hydrophobic peaks in the cloned H. pylori CopA
ATPase, compared to the pRH439-encoded ATPase (31),
did not act as signal anchors, and only the HY segment led to partial
inhibition of glycosylation when translated in the HK-M1 vector.
The H. felis CopA pump contains the corresponding H1 to
H8 segments, as determined by hydropathy analysis and sequence
similarity, but not the HX segment. The absence of this hydrophobic
segment in the H. felis CopA ATPase is consistent
with the finding that the HX segment of the corresponding H. pylori ATPase did not exhibit any membrane insertion
properties. The HY segment was important for the membrane insertion
properties of H7 in the H. pylori CopA ATPase and
is retained in the H. felis CopA version. As in the
other H. pylori P-type pump analyzed previously (31), H6 is followed by the large cytoplasmic energy
transduction loop containing the phosphorylation site. On the basis of
membrane topology, the cloned Helicobacter Cu2+
pumps, therefore, fall into a group of P-type ATPases containing eight TM segments.
The availability of CopA pumps from two distinct gastric
Helicobacter species, H. pylori and
H. felis, allowed a prediction of sequences related to
the transport pathway for copper ions across the cytoplasmic membrane.
Cysteine residues may play a role in ion transport, as found for the
two cysteine residues located in the first TM region of the
E. coli MerT mercuric ion transporter (35).
In CopA, cysteines are thought to participate in Cu2+
binding sites and therefore may be involved in the transport of the ion
through the membrane. A feature of these Helicobacter Cu2+ pumps is that they contain seven (for H. felis) or eight (for H. pylori) cysteine residues.
Five of these cysteines are located at conserved positions in TM
helices. These cysteines are in H4, in H6 as part of the conserved CPC
motif, and in H7. When the Enterococcus hirae CopAB pumps
(37) and the cloned Cu2+ pumps of H. pylori and H. felis are compared, only the
cysteine residue in the CPX motif of H6 is conserved among the
transition metal pumps, bringing into question the role of the other
conserved cysteine residues present in the membrane domain of both the
H. pylori and H. felis CopA pumps.
However, the TM segments H7 and H8, as well as H4, H5, H6, and in part
H3, are well conserved between the two ATPases. Along with the
placement of the homologous cysteines, this conservation could be taken
as preliminary evidence that TM segments H4 to H8 constitute the core
structure of the ion transport domains of these ATPases. The first
two TM sequences show less homology to each other and to the other
P-type ATPases of H. pylori (31, 60).
Therefore, H1 and H2 of the cloned CopA pumps, which represent the two
additional N-terminal TM segments found in all transition metal
ATPases, and perhaps H3 may be situated peripherally to this core
structure, interacting mainly with phospholipid, which would account
for their relative lack of conservation.
In conclusion, H. pylori and H. felis
employ conserved mechanisms of copper resistance. These mechanisms
include expression of a bicistronic copAP operon encoding a
transition metal pump containing eight TM helices, CopA, and the
peptide CopP, the latter most probably being a Cu2+
binding protein involved in copAP operon expression. The
CopA ATPase, which provides the structural and functional
basis for P-type Cu2+ export in Helicobacter
species, uses conserved motifs such as the N-terminal domain with
Cu2+ binding properties and conserved regions in the energy
transduction domain. The CopA membrane domain shows the highest level
of sequence identity in H4, H5, H6, and H7-H8 as well as in stretches
of H3, suggesting that these six segments of the CopA ATPase may
provide the TM pathway for copper ions across the H. pylori and H. felis inner membranes.
 |
ACKNOWLEDGMENTS |
We thank Anita Buhmann, Marion Eisenhauer, and Marina Rektorschek
for excellent technical assistance.
This work was supported in part by the Bundesministerium für
Forschung und Technologie (BMFT grant 514 4003 0310777) and in part by
U.S. Veterans Administration research funds (SMI) and National
Institutes of Health grants DK40615, DK41301, and DK17294.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Byk Gulden
Pharmaceutical, Byk Gulden Str. 2, 78462 Konstanz, Germany. Phone: 49 7531 843376. Fax: 49 7531 843360. E-mail: melchers{at}byk.de.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1994.
