This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borghese, R.
Right arrow Articles by Melandri, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borghese, R.
Right arrow Articles by Melandri, B. A.

 Previous Article  |  Next Article 

J Bacteriol, January 1998, p. 416-421, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

The ATP Synthase atpHAGDC (F1) Operon from Rhodobacter capsulatus

Roberto Borghese, Massimo Crimi,dagger Luca Fava, and Bruno Andrea Melandri*

Laboratory of Biochemistry and Biophysics, Department of Biology, University of Bologna, 40126 Bologna, Italy

Received 2 September 1997/Accepted 6 November 1997

    ABSTRACT
Top
Abstract
Text
References

The atpHAGDC operon of Rhodobacter capsulatus, containing the five genes coding for the F1 sector of the ATP synthase, has been cloned and sequenced. The promoter region has been defined by primer extension analysis. It was not possible to obtain viable cells carrying atp deletions in the R. capsulatus chromosome, indicating that genes coding for ATP synthase are essential, at least under the growth conditions tested. We were able to circumvent this problem by combining gene transfer agent transduction with conjugation. This method represents an easy way to construct strains carrying mutations in indispensable genes.

    TEXT
Top
Abstract
Text
References

ATP synthase is a multisubunit enzyme that catalyzes the respiratory or photosynthetic synthesis of ATP coupled to the exoergonic flux of protons across the inner membrane of mitochondria, the thylakoid membranes of chloroplasts, or the plasma membrane of bacteria. The enzyme can also promote the active translocation of protons driven by ATP hydrolysis (8, 9, 25). The ATP synthase consists of two parts, an extrinsic sector (F1) formed by five different subunits (alpha , beta , gamma , delta , and varepsilon ) with a stoichiometry of alpha 3beta 3gamma delta varepsilon and connected through a thin stalk to the second part, an intrinsic membrane sector (F0) formed by a minimum of three proteins (a, b, and c) with a stoichiometry of ab2c8-12. In photosynthetic membranes, F0 is consistently formed by four different subunits in all cases studied to date (7, 11, 28), the fourth subunit, b', being a duplication of b. The extrinsic F1 sector contains three sites in which the synthesis or hydrolysis of ATP is catalyzed and three noncatalytic nucleotide binding sites, whose role is still not understood. The catalytic reaction is coupled to the transmembrane proton flow through the F0 sector presumably by means of long-range conformational changes propagated along the stalk structure. A rotational catalytic mechanism has been proposed; according to this mechanism, the interaction of the single-copy subunits confers, cyclically in time, different affinities for ATP, ADP, and phosphate to the catalytic site in each alpha beta pair (reviewed in reference 2). This model has received decisive support from the atomic structure of F1 from bovine heart mitochondria, recently resolved at 2.8 Å by X-ray crystallography (1). The rotational catalytic model is also in agreement with recent functional experiments with isolated F1 (5, 21, 22).

The gene structure of the ATP synthases has been studied for a great number of organisms. For the enzymes from photosynthetic organisms, sequences have been elucidated, for at least some subunits of F1, for about 16 higher plants and 6 algae. Of 23 complete sequences of genes coding for eubacterial F0F1 ATPase found in the databases, 16 show a unique atp operon with the F0 genes preceding the genes for F1. The seven remaining species, all photosynthetic, have the atp genes split into two operons (three in Synechococcus sp. strain 6716 [28]). The cyanobacteria Synechococcus sp. strain 6301 (4), Anabaena strain PCC 7120 (18), and Synechocystis strain PCC 6803 (14) and probably the green sulfur bacterium Chlorobium limicola (34) possess one operon comprising the F0 genes together with the first three F1 genes and a second operon with the genes for F1 beta  and varepsilon  subunits. In the Rhodospirillaceae family members Rhodospirillum rubrum (6, 7) and, probably, Rhodopseudomonas blastica, for which only the F1 sequence is known (27), the structural genes of F0 and F1 are organized into two separate operons. Surprisingly, the gene organization and sequences for the ATP synthase of the two species of Rhodospirillaceae most intensively studied from biochemical and genetic standpoints (i.e., Rhodobacter sphaeroides and Rhodobacter capsulatus) are still unknown.

