Department of Microbiology and Immunology,
East Carolina University, Greenville, North Carolina 27858
 |
TEXT |
The spread of antibiotic
resistance is a significant problem in the treatment of
infectious diseases. Historically, plasmids have mediated the majority
of antibiotic resistance transfer, but more recently, conjugative
transposons have been recognized as important vehicles of genetic
exchange. Tn916 (3, 22) and the
Bacteroides tetracycline resistance elements (TET elements) (14, 19) are the best-studied examples of this group.
Another newly recognized, distinct class of transmissible transposons is the mobilizable transposon. These elements are similar to
mobilizable plasmids in that they are not self-transmissible, but they
can transfer between species via conjugation in the presence of a helper element that supplies most of the necessary conjugation functions. Genetic elements in Bacteroides such as
-lactamase transposon Tn4555 (17), the cryptic
Tn4399 (7), and nonreplicating Bacteroides units (NBUs) (23) are the only
documented examples of this class.
Each of the mobilizable transposons studied thus far is unique,
utilizing a variety of mechanisms for transposition (8, 25,
31). However, these transposons seem to have some similarities in
their mobilization strategies in that they all can be mobilized by the
TET elements or other cryptic conjugation elements in
Bacteroides. Tn4555 and the NBUs share a related
mob gene (mobATn for
Tn4555) that codes for a protein distantly related to the
RP4 TraI relaxase family (29). Interestingly, this appears
to be the only protein coding gene required for mobilization (11,
29). In contrast, Tn4399 requires two proteins for
optimal transfer efficiency (15, 16). One of these, MocA, is
closely related to TraI, falling into the same phylogenetic group as
TraI from RP4 and related IncP gram-negative plasmids, which also
require two gene products for mobilization (29).
Comparison of the mobilization regions of Tn4555 and NBU1
has revealed 78% sequence identity over a 1.6-kb region. The regions of high sequence identity end abruptly, and it is possible that these
are genetic cassettes that can recombine into a variety of locations.
This is clearly the case with the Bacteroides plasmid pBI143, in which the mobilization region is bounded by large inverted repeat structures and has a G+C percentage that is different than that
for the rest of the plasmid (30). If the mobilization of these novel transposons is similar to other transmissible systems, then
a complete mobilization cassette should include the
cis-acting transfer origin. The goal of the present work was
to characterize this region on Tn4555.
Escherichia coli DH5
[endA1 recA1 hsdR17
deoR, thi-1 supE44 gyrA96 relA1
(lacZYA-argF)] was used for DNA manipulations. Routine plasmid preparations, restriction digests, ligations, and
alkaline agarose gel electrophoresis were performed as described previously (20). Alkaline agarose gels were electrophoresed at 1 V/cm and 4°C for 40 h in buffer containing 50 mM NaOH and 1 mM EDTA. DNA filter blots of alkaline agarose gels were prepared by
capillary action of the neutralized gels (32). The filters then were hybridized to oligonucleotide probes that had been end labeled with [
-32P]ATP using T4 polynucleotide
kinase according to standard protocols (20). DNA sequencing
reactions were performed by the dideoxy chain termination method
(21) with modified T7 polymerase and other reagents in the
Sequenase kit (U.S. Biochemical, Cleveland, Ohio). Nicked circular DNA
was isolated by the basic method of Clewell and Helinski (2)
with several modifications (16). A final purification of the
nicked DNA was performed by cesium chloride-ethidium bromide
equilibrium ultracentrifugation (20).
The model plasmid used in our studies was pFD576. To construct pFD576,
the 7.5-kb Sau3AI fragment from pJST61 (17) was
inserted into the BamHI site of pUC19 (36). DNA
sequences downstream of mobATn were deleted by
digestion with ClaI and XbaI, followed by a
fill-in reaction with Klenow fragment of DNA polymerase I and ligation
with T4 DNA ligase (20). The regions upstream of mobATn were deleted in a similar manner except
that SmaI and StyI were used (Fig.