.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Bamberg, K., and G. Sachs.
1994.
Topological analysis of the H,K-ATPase using in vitro translation.
J. Biol. Chem.
269:16909-16919[Abstract/Free Full Text].
|
| 3.
|
Bayer, E., and W. Rapp.
1986.
New polymer supports for solid-liquid-phase peptide synthesis.
Chem. Pept. Proteins
3:3-8.
|
| 4.
|
Bayle, D.,
D. Weeks, and G. Sachs.
1995.
The membrane topology of the rat sarcoplasmic and endoplasmic reticulum calcium ATPases by in vitro translation scanning.
J. Biol. Chem.
270:25678-25684[Abstract/Free Full Text].
|
| 5.
|
Bull, P. C.,
G. R. Thomas,
J. M. Rommens,
J. R. Forbes, and D. W. Cox.
1993.
The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene.
Nat. Genet.
5:327-336[Medline].
|
| 6.
|
Chang, C. D., and J. Meierhofer.
1978.
Solid-phase peptide synthesis using mild base cleavage of Na-fluorenylmethyloxycarbonylamino acids, examplified by a synthesis of dihydrosomatostatin.
Int. J. Pept. Protein Res.
11:246-249[Medline].
|
| 7.
|
Clarke, D. M.,
T. W. Loo, and D. H. MacLennan.
1990.
The epitope for monoclonal antibody A20 (amino acids 870-890) is located on the luminal surface of the Ca-ATPase of sarcoplasmic reticulum.
J. Biol. Chem.
265:17405-17408[Abstract/Free Full Text].
|
| 7a.
|
Coste, J.,
D. Le-Nguyen, and B. Castro.
1990.
PyBOP: a new peptide coupling reagent devoid of toxic by-product.
Tetrahedron Lett.
31:205-208.
|
| 8.
|
Cover, T. L., and M. J. Blazer.
1995.
Helicobacter pylori: a bacterial cause of gastritis, peptic ulcer disease, and gastric cancer.
ASM News
61:21-26.
|
| 9.
|
Eisenberg, D.,
E. Schwarz,
M. Komaromy, and R. J. Wall.
1984.
Analysis of membrane and surface protein sequences with the hydrophobic moment plot.
J. Mol. Biol.
179:125-142[Medline].
|
| 10.
|
Epstein, W.
1985.
The Kdp system: a bacterial K+ transport ATPase.
Curr. Top. Membr. Transp.
25:153-175.
|
| 11.
|
Epstein, W.
1990.
Bacterial transport ATPases, p. 87-110. In
A. Krulwich (ed.), Bacterial energetics, vol. 12.
Academic Press Inc., San Diego, Calif.
|
| 12.
|
Fields, G. B., and R. L. Noble.
1990.
Solid phase peptide synthesis utilizing 9-fluorenyl methoxy carbonyl amino acids.
Int. J. Pept. Protein Res.
35:161-214[Medline].
|
| 13.
|
Ge, Z.,
K. Hiratsuka, and D. E. Taylor.
1995.
Nucleotide sequence and mutational analysis indicate that two Helicobacter pylori genes encode a P-type ATPase and a cation-binding protein associated with copper transport.
Mol. Microbiol.
15:97-106[Medline].
|
| 14.
|
Ge, Z., and D. E. Taylor.
1996.
Helicobacter pylori genes hpcopA and hpcopP constitute a cop operon involved in copper export.
FEMS Microbiol. Lett.
145:181-188[Medline].
|
| 15.
|
Ge, Z., and D. E. Taylor.
1996.
Sequencing, expression, and genetic characterization of the Helicobacter pylori ftsH gene encoding a protein homologous to members of a novel ATPase family.
J. Bacteriol.
178:6151-6157[Abstract/Free Full Text].
|
| 16.
|
Graham, D. Y., and M. F. Go.
1993.
Helicobacter pylori: current status.
