This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, C. J.
Right arrow Articles by Parker, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, C. J.
Right arrow Articles by Parker, A. C.

 Previous Article  |  Next Article 

J Bacteriol, January 1998, p. 435-439, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

The Transfer Origin for Bacteroides Mobilizable Transposon Tn4555 Is Related to a Plasmid Family from Gram-Positive Bacteria

C. Jeffrey Smith* and Anita C. Parker

Department of Microbiology and Immunology, East Carolina University, Greenville, North Carolina 27858

Received 14 August 1997/Accepted 10 November 1997

    ABSTRACT
Top
Abstract
Text
References

Conjugal transfer of Bacteroides mobilizable transposon Tn4555 was examined with an Escherichia coli-based assay system. It was shown that mobilization required the cis-acting oriTTn region and that the Tn4555 mobATn gene and RK231 must be present in trans. With alkaline agarose gel electrophoresis and filter blot hybridizations, it was shown that at oriTTn there was a site- and strand-specific cleavage event that was dependent on mobATn. The 5' end of this cleavage site was mapped by primer extension, and the nucleotide sequence surrounding the site had homology to a family of oriT nick sites found in mobilizable plasmids of gram-positive bacteria. Removal of the nick site by deletion of 18 bp surrounding the site resulted in a significant loss of transfer activity.

    TEXT
Top
Abstract
Text
References

The spread of antibiotic resistance is a significant problem in the treatment of infectious diseases. Historically, plasmids have mediated the majority of antibiotic resistance transfer, but more recently, conjugative transposons have been recognized as important vehicles of genetic exchange. Tn916 (3, 22) and the Bacteroides tetracycline resistance elements (TET elements) (14, 19) are the best-studied examples of this group. Another newly recognized, distinct class of transmissible transposons is the mobilizable transposon. These elements are similar to mobilizable plasmids in that they are not self-transmissible, but they can transfer between species via conjugation in the presence of a helper element that supplies most of the necessary conjugation functions. Genetic elements in Bacteroides such as beta -lactamase transposon Tn4555 (17), the cryptic Tn4399 (7), and nonreplicating Bacteroides units (NBUs) (23) are the only documented examples of this class.

Each of the mobilizable transposons studied thus far is unique, utilizing a variety of mechanisms for transposition (8, 25, 31). However, these transposons seem to have some similarities in their mobilization strategies in that they all can be mobilized by the TET elements or other cryptic conjugation elements in Bacteroides. Tn4555 and the NBUs share a related mob gene (mobATn for Tn4555) that codes for a protein distantly related to the RP4 TraI relaxase family (29). Interestingly, this appears to be the only protein coding gene required for mobilization (11, 29). In contrast, Tn4399 requires two proteins for optimal transfer efficiency (15, 16). One of these, MocA, is closely related to TraI, falling into the same phylogenetic group as TraI from RP4 and related IncP gram-negative plasmids, which also require two gene products for mobilization (29).

Comparison of the mobilization regions of Tn4555 and NBU1 has revealed 78% sequence identity over a 1.6-kb region. The regions of high sequence identity end abruptly, and it is possible that these are genetic cassettes that can recombine into a variety of locations. This is clearly the case with the Bacteroides plasmid pBI143, in which the mobilization region is bounded by large inverted repeat structures and has a G+C percentage that is different than that for the rest of the plasmid (30). If the mobilization of these novel transposons is similar to other transmissible systems, then a complete mobilization cassette should include the cis-acting transfer origin. The goal of the present work was to characterize this region on Tn4555.