1). Plasmid pFD601 was constructed by
excising the 285-bp oriTTn PCR fragment from
pFD556 (29) with SstI and SphI and
subcloning it into the low-copy-number Cmr vector pSG335
(4) (Fig. 1). Site-directed mutagenesis of the nick site was
accomplished by making a short deletion with the QuikChange system from
Stratagene (La Jolla, Calif.). The template used was pFD576, and the
mutagenic oligonucleotide was
GCGGAGCGTGTAGTTATAAAGCCATTGTCTGCAAACTCC and its complement
(Fig. 2, bp 28 to 84). To construct
pFD648, the mobA gene of pFD576
oriT2 was deleted by
removal of an internal HindIII fragment (Fig. 1).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Partial restriction maps of plasmids used in the
Tn4555 transfer studies showing relevant restriction sites
and genes. The thin black lines represent the cloning vector pUC19 for
pFD576 and pFD648 and the cloning vector pSG335 for pFD601. Genes are
indicated by open boxes, with arrows showing the direction of
transcription. The small hatched boxes indicate the location of the
PCR-285 sequences, and the
symbol shows the location of the oriTTn nick
site. In the case of pFD648, the mutated oriTTn
nick site is indicated by the
symbol. The restriction sites indicated by the asterisk were eliminated
by blunt-end ligation, and the mobA* gene was truncated as
indicated in the text. Approximate locations of the oligonucleotide
primers used in this work are shown by the arrowheads over the map of
pFD576.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide sequence of oriTTn.
The site of the strand-specific nick is indicated by the arrowhead over
the sequence, and the dark line under the sequence indicates the region
deleted in pFD576 oriT1 and oriT2. The bold, underlined sequence
(bp 1 to 57) indicates nucleotides identical to the mobilization region
of NBU1 (29). The dashed lines over the sequence mark
regions of dyad symmetry. The location of primer 2F is indicated with
an arrow, but note that the actual sequence shown is the complement to
this primer.
|
|
Mobilization of pFD576 and pFD601 in E. coli.
It has
been demonstrated previously that some Bacteroides elements
can be mobilized by IncP
plasmids such as RK2, provided the
Bacteroides-specific mobilization gene(s) is present
(15, 24). Therefore, pFD576 containing the Tn4555
mobATn gene and the adjacent
oriTTn region was tested for mobilization by the RK2 derivative RK231. The results (Table
1) showed that transfer occurred at a
high frequency but the vector alone (pUC19) did not transfer at
detectable frequencies (27).
A fundamental feature of mobilization is the presence of a
cis-acting region (oriT) that is required for
transfer. This region is the initiation site of DNA processing at which
a site- and strand-specific nick is made in the plasmid to start the
transfer event. In a previous study with Bacteroides donor
strains, the cis-acting region of Tn4555 was
localized to a 285-bp fragment (designated PCR-285) (29). In
order to show that the same region worked in the E. coli
system, pFD601 (Cmr) containing PCR-285 was constructed. As
shown in Table 1, when mobATn was in
trans on pFD576, pFD601 transferred at a frequency of
2.9 × 10
3 to 3.3 × 10
3. The
transfer frequency was much lower than when pFD576 was transferred from
the same strain (compare lines 3 and 4 in Table 1). This difference in
transfer frequency may be due to the lower copy number of pFD601 or to
a less efficient diffusion of the mobATn gene
product in the two-plasmid system. pFD601 required the presence of
mobATn and did not transfer in the absence of
pFD576.
Identification of the Tn4555 nick site.
Nicked,
circular pFD576 DNA was restricted with either EcoRI or
SalI, electrophoresed on an alkaline agarose gel,
transferred to nylon filters, and hybridized to a specific
oligonucleotide probe. As seen in Fig.