In this paper, we present the complete gene sequence of the F1 operon (atpHAGDC) of Rhodobacter capsulatus B100. We also describe a procedure that makes possible the introduction of chromosomal deletions in essential genes followed by complementation with a new copy of the same genes. This method will allow us to perform easy site-directed mutagenesis studies on Rhodobacter capsulatus F0F1 ATPase.

Cloning and sequence analysis of the atpHAGDC operon. The probe to be used for library screening was made by amplification of a portion of the gene coding for the alpha  subunit (atpA). The primers used for PCR (5' GACCGTCAGACCGGCAAGACCGC 3' and 5' AGTCTACAGCGACGACGACGCGG 3') were designed based on the sequence of the close relative Rhodospirillum rubrum and chosen in highly conserved regions in the middle of the alpha  subunit. The screening of 550 colonies gave six positive clones, one of which was chosen for further study. The sequencing of 8 kb carrying the atp operon was completed by use of the dideoxynucleotide chain termination method (23).

The genes coding for the five subunits of the ATPase F1 component were identified by their homology to corresponding atp genes from both prokaryotes and eukaryotes. The order of the genes in the operon is atpHAGDC, corresponding to subunits delta , alpha , gamma , beta , and varepsilon , respectively. In Rhodobacter capsulatus, no genes coding for F0 were found upstream of the atpHAGDC operon, like the situation found in Rhodopseudomonas blastica and Rhodospirillum rubrum (6, 27). This organization seems to be unique to the Rhodospirillaceae.

All of the reading frames corresponding to the atp genes are preceded by a canonical Shine-Dalgarno sequence. The first codon is ATG in four genes, atpA, -G, -D, and -C, but is a GTG in the first gene of the operon, atpH. Interestingly, the same feature, specific for the delta  subunit, has been found in the close relatives Rhodospirillum rubrum and Rhodopseudomonas blastica (6, 27) but not in any other prokaryote checked; in these other prokaryotes, atpH begins with a more typical ATG.

The transcription initiation site was determined by primer extension (3). The 5' end of the message was mapped at an adenine residue, 108 nucleotides upstream of the GTG start codon of the delta  subunit (Fig. 1A). A possible promoter sequence was recognized around the -10 and -35 regions. Similar elements have been found in Rhodobacter capsulatus in a number of other operons, particularly operons involved in bacteriochlorophyll and carotenoid biosynthesis, in which identification of the putative promoter elements has been substantiated by mutagenesis analysis (15). In particular, the TTG stretch in the -35 element is completely conserved (Fig. 1B).


View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Determination of transcription initiation. The sequencing ladder, to the left of the lane containing the primer extension product, shows the actual sequence of the template strand; for the sake of clarity, however, the letters at the top of the lanes have been changed to correspond to the sense strand, and the sequence should be read from top to bottom. The corresponding sequence, on the right, should also be read from top to bottom, as indicated by the arrow. The boldface A corresponds to the 5' end of the mRNA. (B) For the promoter region, the sequence includes 40 bases upstream of the start of transcription, which is marked by +1. The -10 and -35 elements are identified by their distance from the +1 position. For the terminator, the TGA at the 5' of the sequence corresponds to the stop codon of the last gene of the operon (atpC).

A terminator sequence is clearly recognizable 23 bp downstream of the atpC stop codon (Fig. 1B). This sequence shows the characteristics of a typical rho-independent terminator, including a stem-loop structure, a GC-rich region at the base of the stem, and a stretch of five T's at the end of the structure.

The amino acid sequence derived from the gene structure is confirmed by the amino-terminal sequence of the peptides published by Gabellini et al. (10). The latter study has indicated, however, that all amino-terminal N-formylmethionines have been removed in the mature peptides. This holds also for the terminal amino acid of the delta  subunit corresponding to the code of valine (probably also an N-formylmethionine). With this fact taken into account, the relative molecular weights of the five subunits should be 54,670, 50,097, 31,076, 18,760, and 13,357 for alpha , beta , gamma , delta , and varepsilon , respectively, corresponding to an overall molecular mass of 377,494 Da.

