Previous Article | Next Article 
J Bacteriol, January 1998, p. 416-421, Vol. 180, No. 2
Laboratory of Biochemistry and Biophysics,
Department of Biology, University of Bologna, 40126 Bologna, Italy
Received 2 September 1997/Accepted 6 November 1997
The atpHAGDC operon of Rhodobacter
capsulatus, containing the five genes coding for the
F1 sector of the ATP synthase, has been cloned and
sequenced. The promoter region has been defined by primer extension
analysis. It was not possible to obtain viable cells carrying
atp deletions in the R. capsulatus chromosome, indicating that genes coding for ATP synthase are essential, at least
under the growth conditions tested. We were able to circumvent this
problem by combining gene transfer agent transduction with conjugation.
This method represents an easy way to construct strains carrying
mutations in indispensable genes.
ATP synthase is a multisubunit
enzyme that catalyzes the respiratory or photosynthetic synthesis of
ATP coupled to the exoergonic flux of protons across the inner membrane
of mitochondria, the thylakoid membranes of chloroplasts, or the plasma
membrane of bacteria. The enzyme can also promote the active
translocation of protons driven by ATP hydrolysis (8, 9,
25). The ATP synthase consists of two parts, an extrinsic sector
(F1) formed by five different subunits ( The gene structure of the ATP synthases has been studied for a great
number of organisms. For the enzymes from photosynthetic organisms,
sequences have been elucidated, for at least some subunits of
F1, for about 16 higher plants and 6 algae. Of 23 complete sequences of genes coding for eubacterial F0F1
ATPase found in the databases, 16 show a unique atp operon
with the F0 genes preceding the genes for F1.
The seven remaining species, all photosynthetic, have the
atp genes split into two operons (three in
Synechococcus sp. strain 6716 [28]). The
cyanobacteria Synechococcus sp. strain 6301 (4),
Anabaena strain PCC 7120 (18), and
Synechocystis strain PCC 6803 (14) and probably
the green sulfur bacterium Chlorobium limicola
(34) possess one operon comprising the F0 genes
together with the first three F1 genes and a second operon with the genes for F1 In this paper, we present the complete gene sequence of the
F1 operon (atpHAGDC) of Rhodobacter
capsulatus B100. We also describe a procedure that makes possible
the introduction of chromosomal deletions in essential genes followed
by complementation with a new copy of the same genes. This method will
allow us to perform easy site-directed mutagenesis studies on
Rhodobacter capsulatus F0F1 ATPase.
Cloning and sequence analysis of the atpHAGDC
operon.
The probe to be used for library screening was made by
amplification of a portion of the gene coding for the
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The ATP Synthase atpHAGDC
(F1) Operon from Rhodobacter capsulatus
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
, 
, 
, 
,
and 
) with a stoichiometry of
33 and connected through a thin
stalk to the second part, an intrinsic membrane sector (F0)
formed by a minimum of three proteins (a, b, and c) with a
stoichiometry of ab2c8-12. In photosynthetic
membranes, F0 is consistently formed by four different
subunits in all cases studied to date (7, 11, 28), the
fourth subunit, b', being a duplication of b. The extrinsic F1 sector contains three sites in which the synthesis or
hydrolysis of ATP is catalyzed and three noncatalytic nucleotide
binding sites, whose role is still not understood. The catalytic
reaction is coupled to the transmembrane proton flow through the
F0 sector presumably by means of long-range conformational
changes propagated along the stalk structure. A rotational catalytic
mechanism has been proposed; according to this mechanism, the
interaction of the single-copy subunits confers, cyclically in time,
different affinities for ATP, ADP, and phosphate to the catalytic site
in each pair (reviewed in reference 2). This
model has received decisive support from the atomic structure of
F1 from bovine heart mitochondria, recently resolved at 2.8 Å by X-ray crystallography (1). The rotational catalytic
model is also in agreement with recent functional experiments with
isolated F1 (5, 21, 22).
and subunits. In the
Rhodospirillaceae family members Rhodospirillum
rubrum (6, 7) and, probably, Rhodopseudomonas
blastica, for which only the F1 sequence is known (27), the structural genes of F0 and
F1 are organized into two separate operons. Surprisingly,
the gene organization and sequences for the ATP synthase of the two
species of Rhodospirillaceae most intensively studied from
biochemical and genetic standpoints (i.e., Rhodobacter
sphaeroides and Rhodobacter capsulatus) are still unknown.