3A, the predicted sizes for the DNA
fragments of plasmid nicked in the region of
oriTTn were similar regardless of which
restriction enzyme was used, and the expected pattern was observed on
the alkaline gels. The covalently closed circular (ccc) form of pFD576
yielded only a single fragment (Fig. 3B, lanes 1 through 4). When
hybridized to probe 2F, a single hybridizing band was expected,
depending on the restriction enzyme. The results shown in Fig. 3C
indicated that the bottom strand was nicked, resulting in hybridization
to either the 1.8-kb EcoRI fragment (lane 2) or the 4.5-kb
SalI fragment (lane 4). In both cases there was substantial
hybridization to the largest fragment corresponding to the 6.5-kb
unnicked DNA. It is likely that this background was due to the random
nicking of the DNA, which occurs during the purification of relaxed
plasmid DNA. The sizes of the restriction fragments that hybridized to
the probe showed that the location of the oriTTn
nick site was within the PCR-285 region and that cleavage was strand
specific. Consistent with the probe 2F results, probe 1R, which is
complementary to the DNA strand opposite of probe 2F, was found to
hybridize only with the largest fragment, irrespective of the
restriction enzyme used (Fig. 3D). This unnicked hybridizing DNA
corresponds to the upper strand on the map in Fig. 3A.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
Alkaline agarose gel electrophoresis and hybridization
analysis of ccc and specifically nicked pFD576. (A) Partial restriction
map of EcoRI- or SalI-digested pFD576 indicating
the DNA fragment sizes expected for denaturing gel electrophoresis. The
top strand is shown by a solid line and the bottom, nicked strand is
shown by a dashed line. (B) Alkaline agarose gel. The white marks show
the fragments that hybridized to probe 2F. (C) Autoradiograph from
filter blot hybridization analysis of gel in panel A probed with
oligonucleotide 2F. (D) Autoradiograph from filter blot hybridization
analysis of gel similar to that shown in panel A probed with
oligonucleotide 1R. Lane 1, EcoRI ccc pFD576; lane 2, EcoRI nicked pFD576; lane 3, SalI ccc pFD576;
lane 4, SalI nicked pFD576; lane 5, 1-kb ladder size
standard; lane 6, EcoRI ccc pFD576 oriT1; lane 7, EcoRI nicked pFD576 oriT1.
|
|
The 5' end of the cleavage site was mapped by nucleotide sequence
analysis of nicked pFD576 plasmid DNA with oligonucleotide 2F as the
primer for these reactions. As shown in Fig.
4, two distinct stops were seen in all
lanes when the relaxed plasmid preparation was used for the template
but not when the ccc plasmid DNA was used (compare panels A and B).
This result corresponds to the G (bp 50) and C (bp 51), both of which
were of equal intensity. It is possible that both sites are utilized by
the enzyme; however, another possibility is that the band corresponding
to the C residue is due to an additional nucleotide added on to the end
of the DNA strand by the terminal transferase activity of the modified T7 DNA polymerase. Similar observations have been made previously with
these types of reactions with Sequenase (6, 13). The location of the nick site was verified with a single DNA strand corresponding to the 4.5-kb SalI fragment that had been
isolated from an alkaline agarose gel. As shown in Fig. 4B, the
sequencing reactions mapped the 5' end to the same two bases. In
another confirmation of this nick site location, primer extension with oligonucleotide 1F yielded identical results (27).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 4.
Determination of the 5' end of the
oriTTn nick site. (A) Nicked, pFD576 DNA was
used as a template for DNA sequencing reactions with the primer 2F. (B)
In the first four lanes, supercoiled ccc pFD576 DNA was used as a
template for DNA sequencing reactions with primer 2F. In the last four
lanes, a 4.5-kb fragment from SalI-digested nicked pFD576
was purified from an alkaline gel and used as a template in DNA
sequencing reactions with primer 2F. The arrow indicates the terminus
of the nicked DNA strand.
|
|
Nucleotide sequence analysis of the nick site.