Four other open reading frames (ORFs) were found upstream and downstream of the atpHAGDC sequence (see Fig. 3A). All of these ORFs have a high degree of sequence similarity with ORFs found around the atp operon of the other photosynthetic bacterium, Rhodopseudomonas blastica (27). The overall organization is identical in the two species, except that Rhodopseudomonas blastica has two extra ORFs. One, ORF5, is found immediately upstream of atpH and is apparently transcribed in the opposite direction; the second, ORF6, is placed between atpG and atpD. Rhodobacter capsulatus ORF1, which we have sequenced for only 443 bases, corresponds to ORF2 in Rhodopseudomonas blastica with 89% identity. ORF1 also has 50% sequence identity with Escherichia coli clpA. Rhodobacter capsulatus ORF2, ORF3, and ORF4 correspond to Rhodopseudomonas blastica ORF3, ORF4, and ORF7 with identities of 56, 65, and 62%, respectively. Apparently there is no correspondence with sequences upstream of the atpHAGDC operon of Rhodospirillum rubrum, the other closely related photosynthetic bacterium (6).

We show in Fig. 2 the sequence alignments of beta , gamma , and varepsilon  subunits from Rhodobacter capsulatus, E. coli (30), and bovine mitochondria (29), together with structural information, where available. The amino acid sequences of the alpha  and beta  subunits confirm that they are the most conserved ones in the whole ATP synthase complex. The identities with sequences of other photosynthetic bacteria are striking (79 and 89% with Rhodospirillum rubrum and Rhodopseudomonas blastica beta  subunits, respectively; 74 and 86% with Rhodospirillum rubrum and Rhodopseudomonas blastica alpha  subunits, respectively (6, 27); the sequence homology with nonphotosynthetic eubacterial ATP synthases is also very extensive (e.g., 69 and 55% identities with E. coli beta  and alpha  subunits, respectively) (30). The homology is also quite strong with the ATP synthase from eukaryotic organisms (78 and 68% identities with beta  and alpha  subunits, respectively, in bovine mitochondria) (29). In Fig. 2A, the alignment of beta subunit sequences indicates that identity is particularly marked in several key sectors, including the catalytic site (1), where all the amino acid residues are entirely conserved in the three sequences. Subunit gamma , only partially resolved by X-ray crystallography of bovine heart mitochondria F1 (1), constitutes the central axis of the complex in the form of a coiled-coil helical stem in the middle of the alpha beta hexamer. In ATP synthases of higher-plant chloroplasts, the gamma  subunit is some 40 residues longer and carries a short 8 amino acid sequence, containing two conserved cysteines, involved in the activation of the catalytic activity of the enzyme by thiol-reducing agents (20). This sequence should be present immediately downstream of the blandly conserved segment of the gamma  subunit sequence at positions 180 to 200 but is absent in Rhodobacter capsulatus (Fig. 2B), in agreement with previous observations for other Rhodospirillaceae (6, 27) and cyanobacteria (4, 14, 18, 28).


View larger version (52K):
[in this window]
[in a new window]
 


View larger version (53K):
[in this window]
[in a new window]
 


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2.   Alignment of the amino acid sequences of beta  (A), gamma  (B), and varepsilon  (C) subunits of Rhodobacter capsulatus (rc), E. coli (ec), and bovine heart mitochondria (bt). Asterisks indicate identical residues, dots indicate conservative substitutions, E's and double underlines indicate beta  strands, and H's and black boxes indicate alpha  helices. The secondary structures of beta  and gamma  subunits have been obtained from the atomic coordinates of bovine heart mitochondria F1 (1), and the secondary structural elements of the varepsilon  subunit have been obtained from nuclear magnetic resonance models of E. coli (33).

Construction of a deletion mutant. Gene transfer agent (GTA) particles produced by Rhodobacter capsulatus cells pack, randomly, pieces of DNA about 4.6 kb long, either from the chromosome or from resident plasmids, and transfer them to acceptor cells, where they are integrated into the chromosome by homologous recombination (17). This results in an exchange between the incoming DNA and the corresponding chromosomal DNA which is lost in the process. The genetic characteristics of transfer using GTA particles make it a method of choice for the introduction of gene deletions into the chromosome. To this end, two plasmids, pRCA107 and pRCA108 (Fig. 3A), were constructed upon cloning in the broad-host-range plasmid pRK415 (13). pRCA107 carries a complete deletion of the atpHAGDC operon, which is replaced by a Kmr cassette; pRCA108 has the cassette inserted at the EcoRV site downstream of the operon. In both cases, the resistance cassette is flanked by portions of Rhodobacter capsulatus DNA to allow for easy homologous recombination.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3.   (A) Restriction maps of plasmids pRCA51, pRCA107, and pRCA108. Thick lines represent Rhodobacter capsulatus DNA. Gray bars indicate atp genes, and open bars represent ORFs. Solid bars in pRCA107 and pRCA108 are kanamycin resistance cassettes inserted at the positions shown. Restriction site abbreviations: B, BamHI; X, XhoI; N, NotI; E, EcoRI; Bg, BglII; EV, EcoRV. Vectors are not shown. (B) Hybridization pattern of Rhodobacter capsulatus total DNA digested with EcoRI. Lanes: 1 and 4, wild-type B100; 2 and 5, strain RCAK1; 3 and 6, deletion mutant RCAK4. Hybridization was done with a gamma -subunit probe (lanes 1 to 3) and then with a kanamycin resistance probe (lanes 4 to 6). The two panels are pictures of the same filter hybridized with the first probe, stripped, and rehybridized with the second probe.