subunit
(atpA). The primers used for PCR (5'
GACCGTCAGACCGGCAAGACCGC 3' and 5' AGTCTACAGCGACGACGACGCGG
3') were designed based on the sequence of the close relative
Rhodospirillum rubrum and chosen in highly conserved regions
in the middle of the subunit. The screening of 550 colonies gave
six positive clones, one of which was chosen for further study. The
sequencing of 8 kb carrying the atp operon was completed by
use of the dideoxynucleotide chain termination method (23).
, , , , and , respectively. In
Rhodobacter capsulatus, no genes coding for F0
were found upstream of the atpHAGDC operon, like the
situation found in Rhodopseudomonas blastica and
Rhodospirillum rubrum (6, 27). This organization
seems to be unique to the Rhodospirillaceae.
subunit, has been found in the close relatives Rhodospirillum
rubrum and Rhodopseudomonas blastica (6, 27) but not in any other prokaryote checked; in these other prokaryotes, atpH begins with a more typical ATG.
The transcription initiation site was determined by primer extension
(3). The 5' end of the message was mapped at an adenine residue, 108 nucleotides upstream of the GTG start codon of the subunit (Fig. 1A). A possible promoter
sequence was recognized around the 
10 and 35 regions. Similar
elements have been found in Rhodobacter capsulatus in a
number of other operons, particularly operons involved in
bacteriochlorophyll and carotenoid biosynthesis, in which
identification of the putative promoter elements has been substantiated
by mutagenesis analysis (15). In particular, the TTG stretch
in the 35 element is completely conserved (Fig. 1B).
|
subunit corresponding to the code of valine (probably also an
N-formylmethionine). With this fact taken into account, the
relative molecular weights of the five subunits should be 54,670, 50,097, 31,076, 18,760, and 13,357 for , , , , and ,
respectively, corresponding to an overall molecular mass of 377,494 Da.
Four other open reading frames (ORFs) were found upstream and
downstream of the atpHAGDC sequence (see Fig. 3A). All of
these ORFs have a high degree of sequence similarity with ORFs found around the atp operon of the other photosynthetic bacterium,
Rhodopseudomonas blastica (27). The overall
organization is identical in the two species, except that
Rhodopseudomonas blastica has two extra ORFs. One, ORF5, is
found immediately upstream of atpH and is apparently
transcribed in the opposite direction; the second, ORF6, is placed
between atpG and atpD. Rhodobacter capsulatus ORF1, which we have sequenced for only 443 bases, corresponds to ORF2
in Rhodopseudomonas blastica with 89% identity. ORF1 also has 50% sequence identity with Escherichia coli clpA.
Rhodobacter capsulatus ORF2, ORF3, and ORF4 correspond to
Rhodopseudomonas blastica ORF3, ORF4, and ORF7 with
identities of 56, 65, and 62%, respectively. Apparently there is no
correspondence with sequences upstream of the atpHAGDC
operon of Rhodospirillum rubrum, the other closely related
photosynthetic bacterium (6).
We show in Fig.
2 the
sequence alignments of , , and subunits from
Rhodobacter capsulatus, E. coli (30),
and bovine mitochondria (29), together with structural
information, where available. The amino acid sequences of the and
subunits confirm that they are the most conserved ones in the whole
ATP synthase complex. The identities with sequences of other
photosynthetic bacteria are striking (79 and 89% with
Rhodospirillum rubrum and Rhodopseudomonas
blastica subunits, respectively; 74 and 86% with
Rhodospirillum rubrum and Rhodopseudomonas
blastica subunits, respectively (6, 27); the
sequence homology with nonphotosynthetic eubacterial ATP synthases is
also very extensive (e.g., 69 and 55% identities with E. coli and subunits, respectively) (30). The
homology is also quite strong with the ATP synthase from eukaryotic organisms (78 and 68% identities with and subunits,
respectively, in bovine mitochondria) (29). In Fig. 2A, the
alignment of subunit sequences indicates that identity is
particularly marked in several key sectors, including the catalytic
site (1), where all the amino acid residues are entirely
conserved in the three sequences. Subunit , only partially resolved
by X-ray crystallography of bovine heart mitochondria F1
(1), constitutes the central axis of the complex in the form
of a coiled-coil helical stem in the middle of the hexamer. In
ATP synthases of higher-plant chloroplasts, the subunit is some 40 residues longer and carries a short 8 amino acid sequence, containing
two conserved cysteines, involved in the activation of the catalytic
activity of the enzyme by thiol-reducing agents (20). This
sequence should be present immediately downstream of the blandly
conserved segment of the subunit sequence at positions 180 to 200 but is absent in Rhodobacter capsulatus (Fig. 2B), in
agreement with previous observations for other
Rhodospirillaceae (6, 27) and cyanobacteria
(4, 14, 18, 28).