Gastroenterology
105:279-282[Medline].
|
| 17.
|
Hudson, D.
1988.
Methodological implications of simultaneous solid phase peptide synthesis. 1. Comparison of different coupling procedures.
J. Org. Chem.
53:617-624.
|
| 18.
|
Kahrs, A. F.,
S. Odenbreit,
W. Schmitt,
D. Heuermann,
F. T. Meyer, and R. Haas.
1995.
An improved TnMax mini-transposon system suitable for sequencing, shuttle mutagenesis and gene fusions.
Gene
167:53-57[Medline].
|
| 19.
|
Kanamaru, K.,
S. Kashiwagi, and T. Mizuno.
1994.
A copper-transporting P type ATPase found in the thylakoid membrane of cyanobacterium Synechococcus species PCC7942.
Mol. Microbiol.
13:369-377[Medline].
|
| 20.
|
Karas, M., and F. Hillenkamp.
1988.
Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons.
Anal. Chem.
60:2299-2301[Medline].
|
| 21.
|
Karlish, S. J. D.,
R. Goldshleger, and P. L. Jorgensen.
1993.
Location of asn831 of the chain of Na/K-ATPase at the cytoplasmic surface. Implication for topological models.
J. Biol. Chem.
268:3471-3478[Abstract/Free Full Text].
|
| 22.
|
Klein, P.,
M. Kanehisa, and C. DeLisi.
1985.
The detection and classification of membrane-spanning proteins.
Biochim. Biophys. Acta
815:468-476[Medline].
|
| 23.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[Medline].
|
| 24.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 25.
|
Laimins, L. A.,
D. B. Rhoads,
K. Altendorf, and W. Epstein.
1978.
Identification of the structural proteins of an ATP-driven potassium transport system in Escherichia coli.
Proc. Natl. Acad. Sci. USA
75:3216-3219[Abstract/Free Full Text].
|
| 26.
|
Laimins, L. A.,
D. B. Rhoads, and W. Epstein.
1981.
Osmotic control of kdp operon expression in E. coli.
Proc. Natl. Acad. Sci. USA
78:464-468[Abstract/Free Full Text].
|
| 27.
|
Lee, A.,
J. Fox, and S. Hazell.
1993.
Pathogenicity of Helicobacter pylori: a perspective.
Infect. Immun.
61:1601-1610[Free Full Text].
|
| 28.
|
Lutsenko, S., and J. H. Kaplan.
1995.
Organization of P-type ATPases: significance of structural diversity.
Biochemistry
34:15607-15613[Medline].
|
| 29.
|
Lutsenko, S.,
K. Petrukhin,
M. J. Cooper,
C. T. Gillian, and J. H. Kaplan.
1997.
N-terminal domains of human copper-transporting adenosine triphosphatase (the Wilson's and Menkes disease proteins) bind copper selectively in vivo and in vitro with stoichiometry of one copper per metal-binding repeat.
J. Biol. Chem.
272:18939-18944[Abstract/Free Full Text].
|
| 30.
| Malfertheiner, P., and G. Bode. 1993. Helicobacter pylori and the pathogenesis of duodenal ulcer
disease. Eur. J. Gastroenterol. 5(Suppl.
1):S1-S83.
|
| 30a.
| Melchers, K., et al. Unpublished data.
|
| 31.
|
Melchers, K.,
T. Weitzenegger,
A. Buhmann,
W. Steinhilber,
G. Sachs, and K. P. Schäfer.
1996.
Cloning and membrane topology of a P type ATPase from Helicobacter pylori.
J. Biol. Chem.
271:446-457[Abstract/Free Full Text].
|
| 32.
|
Merrifield, R. B.
1963.
Solid phase peptide synthesis. I. The synthesis of a tetrapeptide.
J. Am. Chem. Soc.
85:2149-2154.
|
| 33.
|
Misra, T. K.,
N. L. Brown,
D. C. Fritzinger,
R. D. Pridmore,
W. M. Barnes,
L. Haberstroh, and S. Silver.
1984.