Transfer experiments using GTA particles were carried out as described previously (35) with rifampin-resistant strain J1 (31) plasmid-containing cells as the donors and wild-type B100 (12) cells as the acceptors. In each of a number of trials, no atpHAGDC deletion mutants were detected despite extensive efforts. In a typical experiment, slow-growing colonies resistant to kanamycin, putative atp mutants, started to appear on RFD2 minimal plates (standard RCV medium [32] modified with fructose as the carbon source and dimethyl sulfoxide [DMSO] as the final electron acceptor and supplemented with 0.05% yeast extract) after 8 to 14 days under aerobic, photosynthetic, or anaerobic growth conditions. Control colonies, with the Kmr cassette insertion downstream of the operon, grew in 2 to 9 days under corresponding conditions. No growth was detected under pure fermentative conditions (24), on RFD2 medium supplemented with sodium bicarbonate but lacking DMSO, even after prolonged incubation. The putative mutants were checked for aerobic growth on RCV standard minimal medium, with malate as the carbon source. Under these conditions, cells missing the ATP synthase complex are not expected to grow. All of the kanamycin-resistant putative atp mutants grew on RCV medium, indicating that a functional ATP synthase was still present. In addition, genomic DNA was isolated from five putative mutants and from strain RCAK1 carrying the Kmr cassette inserted downstream of the operon. Total DNA digestions were probed with the gamma -subunit gene and with the Kmr gene. All of the putative mutants had conserved the atpHAGDC operon and showed no Kmr cassette insertion (data not shown), indicating that the resistance trait was due to spontaneous mutations, whereas the RCAK1 control strain hybridized to both probes, showing that the Kmr cassette had been inserted into the chromosome. The impossibility to isolate atp deletion mutants represents a good indication that Rhodobacter capsulatus cannot grow without a functional ATP synthase under all growth conditions tested.