|
Construction of a deletion mutant. Gene transfer agent (GTA) particles produced by Rhodobacter capsulatus cells pack, randomly, pieces of DNA about 4.6 kb long, either from the chromosome or from resident plasmids, and transfer them to acceptor cells, where they are integrated into the chromosome by homologous recombination (17). This results in an exchange between the incoming DNA and the corresponding chromosomal DNA which is lost in the process. The genetic characteristics of transfer using GTA particles make it a method of choice for the introduction of gene deletions into the chromosome. To this end, two plasmids, pRCA107 and pRCA108 (Fig. 3A), were constructed upon cloning in the broad-host-range plasmid pRK415 (13). pRCA107 carries a complete deletion of the atpHAGDC operon, which is replaced by a Kmr cassette; pRCA108 has the cassette inserted at the EcoRV site downstream of the operon. In both cases, the resistance cassette is flanked by portions of Rhodobacter capsulatus DNA to allow for easy homologous recombination.
|
-subunit gene and with the
Kmr gene. All of the putative mutants had conserved the
atpHAGDC operon and showed no Kmr cassette
insertion (data not shown), indicating that the resistance trait was
due to spontaneous mutations, whereas the RCAK1 control strain
hybridized to both probes, showing that the Kmr cassette
had been inserted into the chromosome. The impossibility to isolate
atp deletion mutants represents a good indication that Rhodobacter capsulatus cannot grow without a functional ATP
synthase under all growth conditions tested.
The problem of introducing a genomic deletion in the
atpHAGDC operon or, more generally, in an
indispensable gene, was addressed in a different way by combining
transfer using GTA particles and conjugation procedures. We reasoned
that it would be possible, in principle, to insert a genomic deletion
via GTA particles followed by complementation with a wild-type copy of
the operon present on a plasmid introduced by conjugation. Given the
efficiency of transfer using GTA particles for a gene present on a
plasmid and the efficiency of conjugation, measured in control
experiments, it was calculated that approximately 4 × 109 cells were required for one positive event. The
GTA-conjugation experiment was started with 3.5 ml of a
Rhodobacter capsulatus B100 full-grown culture (~7 × 109 cells) and 3.5 ml of GTA containing filtrate from a J1
donor strain culture. This mixture was then centrifuged, resuspended in
3.5 ml of RCV minimal medium, and incubated at 30°C for 1 h. Conjugation of plasmid pRCA51 (pRK415 carrying the atpHAGDC
operon) (Fig. 3A) was carried out by adding to the Rhodobacter
capsulatus cell suspension 750 µl each of the two E. coli strains used in triparental matings, and the mixture was
plated as described previously (26), on RCV minimal medium
plus kanamycin. Under these conditions, three colonies that were then
found to be resistant to both kanamycin and tetracycline (marker
carried by pRCA51) appeared, suggesting the presence of both the
Kmr cassette and the complementing plasmid. These colonies
were grown as liquid cultures on RCV minimal medium with kanamycin but
in the absence of tetracycline. Under these growth conditions, the selective pressure for plasmid maintenance is considered to be the
presence of a functional ATP synthase rather than the antibiotic resistance. After repeated subculturing, all of the colonies derived from these cultures tested positive for resistance to both kanamycin and tetracycline. Under the same conditions and without antibiotic selection, the vector, pRK415, was lost in up to 40 to 50% of the
cells. Plasmid preparations confirmed that the complementing plasmid
was still present. For direct evidence of the genomic insertion of the
Kmr cassette, genomic DNA was isolated from wild-type
strain B100, strain RCAK1, and one of the strains with double
resistance, RCAK4. Total DNA EcoRI digestions were checked
by hybridization with the -subunit gene (atpG) and the
Kmr gene. The hybridization results are shown in Fig. 3B.