Escherichia coli DH5alpha [endA1 recA1 hsdR17 deoR, thi-1 supE44 gyrA96 relA1 Delta (lacZYA-argF)] was used for DNA manipulations. Routine plasmid preparations, restriction digests, ligations, and alkaline agarose gel electrophoresis were performed as described previously (20). Alkaline agarose gels were electrophoresed at 1 V/cm and 4°C for 40 h in buffer containing 50 mM NaOH and 1 mM EDTA. DNA filter blots of alkaline agarose gels were prepared by capillary action of the neutralized gels (32). The filters then were hybridized to oligonucleotide probes that had been end labeled with [gamma -32P]ATP using T4 polynucleotide kinase according to standard protocols (20). DNA sequencing reactions were performed by the dideoxy chain termination method (21) with modified T7 polymerase and other reagents in the Sequenase kit (U.S. Biochemical, Cleveland, Ohio). Nicked circular DNA was isolated by the basic method of Clewell and Helinski (2) with several modifications (16). A final purification of the nicked DNA was performed by cesium chloride-ethidium bromide equilibrium ultracentrifugation (20).

The model plasmid used in our studies was pFD576. To construct pFD576, the 7.5-kb Sau3AI fragment from pJST61 (17) was inserted into the BamHI site of pUC19 (36). DNA sequences downstream of mobATn were deleted by digestion with ClaI and XbaI, followed by a fill-in reaction with Klenow fragment of DNA polymerase I and ligation with T4 DNA ligase (20). The regions upstream of mobATn were deleted in a similar manner except that SmaI and StyI were used (Fig. 1). Plasmid pFD601 was constructed by excising the 285-bp oriTTn PCR fragment from pFD556 (29) with SstI and SphI and subcloning it into the low-copy-number Cmr vector pSG335 (4) (Fig. 1). Site-directed mutagenesis of the nick site was accomplished by making a short deletion with the QuikChange system from Stratagene (La Jolla, Calif.). The template used was pFD576, and the mutagenic oligonucleotide was GCGGAGCGTGTAGTTATAAAGCCATTGTCTGCAAACTCC and its complement (Fig. 2, bp 28 to 84). To construct pFD648, the mobA gene of pFD576Delta oriT2 was deleted by removal of an internal HindIII fragment (Fig. 1).


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1.   Partial restriction maps of plasmids used in the Tn4555 transfer studies showing relevant restriction sites and genes. The thin black lines represent the cloning vector pUC19 for pFD576 and pFD648 and the cloning vector pSG335 for pFD601. Genes are indicated by open boxes, with arrows showing the direction of transcription. The small hatched boxes indicate the location of the PCR-285 sequences, and the open circle  symbol shows the location of the oriTTn nick site. In the case of pFD648, the mutated oriTTn nick site is indicated by the triangle  symbol. The restriction sites indicated by the asterisk were eliminated by blunt-end ligation, and the mobA* gene was truncated as indicated in the text. Approximate locations of the oligonucleotide primers used in this work are shown by the arrowheads over the map of pFD576.


View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2.   Nucleotide sequence of oriTTn. The site of the strand-specific nick is indicated by the arrowhead over the sequence, and the dark line under the sequence indicates the region deleted in pFD576Delta oriT1 and Delta oriT2. The bold, underlined sequence (bp 1 to 57) indicates nucleotides identical to the mobilization region of NBU1 (29). The dashed lines over the sequence mark regions of dyad symmetry. The location of primer 2F is indicated with an arrow, but note that the actual sequence shown is the complement to this primer.

Mobilization of pFD576 and pFD601 in E. coli. It has been demonstrated previously that some Bacteroides elements can be mobilized by IncPalpha plasmids such as RK2, provided the Bacteroides-specific mobilization gene(s) is present (15, 24). Therefore, pFD576 containing the Tn4555 mobATn gene and the adjacent oriTTn region was tested for mobilization by the RK2 derivative RK231. The results (Table 1) showed that transfer occurred at a high frequency but the vector alone (pUC19) did not transfer at detectable frequencies (27).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Transfer of Tn4555 oriT derivatives