Mercuric ion resistance operons of plasmid R100 and transposon Tn501: the beginning of the operon including the regulatory region and the first two structural genes.
Proc. Natl. Acad. Sci. USA
81:5974-5978.
|
| 34.
|
Mobley, H. L. T.,
R. M. Garner, and P. Bauerfeind.
1995.
Helicobacter pylori nickel-transport gene nixA: synthesis of catalytically active urease in Escherichia coli independent of growth conditions.
Mol. Microbiol.
16:97-109[Medline].
|
| 35.
|
Morby, A. P.,
J. L. Hobman, and N. L. Brown.
1995.
The role of cysteine residues in the transport of mercuric ions by the Tn501 MerT and MerP mercury-resistance proteins.
Mol. Microbiol.
17:25-35[Medline].
|
| 36.
|
Nies, D. H., and S. Silver.
1995.
Ion efflux systems involved in bacterial metal resistance.
J. Ind. Microbiol.
14:186-199[Medline].
|
| 37.
|
Nucifora, G.,
L. Chu,
T. K. Misra, and S. Silver.
1989.
Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium-efflux ATPase.
Proc. Natl. Acad. Sci. USA
86:3544-3548[Abstract/Free Full Text].
|
| 38.
|
Odermatt, A., and M. Solioz.
1995.
Two trans-acting metalloregulatory proteins controlling expression of the copper ATPases of Enterococcus hirae.
J. Biol. Chem.
270:4349-4354[Abstract/Free Full Text].
|
| 39.
|
Odermatt, A.,
H. Suter,
R. Krapf, and M. Solioz.
1993.
Primary structure of two P-type ATPases involved in copper homeostasis in Enterococcus hirae.
J. Biol. Chem.
268:12775-12779[Abstract/Free Full Text].
|
| 40.
|
Okada, M.,
H. Matsuzaki,
I. Shibuya, and K. Matsumoto.
1994.
Cloning, sequencing, and expression in Escherichia coli of the Bacillus subtilis gene for phosphatidylserine synthase.
J. Bacteriol.
176:7456-7461[Abstract/Free Full Text].
|
| 41.
|
Okupodu, C. M.,
D. Robertson,
W. F. Boss,
R. K. Togasaki, and S. J. Surzycki.
1994.
Rapid isolation of nuclei from carrot suspension culture cells using a BioNebulizer.
BioTechniques
16:154-159.
[Medline] |
| 42.
|
Paster, B. J.,
A. Lee,
J. G. Fox,
F. E. Dewhirst,
L. A. Tordoff,
G. J. Fraser,
J. L. O'Rourke,
N. S. Taylor, and R. Ferrero.
1991.
Phylogeny of Helicobacter felis sp. nov., Helicobacter mustelae, and related bacteria.
Int. J. Syst. Bacteriol.
41:31-38[Abstract/Free Full Text].
|
| 43.
|
Pedersen, P. L., and E. Carafoli.
1987.
Ion motive ATPases. I. Ubiquity, properties, and significance to cell function.
Trends Biochem. Sci.
12:146-150.
|
| 44.
|
Polarek, J. W.,
G. Williams, and W. Epstein.
1992.
The products of the kdpDE operon are required for expression of the Kdp ATPase of Escherichia coli.
J. Bacteriol.
174:2145-2151[Abstract/Free Full Text].
|
| 45.
|
Przybylski, M., and M. O. Glocker.
1996.
Electrospray mass spectrometry of biomacromolecular complexes with noncovalent interactions new analytical perspectives for supramolecular chemistry and molecular recognition process.
Angew. Chem. Int. Ed. Engl.
35:806-826.
|
| 46.
|
Rao, M. J. K., and P. Argos.
1986.
A conformational preference parameter to predict helices in integral membrane proteins.
Biochim. Biophys. Acta
869:197-214[Medline].
|
| 47.
|
Richterich, P.,
C. Heller,
H. Wurst, and F. M. Pohl.
1989.
DNA sequencing with direct blotting electrophoresis and colorimetric detection.
BioTechniques
7:52-59.