Wild-type strain B100 hybridizes to the -subunit probe, showing a
5.3-kb restriction fragment (Fig. 3B, lane 1), but not to the
Kmr gene (lane 4). Strain RCAK1 (lanes 2 and 5) shows the
same hybridization band with both probes (see pRCA108 restriction map
in Fig. 3A). These 6.9-kb signals correspond to the 5.3-kb
EcoRI restriction fragment of the wild type plus the 1.6-kb
Kmr gene inserted at the end of the operon. Strain RCAK4
probed with the -subunit gene (lane 3) shows a signal corresponding
to a fragment of 18.5 kb, which is exactly the size of the plasmid pRCA51 linearized with EcoRI. In lane 3, there is no trace
of the 5.3-kb hybridization band that represents the wild-type
chromosomal copy of atpHAGDC, indicating that the operon has
been deleted from the chromosome. In lane 6, hybridization of the same
RCAK4 DNA with the Kmr gene indicates that the resistance
cassette has been inserted into the chromosome in place of the
atpHAGDC operon. The size of this fragment does not
correspond to the 6.9 kb of the hybridization band in lane 5 minus the
5.1 kb of the atp operon because the EcoRI site
present inside the operon has been lost in the process of deletion.
From the experiment just described derives the possibility of testing
the effect of site-directed mutations in essential genes in
Rhodobacter capsulatus simply by substituting in the wild-type copy, on the incoming plasmid, a mutated version of the gene
under study.
Conclusions. We have cloned and sequenced the atpHAGDC operon coding for ATP synthase from Rhodobacter capsulatus. The operon contains only the five genes of the extrinsic sector (F1), while the genes of the transmembrane subunits (F0) are in a different region of the chromosome, resembling the situation found in the close relatives Rhodospirillum rubrum and Rhodopseudomonas blastica. Cloning and sequencing of the F0 operon are in progress.
Rhodobacter capsulatus was reported to grow quite poorly under pure fermentative conditions, with fructose as the carbon source (24). Substantial growth was observed when DMSO or trimethylamine-N-oxide was used as an exogenous electron sink (16). We tried to isolate F1 deletion mutants under both growth conditions. Cells were incubated either anaerobically in the dark or in the light (as additional energy source) or aerobically with the respiratory chain used as an electron sink. No such deletion mutants were obtained under any of these growth conditions. It was possible, however, to isolate strains with a chromosomal deletion in the atpHAGDC operon after conjugation with an F1-containing plasmid. Our data can be considered in the light of previous conflicting results on the requirement of oxidative phosphorylation for growth under conditions of anaerobic respiration with DMSO or trimethylamine-N-oxide (16, 19, 24). Regarding the question of whether anaerobic electron flow is required just to dissipate the reducing power generated during fermentation or is necessarily associated with oxidative phosphorylation, our results clearly favor the second hypothesis. This work represents the first step in the genetic characterization of the ATP synthase system in this photosynthetic bacterium. The well-developed genetics of this species and the good biochemical characterization of its energy-producing components make it a preferred system for genetic and structural analysis of photosynthetic ATP synthesis in prokaryotes. We have described here a genetic procedure that will make possible the easy introduction of mutated copies of the atpHAGDC operon for site-directed functional and structural analyses.Nucleotide sequence accession number. The DNA sequence presented has been assigned the EMBL accession no. X99599.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the European Community under contract BIO2-CT93 0078.
We are grateful to A. G. W. Leslie and J. E. Walker, MRC Laboratory, Cambridge, United Kingdom, who allowed access to the atomic coordinates of bovine heart mitochondrial F1. We also thank Paola Turina for helpful discussions and for preparation of Fig. 3. The work of our students, Daniela Costa, Andrea Romano, and Luigi Altomare, is also acknowledged.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Università di Bologna, Dipartimento di Biologia, via Irnerio 42, 40162 Bologna, Italy. Phone: 39-51-351293. Fax: 39-51-242576. E-mail: melandri{at}alma.unibo.it.