A fundamental feature of mobilization is the presence of a cis-acting region (oriT) that is required for transfer. This region is the initiation site of DNA processing at which a site- and strand-specific nick is made in the plasmid to start the transfer event. In a previous study with Bacteroides donor strains, the cis-acting region of Tn4555 was localized to a 285-bp fragment (designated PCR-285) (29). In order to show that the same region worked in the E. coli system, pFD601 (Cmr) containing PCR-285 was constructed. As shown in Table 1, when mobATn was in trans on pFD576, pFD601 transferred at a frequency of 2.9 × 10-3 to 3.3 × 10-3. The transfer frequency was much lower than when pFD576 was transferred from the same strain (compare lines 3 and 4 in Table 1). This difference in transfer frequency may be due to the lower copy number of pFD601 or to a less efficient diffusion of the mobATn gene product in the two-plasmid system. pFD601 required the presence of mobATn and did not transfer in the absence of pFD576.

Identification of the Tn4555 nick site. Nicked, circular pFD576 DNA was restricted with either EcoRI or SalI, electrophoresed on an alkaline agarose gel, transferred to nylon filters, and hybridized to a specific oligonucleotide probe. As seen in Fig. 3A, the predicted sizes for the DNA fragments of plasmid nicked in the region of oriTTn were similar regardless of which restriction enzyme was used, and the expected pattern was observed on the alkaline gels. The covalently closed circular (ccc) form of pFD576 yielded only a single fragment (Fig. 3B, lanes 1 through 4). When hybridized to probe 2F, a single hybridizing band was expected, depending on the restriction enzyme. The results shown in Fig. 3C indicated that the bottom strand was nicked, resulting in hybridization to either the 1.8-kb EcoRI fragment (lane 2) or the 4.5-kb SalI fragment (lane 4). In both cases there was substantial hybridization to the largest fragment corresponding to the 6.5-kb unnicked DNA. It is likely that this background was due to the random nicking of the DNA, which occurs during the purification of relaxed plasmid DNA. The sizes of the restriction fragments that hybridized to the probe showed that the location of the oriTTn nick site was within the PCR-285 region and that cleavage was strand specific. Consistent with the probe 2F results, probe 1R, which is complementary to the DNA strand opposite of probe 2F, was found to hybridize only with the largest fragment, irrespective of the restriction enzyme used (Fig. 3D). This unnicked hybridizing DNA corresponds to the upper strand on the map in Fig. 3A.


View larger version (46K):
[in this window]
[in a new window]
 
FIG. 3.   Alkaline agarose gel electrophoresis and hybridization analysis of ccc and specifically nicked pFD576. (A) Partial restriction map of EcoRI- or SalI-digested pFD576 indicating the DNA fragment sizes expected for denaturing gel electrophoresis. The top strand is shown by a solid line and the bottom, nicked strand is shown by a dashed line. (B) Alkaline agarose gel. The white marks show the fragments that hybridized to probe 2F. (C) Autoradiograph from filter blot hybridization analysis of gel in panel A probed with oligonucleotide 2F. (D) Autoradiograph from filter blot hybridization analysis of gel similar to that shown in panel A probed with oligonucleotide 1R. Lane 1, EcoRI ccc pFD576; lane 2, EcoRI nicked pFD576; lane 3, SalI ccc pFD576; lane 4, SalI nicked pFD576; lane 5, 1-kb ladder size standard; lane 6, EcoRI ccc pFD576Delta oriT1; lane 7, EcoRI nicked pFD576Delta oriT1.

The 5' end of the cleavage site was mapped by nucleotide sequence analysis of nicked pFD576 plasmid DNA with oligonucleotide 2F as the primer for these reactions. As shown in Fig. 4, two distinct stops were seen in all lanes when the relaxed plasmid preparation was used for the template but not when the ccc plasmid DNA was used (compare panels A and B). This result corresponds to the G (bp 50) and C (bp 51), both of which were of equal intensity. It is possible that both sites are utilized by the enzyme; however, another possibility is that the band corresponding to the C residue is due to an additional nucleotide added on to the end of the DNA strand by the terminal transferase activity of the modified T7 DNA polymerase. Similar observations have been made previously with these types of reactions with Sequenase (6, 13). The location of the nick site was verified with a single DNA strand corresponding to the 4.5-kb SalI fragment that had been isolated from an alkaline agarose gel. As shown in Fig. 4B, the sequencing reactions mapped the 5' end to the same two bases. In another confirmation of this nick site location, primer extension with oligonucleotide 1F yielded identical results (27).