The problem of introducing a genomic deletion in the atpHAGDC operon or, more generally, in an indispensable gene, was addressed in a different way by combining transfer using GTA particles and conjugation procedures. We reasoned that it would be possible, in principle, to insert a genomic deletion via GTA particles followed by complementation with a wild-type copy of the operon present on a plasmid introduced by conjugation. Given the efficiency of transfer using GTA particles for a gene present on a plasmid and the efficiency of conjugation, measured in control experiments, it was calculated that approximately 4 × 109 cells were required for one positive event. The GTA-conjugation experiment was started with 3.5 ml of a Rhodobacter capsulatus B100 full-grown culture (~7 × 109 cells) and 3.5 ml of GTA containing filtrate from a J1 donor strain culture. This mixture was then centrifuged, resuspended in 3.5 ml of RCV minimal medium, and incubated at 30°C for 1 h. Conjugation of plasmid pRCA51 (pRK415 carrying the atpHAGDC operon) (Fig. 3A) was carried out by adding to the Rhodobacter capsulatus cell suspension 750 µl each of the two E. coli strains used in triparental matings, and the mixture was plated as described previously (26), on RCV minimal medium plus kanamycin. Under these conditions, three colonies that were then found to be resistant to both kanamycin and tetracycline (marker carried by pRCA51) appeared, suggesting the presence of both the Kmr cassette and the complementing plasmid. These colonies were grown as liquid cultures on RCV minimal medium with kanamycin but in the absence of tetracycline. Under these growth conditions, the selective pressure for plasmid maintenance is considered to be the presence of a functional ATP synthase rather than the antibiotic resistance. After repeated subculturing, all of the colonies derived from these cultures tested positive for resistance to both kanamycin and tetracycline. Under the same conditions and without antibiotic selection, the vector, pRK415, was lost in up to 40 to 50% of the cells. Plasmid preparations confirmed that the complementing plasmid was still present. For direct evidence of the genomic insertion of the Kmr cassette, genomic DNA was isolated from wild-type strain B100, strain RCAK1, and one of the strains with double resistance, RCAK4. Total DNA EcoRI digestions were checked by hybridization with the gamma -subunit gene (atpG) and the Kmr gene. The hybridization results are shown in Fig. 3B. Wild-type strain B100 hybridizes to the gamma -subunit probe, showing a 5.3-kb restriction fragment (Fig. 3B, lane 1), but not to the Kmr gene (lane 4). Strain RCAK1 (lanes 2 and 5) shows the same hybridization band with both probes (see pRCA108 restriction map in Fig. 3A). These 6.9-kb signals correspond to the 5.3-kb EcoRI restriction fragment of the wild type plus the 1.6-kb Kmr gene inserted at the end of the operon. Strain RCAK4 probed with the gamma -subunit gene (lane 3) shows a signal corresponding to a fragment of 18.5 kb, which is exactly the size of the plasmid pRCA51 linearized with EcoRI. In lane 3, there is no trace of the 5.3-kb hybridization band that represents the wild-type chromosomal copy of atpHAGDC, indicating that the operon has been deleted from the chromosome. In lane 6, hybridization of the same RCAK4 DNA with the Kmr gene indicates that the resistance cassette has been inserted into the chromosome in place of the atpHAGDC operon. The size of this fragment does not correspond to the 6.9 kb of the hybridization band in lane 5 minus the 5.1 kb of the atp operon because the EcoRI site present inside the operon has been lost in the process of deletion. From the experiment just described derives the possibility of testing the effect of site-directed mutations in essential genes in Rhodobacter capsulatus simply by substituting in the wild-type copy, on the incoming plasmid, a mutated version of the gene under study.

Conclusions. We have cloned and sequenced the atpHAGDC operon coding for ATP synthase from Rhodobacter capsulatus. The operon contains only the five genes of the extrinsic sector (F1), while the genes of the transmembrane subunits (F0) are in a different region of the chromosome, resembling the situation found in the close relatives Rhodospirillum rubrum and Rhodopseudomonas blastica. Cloning and sequencing of the F0 operon are in progress.

Rhodobacter capsulatus was reported to grow quite poorly under pure fermentative conditions, with fructose as the carbon source (24). Substantial growth was observed when DMSO or trimethylamine-N-oxide was used as an exogenous electron sink (16). We tried to isolate F1 deletion mutants under both growth conditions. Cells were incubated either anaerobically in the dark or in the light (as additional energy source) or aerobically with the respiratory chain used as an electron sink. No such deletion mutants were obtained under any of these growth conditions. It was possible, however, to isolate strains with a chromosomal deletion in the atpHAGDC operon after conjugation with an F1-containing plasmid. Our data can be considered in the light of previous conflicting results on the requirement of oxidative phosphorylation for growth under conditions of anaerobic respiration with DMSO or trimethylamine-N-oxide (16, 19, 24). Regarding the question of whether anaerobic electron flow is required just to dissipate the reducing power generated during fermentation or is necessarily associated with oxidative phosphorylation, our results clearly favor the second hypothesis.

This work represents the first step in the genetic characterization of the ATP synthase system in this photosynthetic bacterium. The well-developed genetics of this species and the good biochemical characterization of its energy-producing components make it a preferred system for genetic and structural analysis of photosynthetic ATP synthesis in prokaryotes. We have described here a genetic procedure that will make possible the easy introduction of mutated copies of the atpHAGDC operon for site-directed functional and structural analyses.

Nucleotide sequence accession number. The DNA sequence presented has been assigned the EMBL accession no. X99599.

    ACKNOWLEDGMENTS

This work was supported by the European Community under contract BIO2-CT93 0078.

We are grateful to A. G. W. Leslie and J. E. Walker, MRC Laboratory, Cambridge, United Kingdom, who allowed access to the atomic coordinates of bovine heart mitochondrial F1. We also thank Paola Turina for helpful discussions and for preparation of Fig. 3. The work of our students, Daniela Costa, Andrea Romano, and Luigi Altomare, is also acknowledged.