Present address: Istituto Policattedra, Facoltà di Scienze,
Università di Verona, 37134 Verona, Italy.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Abrahams, J. P., A. G. W. Leslie, R. Lutter, and J. E. Walker. 1994. Structure at 2.8 Å resolution of F1-ATPase from bovine heart mitochondria. Nature 370:621-628[Medline]. |
| 2. | Boyer, P. D. 1993. The binding change mechanism for ATP synthase. Some probabilities and possibilities. Biochim. Biophys. Acta 1140:215-250[Medline]. |
| 3. |
Buggy, J. J.,
M. W. Sganga, and C. E. Bauer.
1994.
Nucleotide sequence and characterization of the Rhodobacter capsulatus hvrB gene: HvrB is an activator of S-adenosyl-L-homocysteine hydrolase expression and is a member of the LysR family.
J. Bacteriol.
176:61-69 |
| 4. | Cozen, A. L., and J. E. Walker. 1987. The organization and sequence of the genes for ATP synthase subunits in the cyanobacterium Synechococcus 6301. J. Mol. Biol. 194:359-383[Medline]. |
| 5. |
Duncan, T. M.,
V. V. Bulygin,
Y. Zhou,
M. L. Hutcheon, and R. L. Cross.
1995.
Rotation of subunits during catalysis by Escherichia coli F1-ATPase.
Proc. Natl. Acad. Sci. USA
92:10964-10968 |
| 6. | Falk, G., A. Hampe, and J. E. Walker. 1985. Nucleotide sequence of the Rhodospirillum rubrum atp operon. Biochem. J. 228:391-407[Medline]. |
| 7. | Falk, G., and J. E. Walker. 1988. DNA sequence of a gene cluster coding for subunits of the F0 membrane sector of ATP synthase in Rhodospirillum rubrum. Biochem. J. 254:109-122[Medline]. |
| 8. | Fillingame, R. H. 1990. Molecular mechanics of ATP synthesis by F1F0-type H+-transporting ATP synthases, p. 354-391. In T. A. Krulwich (ed.), The bacteria. Academic Press, Inc., New York, N.Y. |
| 9. | Futai, M., T. Noumi, and M. Maeda. 1989. ATP synthase (H+-ATPase): results by combined biochemical and molecular biological approaches. Annu. Rev. Biochem. 58:111-136[Medline]. |
| 10. | Gabellini, N., Z. Gao, C. Eckerskorn, F. Lottspeich, and D. Oesterhelt. 1988. Purification of the H+-ATPase from Rhodobacter capsulatus, identification of the F1F0 components and reconstitution of the active enzyme. Biochim. Biophys. Acta 934:227-234. |
| 11. | Herrmann, R. G., J. Steppuhn, G. S. Herrmann, and N. Nelson. 1993. The nuclear-encoded polypeptide Cfo-II from spinach is a real, ninth subunit of chloroplast ATP synthase. FEBS Lett. 326:192-198[Medline]. |
| 12. |
Hillmer, P., and H. Gest.
1977.
H2 metabolism in the photosynthetic bacterium Rhodopseudomonas capsulata: H2 production by growing cultures.
J. Bacteriol.
129:724-731 |
| 13. | Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197[Medline]. |
| 14. | Lill, H., and N. Nelson. 1991. The atp1 and atp2 operons of the cyanobacterium Synechocystis sp. PCC 6803. Plant Mol. Biol. 17:641-652[Medline]. |
| 15. |
Ma, D.,
D. N. Cook,
D. A. O'Brien, and J. E. Hearst.
1993.
Analysis of the promoter and regulatory sequences of an oxygen-regulated bch operon in Rhobobacter capsulatus by site-directed mutagenesis.
J. Bacteriol.
175:2037-2045 |
| 16. |
Madigan, M. T.,
J. C. Cox, and H. Gest.
1980.
Physiology of dark fermentative growth of Rhodopseudomonas capsulata.
J. Bacteriol.
142:908-915 |
| 17. |
Marrs, B.
1974.
Genetic recombination in Rhodopseudomonas capsulata.
Proc. Natl. Acad. Sci. USA
71:971-973 |
| 18. |
McCarn, D. F.,
R. A. Whitaker,
J. Alam,
J. M. Vrba, and S. E. Curtis.
1988.