View larger version (60K):
[in this window]
[in a new window]
 
FIG. 4.   Determination of the 5' end of the oriTTn nick site. (A) Nicked, pFD576 DNA was used as a template for DNA sequencing reactions with the primer 2F. (B) In the first four lanes, supercoiled ccc pFD576 DNA was used as a template for DNA sequencing reactions with primer 2F. In the last four lanes, a 4.5-kb fragment from SalI-digested nicked pFD576 was purified from an alkaline gel and used as a template in DNA sequencing reactions with primer 2F. The arrow indicates the terminus of the nicked DNA strand.

Nucleotide sequence analysis of the nick site. The nick site was located in a region of Tn4555 that was at the very end of its homology with NBU1 and NBU2. Although this is not the location previously thought to contain the NBU oriT, based on nucleotide sequence comparisons (11, 12), it is likely that this nick site is used, since it was shown previously that NBU1 mob can substitute for mobATn (29). Inspection of the oriTTn primary DNA sequence revealed several features common to oriTs (10). These include the presence of inverted repeat sequences adjacent to the nick site, a higher AT content than the surrounding area, and a location near other mobilization genes (Fig. 1 and 2). In addition, the sequence surrounding the nick site itself was similar to the oriT of a streptococcal TET resistance plasmid, pMV158 (6). pMV158 is representative of a new oriT family made up of gram-positive, mobilizable plasmids that replicate by the rolling circle mechanism (6, 10). The pMV158 oriT is located in the RSA sequence, which is conserved in many mobilizable gram-positive plasmids. An alignment of these sequences from a representative group of these plasmids is shown in Fig. 5. Included with the alignment are potential oriT nick sites from two mobilizable Bacteroides plasmids. These were identified by using the oriTTn sequence as a query in searches of pBI143 and pIP421. In each case, one significant homologous region was found, and these were located in appropriate regions. oriT143 was located at bp 2661 to 2679 adjacent to an inverted repeat sequence just upstream from mobA143. This region was required in cis for the transfer of pBI143 (29, 30). Likewise, in a 217-bp region of pIP421 (bp 450 to 468) known to be required in cis for transfer (34), there was significant homology (16 of 19 bases) to oriTTn (Fig. 5). This sequence was about 100 bp upstream from the start codon of mob and located near several indirect repeats.


View larger version (63K):
[in this window]
[in a new window]
 
FIG. 5.   Alignment of the Tn4555 and pMV158 nick sites with the predicted nick sites of related plasmids. Known nick sites are shown by the arrowhead. GenBank accession numbers for the sequences are as follow: Bacteroides Tn4555, U38243; Bacteroides pBI143, U30316; Bacteroides pIP421, Y10480; Listeria monocytogenes pIP823, U40997; Streptococcus agalactiae pMV158, M28538; Lactobacillus hilgardii pLAB1000, M55222; Streptococcus ferus pVA380-1, M96957; Bacillus subtilis pTA1060, U323380; and Staphylococcus aureus pT181, J01764.

The Bacteroides elements with this oriTTn nick site have related mob genes, and analysis of the gene products shows them to fall into the same phylogenetic group (29, 34). A similarity between these mobilization systems and pMV158 is that the oriT cleavage reactions appear to require a single gene product, not two, as in other transfer systems (e.g., IncP plasmids). This has been shown biochemically for pMV158 (6) and genetically for Tn4555 and NBU1 (11, 29). In contrast, the nick site of the Tn4399 oriT falls into a group with the IncP plasmids (9, 10).