    FOOTNOTES

* Corresponding author. Mailing address: Università di Bologna, Dipartimento di Biologia, via Irnerio 42, 40162 Bologna, Italy. Phone: 39-51-351293. Fax: 39-51-242576. E-mail: melandri{at}alma.unibo.it.

dagger Present address: Istituto Policattedra, Facoltà di Scienze, Università di Verona, 37134 Verona, Italy.

    REFERENCES
Top
Abstract
Text
References

1. Abrahams, J. P., A. G. W. Leslie, R. Lutter, and J. E. Walker. 1994. Structure at 2.8 Å resolution of F1-ATPase from bovine heart mitochondria. Nature 370:621-628[Medline].
2. Boyer, P. D. 1993. The binding change mechanism for ATP synthase. Some probabilities and possibilities. Biochim. Biophys. Acta 1140:215-250[Medline].
3. Buggy, J. J., M. W. Sganga, and C. E. Bauer. 1994. Nucleotide sequence and characterization of the Rhodobacter capsulatus hvrB gene: HvrB is an activator of S-adenosyl-L-homocysteine hydrolase expression and is a member of the LysR family. J. Bacteriol. 176:61-69[Abstract/Free Full Text].
4. Cozen, A. L., and J. E. Walker. 1987. The organization and sequence of the genes for ATP synthase subunits in the cyanobacterium Synechococcus 6301. J. Mol. Biol. 194:359-383[Medline].
5. Duncan, T. M., V. V. Bulygin, Y. Zhou, M. L. Hutcheon, and R. L. Cross. 1995. Rotation of subunits during catalysis by Escherichia coli F1-ATPase. Proc. Natl. Acad. Sci. USA 92:10964-10968[Abstract/Free Full Text].
6. Falk, G., A. Hampe, and J. E. Walker. 1985. Nucleotide sequence of the Rhodospirillum rubrum atp operon. Biochem. J. 228:391-407[Medline].
7. Falk, G., and J. E. Walker. 1988. DNA sequence of a gene cluster coding for subunits of the F0 membrane sector of ATP synthase in Rhodospirillum rubrum. Biochem. J. 254:109-122[Medline].
8. Fillingame, R. H. 1990. Molecular mechanics of ATP synthesis by F1F0-type H+-transporting ATP synthases, p. 354-391. In T. A. Krulwich (ed.), The bacteria. Academic Press, Inc., New York, N.Y.
9. Futai, M., T. Noumi, and M. Maeda. 1989. ATP synthase (H+-ATPase): results by combined biochemical and molecular biological approaches. Annu. Rev. Biochem. 58:111-136[Medline].
10. Gabellini, N., Z. Gao, C. Eckerskorn, F. Lottspeich, and D. Oesterhelt. 1988. Purification of the H+-ATPase from Rhodobacter capsulatus, identification of the F1F0 components and reconstitution of the active enzyme. Biochim. Biophys. Acta 934:227-234.
11. Herrmann, R. G., J. Steppuhn, G. S. Herrmann, and N. Nelson. 1993. The nuclear-encoded polypeptide Cfo-II from spinach is a real, ninth subunit of chloroplast ATP synthase. FEBS Lett. 326:192-198[Medline].
12. Hillmer, P., and H. Gest. 1977. H2 metabolism in the photosynthetic bacterium Rhodopseudomonas capsulata: H2 production by growing cultures. J. Bacteriol. 129:724-731[Abstract/Free Full Text].
13. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197[Medline].
14. Lill, H., and N. Nelson. 1991. The atp1 and atp2 operons of the cyanobacterium Synechocystis sp. PCC 6803. Plant Mol. Biol. 17:641-652[Medline].
15. Ma, D., D. N. Cook, D. A. O'Brien, and J. E. Hearst. 1993. Analysis of the promoter and regulatory sequences of an oxygen-regulated bch operon in Rhobobacter capsulatus by site-directed mutagenesis. J. Bacteriol. 175:2037-2045[Abstract/Free Full Text].
16. Madigan, M. T., J. C. Cox, and H. Gest. 1980. Physiology of dark fermentative growth of Rhodopseudomonas capsulata. J. Bacteriol. 142:908-915[Abstract/Free Full Text].
17. Marrs, B. 1974. Genetic recombination in Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 71:971-973[Abstract/Free Full Text].