The nick site
was located in a region of Tn4555 that was at the very end
of its homology with NBU1 and NBU2. Although this is not the location
previously thought to contain the NBU oriT, based on
nucleotide sequence comparisons (11, 12), it is likely that
this nick site is used, since it was shown previously that NBU1
mob can substitute for mobATn
(29). Inspection of the oriTTn primary DNA sequence revealed several features common to
oriTs (10). These include the presence of
inverted repeat sequences adjacent to the nick site, a higher AT
content than the surrounding area, and a location near other
mobilization genes (Fig. 1 and 2). In addition, the sequence
surrounding the nick site itself was similar to the oriT of
a streptococcal TET resistance plasmid, pMV158 (6). pMV158
is representative of a new oriT family made up of
gram-positive, mobilizable plasmids that replicate by the rolling
circle mechanism (6, 10). The pMV158 oriT is
located in the RSA sequence, which is conserved in many
mobilizable gram-positive plasmids. An alignment of these sequences
from a representative group of these plasmids is shown in Fig.
5. Included with the alignment are
potential oriT nick sites from two mobilizable
Bacteroides plasmids. These were identified by using the
oriTTn sequence as a query in searches of pBI143
and pIP421. In each case, one significant homologous region was found,
and these were located in appropriate regions.
oriT143 was located at bp 2661 to 2679 adjacent
to an inverted repeat sequence just upstream from
mobA143. This region was required in
cis for the transfer of pBI143 (29, 30).
Likewise, in a 217-bp region of pIP421 (bp 450 to 468) known to be
required in cis for transfer (34), there was
significant homology (16 of 19 bases) to oriTTn
(Fig. 5). This sequence was about 100 bp upstream from the start codon
of mob and located near several indirect repeats.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 5.
Alignment of the Tn4555 and pMV158 nick sites
with the predicted nick sites of related plasmids. Known nick sites are
shown by the arrowhead. GenBank accession numbers for the
sequences are as follow: Bacteroides Tn4555,
U38243; Bacteroides pBI143, U30316;
Bacteroides pIP421, Y10480; Listeria
monocytogenes pIP823, U40997; Streptococcus agalactiae
pMV158, M28538; Lactobacillus hilgardii pLAB1000, M55222;
Streptococcus ferus pVA380-1, M96957; Bacillus
subtilis pTA1060, U323380; and Staphylococcus aureus
pT181, J01764.
|
|
The Bacteroides elements with this
oriTTn nick site have related mob
genes, and analysis of the gene products shows them to fall into the
same phylogenetic group (29, 34). A similarity between these mobilization systems and pMV158 is that the
oriT cleavage reactions appear to require a single gene
product, not two, as in other transfer systems (e.g., IncP plasmids).
This has been shown biochemically for pMV158 (6) and
genetically for Tn4555 and NBU1 (11, 29). In
contrast, the nick site of the Tn4399 oriT falls into a
group with the IncP plasmids (9, 10).
The effect of nick site deletion on pFD576 mobilization.
A pFD576 mutation lacking 18 bp surrounding the nick site
(Fig. 2) was constructed. As shown in Table 1, plasmids
pFD576
oriT1 and pFD576
oriT2 each transferred at 200- to
500-fold-lower frequency than the pFD576 parent, but it was surprising
that the deletion mutants transferred at all. Therefore, we showed that
this background transfer was dependent upon an intact
MobATn, using pFD648, a plasmid construct lacking an intact
mobATn gene (Table 1). Further, relaxed plasmid
DNA from a strain carrying pFD576
oriT2 did not reveal any evidence
for a site- and strand-specific nick (Fig. 3, lanes 6 and 7). The
transfer origin for this event is not known, but one possible
explanation is that there are one or more oriT-like sites
that were used by MobATn and that the frequency was too low
to detect by our physical analyses. Working with a derivative of RK2,
others also have noted transfer following mutation of an
oriT, but no specific alternate nick site was found
(26).