The effect of nick site deletion on pFD576 mobilization. A pFD576 mutation lacking 18 bp surrounding the nick site (Fig. 2) was constructed. As shown in Table 1, plasmids pFD576Delta oriT1 and pFD576Delta oriT2 each transferred at 200- to 500-fold-lower frequency than the pFD576 parent, but it was surprising that the deletion mutants transferred at all. Therefore, we showed that this background transfer was dependent upon an intact MobATn, using pFD648, a plasmid construct lacking an intact mobATn gene (Table 1). Further, relaxed plasmid DNA from a strain carrying pFD576Delta oriT2 did not reveal any evidence for a site- and strand-specific nick (Fig. 3, lanes 6 and 7). The transfer origin for this event is not known, but one possible explanation is that there are one or more oriT-like sites that were used by MobATn and that the frequency was too low to detect by our physical analyses. Working with a derivative of RK2, others also have noted transfer following mutation of an oriT, but no specific alternate nick site was found (26).

It should not be surprising that the mobilizable transposons such as Tn4555 utilize a plasmid type of mobilization system, because the data presented here and elsewhere (28, 29, 33) suggest a model of transposition and mobilization that is based on a circular intermediate. In this model, transfer of Tn4555 would be initiated by excision from the chromosome and formation of a ccc intermediate. DNA processing events would then begin, and this plasmid-like supercoiled DNA would be the target for a MobATn-catalyzed cleavage reaction at the nick site described here. It was surprising to find that the oriT nick site was closely related to pMV158 found in gram-positive bacteria. However, Bacteroides organisms seem to possess a variety of mobilizable genetic elements with components related to both gram-negative and gram-positive organisms. Perhaps this finding reflects the phylogenetic position of Bacteroides; it is believed to have branched from the main eubacterial line of descent prior to the divergence of gram-negative and gram-positive bacteria (35).

    ACKNOWLEDGMENTS

These studies were supported by Public Health Service grant AI28884.

We thank M. Malamy and C. Murphy for helpful suggestions and E. Lanka for discussion on nick site families.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology and Immunology, Moye Blvd., East Carolina University, Greenville, NC 27858. Phone: (919) 816-3127. Fax: (919) 816-3535. E-mail: jsmith{at}brody.med.ecu.edu.