[Medline] |
| 48.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 49.
|
Schägger, H., and G. Jagow.
1987.
Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa.
Anal. Biochem.
166:368-379[Medline].
|
| 50.
|
Shull, G. E.,
A. Schwartz, and J. B. Lingrel.
1985.
Molecular cloning of the rat stomach (H+ + K+)-ATPase.
Nature
316:691-695[Medline].
|
| 51.
|
Silver, S.,
G. Nucifora,
L. Chu, and T. K. Misra.
1989.
Bacterial resistance ATPases: primary pumps for exporting toxic cations and anions.
Trends Biochem. Sci.
14:76-80[Medline].
|
| 52.
|
Silver, S., and L. T. Phung.
1996.
Bacterial heavy metal resistance: new surprises.
Annu. Rev. Microbiol.
50:753-789[Medline].
|
| 53.
|
Silver, S., and M. Walderhaug.
1992.
Gene regulation of plasmid- and chromosome-determined inorganic ion transport in bacteria.
Microbiol. Rev.
56:195-228[Abstract/Free Full Text].
|
| 54.
|
Smith, D. L.,
T. Tao, and M. E. Maguire.
1993.
Membrane topology of a P-type ATPase. The MgtB magnesium transport protein of Salmonella typhimurium.
J. Biol. Chem.
268:22469-22479[Abstract/Free Full Text].
|
| 55.
|
Solioz, M.,
S. Mathews, and P. Fürst.
1987.
Cloning of the K+ ATPase of Streptococcus faecalis.
J. Biol. Chem.
262:7358-7362[Abstract/Free Full Text].
|
| 56.
|
Solioz, M., and A. Odermatt.
1995.
Copper and silver transport by CopB-ATPase in membrane vesicles of Enterococcus hirae.
J. Biol. Chem.
270:9217-9221[Abstract/Free Full Text].
|
| 57.
|
Solioz, M., and C. Vulpe.
1996.
CPX-type ATPases: a class of P-type ATPases that pump heavy metals.
Trends Biochem. Sci.
247:237-241.
|
| 58.
|
Southern, E.
1975.
Detection of specific DNA sequences among DNA fragments separated by gel electrophoresis.
J. Mol. Biol.
98:503-517[Medline].
|
| 59.
|
Sugiura, A.,
K. Hirokawa,
K. Nakashima, and T. Mizuno.
1994.
Signal-sensing mechanisms of the putative osmosensor KdpD in Escherichia coli.
Mol. Microbiol.
14:929-938[Medline].
|
| 60.
|
Tomb, J. F.,
O. White,
A. R. Kerlavage,
R. A. Clayton,
G. G. Sutton,
R. D. Fleischmann,
K. A. Ketchum,
H. P. Klenk,
S. Gill,
B. A. Dougherty,
K. Nelson,
J. Quackenbush,
L. Zhou,
E. F. Kirkness,
S. Peterson,
B. Loftus,
D. Richardson,
R. Dodson,
H. G. Khalak,
A. Glodek,
K. McKenney,
L. M. Fitzegerald,
N. Lee,
M. D. Adams,
E. K. Hickey,
D. E. Berg,
J. D. Gocayne,
T. R. Utterback,
J. D. Peterson,
J. M. Kelley,
M. D. Cotton,
J. M. Weidman,
C. Fujii,
C. Bowman,
L. Watthey,
E. Wallin,
W. S. Hayes,
M. Borodovsky,
P. D. Karp,
H. O. Smith,
C. M. Fraser, and J. C. Venter.
1997.
The complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature
388:539-547[Medline].
|
| 61.
| Volz, J., F. U. Bosch, M. Wunderlin, M. Schuhmacher, K. Melchers, K. Bensch, W. Steinhilber, K. P. Schäfer, G. Toth, B. Penke, and M. Przybylski.
Characterization of metal binding polypeptide domains by electrospray
ionization mass spectrometry and metal chelate affinity chromatography.
J. Chromatogr., in press.
|
| 62.
|
Vulpe, C.,
B. Levinson,
S. Whitney,
S. Packman, and J. Gitschier.
1993.