18. McCarn, D. F., R. A. Whitaker, J. Alam, J. M. Vrba, and S. E. Curtis. 1988. Genes encoding the alpha , gamma , delta , and four F0 subunits of ATP synthase constitute an operon in the cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 170:3448-3458[Abstract/Free Full Text].
19. McEwan, A. G., S. J. Ferguson, and J. B. Jackson. 1983. Electron flow to dimethylsulphoxide or trimethylamine-N-oxide generates a membrane potential in Rhodopseudomonas capsulata. Arch. Microbiol. 136:300-305[Medline].
20. Miki, J., M. Maeda, Y. Mukohata, and M. Futai. 1988. The gamma -subunit of ATP synthase from spinach chloroplasts. Primary structure deduced from the cloned cDNA sequence. FEBS Lett. 232:221-226[Medline].
21. Noji, H., R. Yasuda, M. Yosida, and K. Kinosita. 1997. Direct observation of the rotation of F1-ATPase. Nature 386:299-302[Medline].
22. Sabbert, D., S. Engelbrecht, and W. Junge. 1996. Intersubunit rotation in active F-ATPase. Nature 381:623-625[Medline].
23. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
24. Schultz, J. E., and P. F. Weaver. 1982. Fermentation and anaerobic respiration by Rhodospirillum rubrum and Rhodopseudomonas capsulata. J. Bacteriol. 149:181-190[Abstract/Free Full Text].
25. Senior, A. E. 1990. The proton translocating ATPase of Escherichia coli. Annu. Rev. Biophys. Biophys. Chem. 19:7-41[Medline].
26. Sharak Genthner, B. R., and J. D. Wall. 1985. Ammonium uptake in Rhodopseudomonas capsulata. Arch. Microbiol. 141:219-224.
27. Tybulewicz, V. L. J., G. Falk, and J. E. Walker. 1984. Rhodopseudomonas blastica atp operon. Nucleotide sequence and transcription. J. Mol. Biol. 179:185-214[Medline].
28. Van Walraven, H. S., R. Lutter, and J. E. Walker. 1993. Organization and sequences of genes for the subunits of ATP synthase in the thermophilic cyanobacterium Synechococcus 6716. Biochem. J. 294:239-251.
29. Walker, J. E., I. M. Fearnley, N. J. Gay, B. W. Gibson, F. D. Northrop, S. J. Powell, M. J. Rusnwick, M. Saraste, and V. L. J. Tybulewicz. 1985. Primary structure and subunit stoichiometry of F1 ATPase from bovine mitochondria. J. Mol. Biol. 184:677-701[Medline].
30. Walker, J. E., M. Saraste, and N. J. Gay. 1984. Nucleotide sequence, regulation and structure of ATP-synthase. Biochim. Biophys. Acta 768:164-200[Medline].
31. Wall, J. D., and K. Braddock. 1984. Mapping of Rhodopseudomonas capsulata nif genes. J. Bacteriol. 158:404-410[Abstract/Free Full Text].
32. Weaver, P. F., J. D. Wall, and H. Gest. 1975. Characterization of Rhodopseudomonas capsulata. Arch. Microbiol. 105:207-216[Medline].
33. Wilkens, S., F. W. Dahlquist, L. P. McIntosh, L. W. Donaldson, and R. A. Capaldi. 1995. Structural features of the varepsilon  subunit of the Escherichia coli ATP synthase determined by NMR spectroscopy. Nat. Struct. Biol. 2:961-967[Medline].
34. Xie, D. L., H. Lill, G. Hauska, M. Maeda, M. Futai, and N. Nelson. 1993. The atp2 operon of the green bacterium Chlorobium limicola. Biochim. Biophys. Acta 1172:267-273[Medline].
35. Yen, H.-C., and B. Marrs. 1976. Map of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata. J. Bacteriol. 126:619-629[Abstract/Free Full Text].


J Bacteriol, January 1998, p. 416-421, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Baker, S. C., Ferguson, S. J., Ludwig, B., Page, M. D., Richter, O.-M. H., van Spanning, R. J. M. (1998). Molecular Genetics of the Genus Paracoccus: Metabolically Versatile Bacteria with Bioenergetic Flexibility. Microbiol. Mol. Biol. Rev. 62: 1046-1078 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borghese, R.
Right arrow Articles by Melandri, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borghese, R.
Right arrow Articles by Melandri, B. A.