    REFERENCES
Top
Abstract
Text
References

1. Bolivar, F., and K. Backman. 1979. Plasmids of Escherichia coli as cloning vectors. Methods Enzymol. 68:245-267[Medline].
2. Clewell, D. B., and D. R. Helinski. 1969. Supercoiled circular DNA-protein complex in Escherichia coli: purification and induced conversion to an open circular DNA form. Proc. Natl. Acad. Sci. USA 62:1159-1166[Abstract/Free Full Text].
3. Gawron-Burke, C., and D. B. Clewell. 1982. A transposon in Streptococcus faecalis with fertility properties. Nature 300:281-284[Medline].
4. Geissler, S., and M. Drummond. 1993. A counterselectable pACYC184-based lacZalpha -complementing plasmid vector with novel multiple cloning sites: construction of chromosomal deletions in Klebsiella pneumoniae. Gene 136:253-255[Medline].
5. Guiney, D. G., P. Hasegawa, and C. E. Davis. 1984. Plasmid transfer from Escherichia coli to Bacteroides fragilis: differential expression of antibiotic resistance phenotypes. Proc. Natl. Acad. Sci. USA 81:7203-7206[Abstract/Free Full Text].
6. Guzman, L. M., and M. Espinosa. 1997. The mobilization protein, MobM, of the streptococcal plasmid pMV158 specifically cleaves supercoiled DNA at the plasmid oriT. J. Mol. Biol. 266:688-702[Medline].
7. Hecht, D. W., and M. H. Malamy. 1989. Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. J. Bacteriol. 171:3603-3608[Abstract/Free Full Text].
8. Hecht, D. W., J. S. Thompson, and M. H. Malamy. 1989. Characterization of the termini and transposition products of Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis. Proc. Natl. Acad. Sci. USA 86:5340-5344[Abstract/Free Full Text].
9. Lanka, E. 1997. Personal communication.
10. Lanka, E., and B. M. Wilkins. 1995. DNA processing reactions in bacterial conjugation. Annu. Rev. Biochem. 64:141-169[Medline].
11. Li, L.-Y., N. B. Shoemaker, and A. A. Salyers. 1993. Characterization of the mobilization region of a Bacteroides insertion element (NBU1) that is excised and transferred by Bacteroides conjugative transposons. J. Bacteriol. 175:6588-6598[Abstract/Free Full Text].
12. Li, L.-Y., N. B. Shoemaker, G.-R. Wang, S. P. Cole, M. K. Hashimoto, J. Wang, and A. A. Salyers. 1995. The mobilization regions of two integrated Bacteroides elements, NBU1 and NBU2, have only a single mobilization protein and may be on a cassette. J. Bacteriol. 177:3940-3945[Abstract/Free Full Text].
13. Llosa, M., G. Grandoso, and F. de la Cruz. 1995. Nicking activity of TrwC directed against the origin of transfer of the IncW plasmid R388. J. Mol. Biol. 246:54-62[Medline].
14. Mays, T. D., C. J. Smith, R. A. Welch, C. Delfini, and F. L. Macrina. 1982. Novel antibiotic resistance transfer in Bacteroides. Antimicrob. Agents Chemother. 21:110-118[Abstract/Free Full Text].
15. Murphy, C. G., and M. H. Malamy. 1993. Characterization of a "mobilization cassette" in transposon Tn4399 from Bacteroides fragilis. J. Bacteriol. 175:5814-5823[Abstract/Free Full Text].
16. Murphy, C. G., and M. H. Malamy. 1995. Requirements for strand- and site-specific cleavage within the oriT region of Tn4399, a mobilizing transposon from Bacteroides fragilis. J. Bacteriol. 177:3158-3165[Abstract/Free Full Text].
17. Parker, A. C., and C. J. Smith. 1993. Genetic and biochemical analysis of a novel ambler class A beta -lactamase responsible for cefoxitin resistance in Bacteroides species. Antimicrob. Agents Chemother. 37:1028-1036[Abstract/Free Full Text].
18. Provence, D. L., and R. Curtiss, III. 1994. Gene transfer in gram-negative bacteria, p. 317-347. In P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Krieg (ed.), Methods for general and molecular bacteriology. American Society for Microbiology, Washington, D.C.
19. Salyers, A. A., N. B. Shoemaker, A. M. Stevens, and L. Y. Li. 1995. Conjugative transposons: an unusual and diverse set of integrated gene transfer elements. Microbiol. Rev. 59:579-590[Abstract/Free Full Text].
20. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. . Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
21. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
22. Scott, J. R., and G. G. Churchward. 1995. Conjugative transposition. Annu. Rev. Microbiol. 49:367-397[Medline].
23. Shoemaker, N. B., and A. A. Salyers. 1988. Tetracycline-dependent appearance of plasmidlike forms in Bacteroides uniformis 0061 mediated by conjugal Bacteroides tetracycline resistance elements. J. Bacteriol. 170:1651-1657[Abstract/Free Full Text].
24. Shoemaker, N. B., C. Getty, E. P. Guthrie, and A. A. Salyers. 1986. Regions in Bacteroides plasmids pBFTM10 and pB8-51 that allow Escherichia coli-Bacteroides shuttle vectors to be mobilized by plasmids and by a conjugative Bacteroides tetracycline element. J. Bacteriol. 166:959-965[Abstract/Free Full Text].
25. Shoemaker, N. B., G.-R. Wang, and A. A. Salyers. 1996. The Bacteroides mobilizable insertion element, NBU1, integrates into the 3' end of a Leu-tRNA gene and has an integrase that is a member of the lambda integrase family. J. Bacteriol. 178:3594-3600[Abstract/Free Full Text].
26. Sia, E. A., D. M. Kuehner, and D. H. Figurski. 1996. Mechanism of retrotransfer in conjugation: prior transfer of the conjugative plasmid is required. J. Bacteriol. 178:1457-1464[Abstract/Free Full Text].
27. Smith, C. J. 1992. Unpublished data.
28. Smith, C. J., and A. C. Parker. 1993. Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J. Bacteriol. 175:2682-2691[Abstract/Free Full Text].
29. Smith, C. J., and A. C. Parker. 1996. A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol. Microbiol. 20:741-750[Medline].
30. Smith, C. J., L. A. Rollins, and A. C. Parker. 1995. Nucleotide sequence determination and genetic analysis of the Bacteroides plasmid, pBI143. Plasmid 34:211-222[Medline].
31. Smith, C. J., R. A. Welch, and F. L. Macrina. 1982. Two independent conjugal transfer systems operating in Bacteroides fragilis V479-1. J. Bacteriol. 151:281-287[Abstract/Free Full Text].
32. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517[Medline].
33. Tribble, G. D., A. C. Parker, and C. J. Smith. 1997. The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916. J. Bacteriol. 179:2731-2739[Abstract/Free Full Text].
34. Trinh, S., and G. Reysset. 1997. Identification and DNA sequence of the mobilization region of the 5-nitroimidazole resistance plasmid pIP421 from Bacteroides fragilis. J. Bacteriol. 179:4071-4074[Abstract/Free Full Text].
35. Weisburg, W. G., Y. Oyaizu, H. Oyaizu, and C. R. Woese. 1985. Natural relationship between Bacteroides and flavobacteria. J. Bacteriol. 164:230-236[Abstract/Free Full Text].
36. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline].