Isolation of a candidate gene for Menkes disease and evidence that it encodes a copper transporting ATPase.
Nat. Genet.
3:7-13[Medline].
|
| 63.
|
Walderhaug, M. O.,
J. W. Polarek,
P. Voelkner,
J. M. Daniel,
J. E. Hesse,
K. Altendorf, and W. Epstein.
1992.
KdpD and KdpE, proteins that control expression of the kdpABC operon, are members of the two-component sensor-effector class of regulators.
J. Bacteriol.
174:2152-2159[Abstract/Free Full Text].
|
| 64.
|
Warren, J. R., and B. Marshall.
1983.
Unidentified curved bacilli on gastric epithelium in active chronic gastritis.
Lancet
i:1273-1275.
|
J Bacteriol, January 1998, p. 317-329, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hall, S. J., Hitchcock, A., Butler, C. S., Kelly, D. J.
(2008). A Multicopper Oxidase (Cj1516) and a CopA Homologue (Cj1161) Are Major Components of the Copper Homeostasis System of Campylobacter jejuni. J. Bacteriol.
190: 8075-8085
[Abstract]
[Full Text]
-
Azevedo, N. F., Almeida, C., Cerqueira, L., Dias, S., Keevil, C. W., Vieira, M. J.
(2007). Coccoid Form of Helicobacter pylori as a Morphological Manifestation of Cell Adaptation to the Environment. Appl. Environ. Microbiol.
73: 3423-3427
[Abstract]
[Full Text]
-
Kusters, J. G., van Vliet, A. H. M., Kuipers, E. J.
(2006). Pathogenesis of Helicobacter pylori Infection. Clin. Microbiol. Rev.
19: 449-490
[Abstract]
[Full Text]
-
Coombs, J. M., Barkay, T.
(2005). New Findings on Evolution of Metal Homeostasis Genes: Evidence from Comparative Genome Analysis of Bacteria and Archaea. Appl. Environ. Microbiol.
71: 7083-7091
[Abstract]
[Full Text]
-
Waidner, B., Melchers, K., Ivanov, I., Loferer, H., Bensch, K. W., Kist, M., Bereswill, S.
(2002). Identification by RNA Profiling and Mutational Analysis of the Novel Copper Resistance Determinants CrdA (HP1326), CrdB (HP1327), and CzcB (HP1328) in Helicobacter pylori. J. Bacteriol.
184: 6700-6708
[Abstract]
[Full Text]
-
Adaikkalam, V., Swarup, S.
(2002). Molecular characterization of an operon, cueAR, encoding a putative P1-type ATPase and a MerR-type regulatory protein involved in copper homeostasis in Pseudomonas putida. Microbiology
148: 2857-2867
[Abstract]
[Full Text]
-
Vats, N., Lee, S. F.
(2001). Characterization of a copper-transport operon, copYAZ, from Streptococcus mutans. Microbiology
147: 653-662
[Abstract]
[Full Text]
-
Solnick, J. V., Schauer, D. B.
(2001). Emergence of Diverse Helicobacter Species in the Pathogenesis of Gastric and Enterohepatic Diseases. Clin. Microbiol. Rev.
14: 59-97
[Abstract]
[Full Text]
-
Roh, J. H., Kaplan, S.
(2000). Genetic and Phenotypic Analyses of the rdx Locus of Rhodobacter sphaeroides 2.4.1. J. Bacteriol.
182: 3475-3481
[Abstract]
[Full Text]
-
Weissman, Z., Berdicevsky, I., Cavari, B.-Z., Kornitzer, D.
(2000). The high copper tolerance of Candida albicans is mediated by a P-type ATPase. Proc. Natl. Acad. Sci. USA
97: 3520-3525
[Abstract]
[Full Text]
-
Gatti, D., Mitra, B., Rosen, B. P.
(2000). Escherichia coli Soft Metal Ion-translocating ATPases. J. Biol. Chem.
275: 34009-34012
[Full Text]