Genes encoding the , , , and four F0 subunits of ATP synthase constitute an operon in the cyanobacterium Anabaena sp. strain PCC 7120.
J. Bacteriol.
170:3448-3458 |
| 19. | McEwan, A. G., S. J. Ferguson, and J. B. Jackson. 1983. Electron flow to dimethylsulphoxide or trimethylamine-N-oxide generates a membrane potential in Rhodopseudomonas capsulata. Arch. Microbiol. 136:300-305[Medline]. |
| 20. |
Miki, J.,
M. Maeda,
Y. Mukohata, and M. Futai.
1988.
The -subunit of ATP synthase from spinach chloroplasts. Primary structure deduced from the cloned cDNA sequence.
FEBS Lett.
232:221-226[Medline].
|
| 21. | Noji, H., R. Yasuda, M. Yosida, and K. Kinosita. 1997. Direct observation of the rotation of F1-ATPase. Nature 386:299-302[Medline]. |
| 22. | Sabbert, D., S. Engelbrecht, and W. Junge. 1996. Intersubunit rotation in active F-ATPase. Nature 381:623-625[Medline]. |
| 23. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 24. |
Schultz, J. E., and P. F. Weaver.
1982.
Fermentation and anaerobic respiration by Rhodospirillum rubrum and Rhodopseudomonas capsulata.
J. Bacteriol.
149:181-190 |
| 25. | Senior, A. E. 1990. The proton translocating ATPase of Escherichia coli. Annu. Rev. Biophys. Biophys. Chem. 19:7-41[Medline]. |
| 26. | Sharak Genthner, B. R., and J. D. Wall. 1985. Ammonium uptake in Rhodopseudomonas capsulata. Arch. Microbiol. 141:219-224. |
| 27. | Tybulewicz, V. L. J., G. Falk, and J. E. Walker. 1984. Rhodopseudomonas blastica atp operon. Nucleotide sequence and transcription. J. Mol. Biol. 179:185-214[Medline]. |
| 28. | Van Walraven, H. S., R. Lutter, and J. E. Walker. 1993. Organization and sequences of genes for the subunits of ATP synthase in the thermophilic cyanobacterium Synechococcus 6716. Biochem. J. 294:239-251. |
| 29. | Walker, J. E., I. M. Fearnley, N. J. Gay, B. W. Gibson, F. D. Northrop, S. J. Powell, M. J. Rusnwick, M. Saraste, and V. L. J. Tybulewicz. 1985. Primary structure and subunit stoichiometry of F1 ATPase from bovine mitochondria. J. Mol. Biol. 184:677-701[Medline]. |
| 30. | Walker, J. E., M. Saraste, and N. J. Gay. 1984. Nucleotide sequence, regulation and structure of ATP-synthase. Biochim. Biophys. Acta 768:164-200[Medline]. |
| 31. |
Wall, J. D., and K. Braddock.
1984.
Mapping of Rhodopseudomonas capsulata nif genes.
J. Bacteriol.
158:404-410 |
| 32. | Weaver, P. F., J. D. Wall, and H. Gest. 1975. Characterization of Rhodopseudomonas capsulata. Arch. Microbiol. 105:207-216[Medline]. |
| 33. |
Wilkens, S.,
F. W. Dahlquist,
L. P. McIntosh,
L. W. Donaldson, and R. A. Capaldi.
1995.
Structural features of the subunit of the Escherichia coli ATP synthase determined by NMR spectroscopy.
Nat. Struct. Biol.
2:961-967[Medline].
|
| 34. | Xie, D. L., H. Lill, G. Hauska, M. Maeda, M. Futai, and N. Nelson. 1993. The atp2 operon of the green bacterium Chlorobium limicola. Biochim. Biophys. Acta 1172:267-273[Medline]. |
| 35. |
Yen, H.-C., and B. Marrs.
1976.
Map of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata.
J. Bacteriol.
126:619-629 |
J Bacteriol, January 1998, p. 416-421, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Baker, S. C., Ferguson, S. J., Ludwig, B., Page, M. D., Richter, O.-M. H., van Spanning, R. J. M.
(1998). Molecular Genetics of the Genus Paracoccus: Metabolically Versatile Bacteria with Bioenergetic Flexibility. Microbiol. Mol. Biol. Rev.
62: 1046-1078
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»