J Bacteriol, January 1998, p. 435-439, Vol. 180, No. 2
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Grohmann, E., Muth, G., Espinosa, M. (2003). Conjugative Plasmid Transfer in Gram-Positive Bacteria. Microbiol. Mol. Biol. Rev. 67: 277-301 [Abstract] [Full Text]  
  • Bartosik, D., Baj, J., Sochacka, M., Piechucka, E., Wlodarczyk, M. (2002). Molecular characterization of functional modules of plasmid pWKS1 of Paracoccus pantotrophus DSM 11072. Microbiology 148: 2847-2856 [Abstract] [Full Text]  
  • Bass, K. A., Hecht, D. W. (2002). Isolation and Characterization of cLV25, a Bacteroides fragilis Chromosomal Transfer Factor Resembling Multiple Bacteroides sp. Mobilizable Transposons. J. Bacteriol. 184: 1895-1904 [Abstract] [Full Text]  
  • Vedantam, G., Hecht, D. W. (2002). Isolation and Characterization of BTF-37: Chromosomal DNA Captured from Bacteroides fragilis That Confers Self-Transferability and Expresses a Pilus-Like Structure in Bacteroides spp. and Escherichia coli. J. Bacteriol. 184: 728-738 [Abstract] [Full Text]  
  • Szpirer, C. Y., Faelen, M., Couturier, M. (2001). Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1. J. Bacteriol. 183: 2101-2110 [Abstract] [Full Text]  
  • Wang, J., Shoemaker, N. B., Wang, G.-R., Salyers, A. A. (2000). Characterization of a Bacteroides Mobilizable Transposon, NBU2, Which Carries a Functional Lincomycin Resistance Gene. J. Bacteriol. 182: 3559-3571 [Abstract] [Full Text]  
  • Shoemaker, N. B., Wang, G.-R., Salyers, A. A. (2000). Multiple Gene Products and Sequences Required for Excision of the Mobilizable Integrated Bacteroides Element NBU1. J. Bacteriol. 182: 928-936 [Abstract] [Full Text]  
  • Vedantam, G., Novicki, T. J., Hecht, D. W. (1999). Bacteroides fragilis Transfer Factor Tn5520: the Smallest Bacterial Mobilizable Transposon Containing Single Integrase and Mobilization Genes That Function in Escherichia coli. J. Bacteriol. 181: 2564-2571 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, C. J.
Right arrow Articles by Parker, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, C. J.
Right arrow Articles by Parker, A. C.