It should not be surprising that the mobilizable transposons such as
Tn4555 utilize a plasmid type of mobilization system, because the data presented here and elsewhere (28, 29, 33) suggest a model of transposition and mobilization that is based on a
circular intermediate. In this model, transfer of Tn4555 would be initiated by excision from the chromosome and formation of a
ccc intermediate. DNA processing events would then begin, and this
plasmid-like supercoiled DNA would be the target for a
MobATn-catalyzed cleavage reaction at the nick site
described here. It was surprising to find that the oriT nick
site was closely related to pMV158 found in gram-positive bacteria.
However, Bacteroides organisms seem to possess a variety of
mobilizable genetic elements with components related to both
gram-negative and gram-positive organisms. Perhaps this finding
reflects the phylogenetic position of Bacteroides; it is
believed to have branched from the main eubacterial line of descent
prior to the divergence of gram-negative and gram-positive bacteria
(35).
These studies were supported by Public Health Service grant
AI28884.
We thank M. Malamy and C. Murphy for helpful suggestions and E. Lanka
for discussion on nick site families.
| 1.
|
Bolivar, F., and K. Backman.
1979.
Plasmids of Escherichia coli as cloning vectors.
Methods Enzymol.
68:245-267[Medline].
|
| 2.
|
Clewell, D. B., and D. R. Helinski.
1969.
Supercoiled circular DNA-protein complex in Escherichia coli: purification and induced conversion to an open circular DNA form.
Proc. Natl. Acad. Sci. USA
62:1159-1166[Abstract/Free Full Text].
|
| 3.
|
Gawron-Burke, C., and D. B. Clewell.
1982.
A transposon in Streptococcus faecalis with fertility properties.
Nature
300:281-284[Medline].
|
| 4.
|
Geissler, S., and M. Drummond.
1993.
A counterselectable pACYC184-based lacZ -complementing plasmid vector with novel multiple cloning sites: construction of chromosomal deletions in Klebsiella pneumoniae.
Gene
136:253-255[Medline].
|
| 5.
|
Guiney, D. G.,
P. Hasegawa, and C. E. Davis.
1984.
Plasmid transfer from Escherichia coli to Bacteroides fragilis: differential expression of antibiotic resistance phenotypes.
Proc. Natl. Acad. Sci. USA
81:7203-7206[Abstract/Free Full Text].
|
| 6.
|
Guzman, L. M., and M. Espinosa.
1997.
The mobilization protein, MobM, of the streptococcal plasmid pMV158 specifically cleaves supercoiled DNA at the plasmid oriT.
J. Mol. Biol.
266:688-702[Medline].
|
| 7.
|
Hecht, D. W., and M. H. Malamy.
1989.
Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis.
J. Bacteriol.
171:3603-3608[Abstract/Free Full Text].
|
| 8.
|
Hecht, D. W.,
J. S. Thompson, and M. H. Malamy.
1989.
Characterization of the termini and transposition products of Tn4399, a conjugal mobilizing transposon of Bacteroides fragilis.
Proc. Natl. Acad. Sci. USA
86:5340-5344[Abstract/Free Full Text].
|
| 9.
| Lanka, E. 1997. Personal communication.
|
| 10.
|
Lanka, E., and B. M. Wilkins.
1995.
DNA processing reactions in bacterial conjugation.
Annu. Rev. Biochem.
64:141-169[Medline].
|
| 11.
|
Li, L.-Y.,
N. B. Shoemaker, and A. A. Salyers.
1993.
Characterization of the mobilization region of a Bacteroides insertion element (NBU1) that is excised and transferred by Bacteroides conjugative transposons.
J. Bacteriol.
175:6588-6598[Abstract/Free Full Text].
|
| 12.
|
Li, L.-Y.,
N. B. Shoemaker,
G.-R. Wang,
S. P. Cole,
M. K. Hashimoto,
J. Wang, and A. A. Salyers.
1995.
The mobilization regions of two integrated Bacteroides elements, NBU1 and NBU2, have only a single mobilization protein and may be on a cassette.
J. Bacteriol.
177:3940-3945[Abstract/Free Full Text].
|
| 13.
|
Llosa, M.,
G. Grandoso, and F. de la Cruz.
1995.
Nicking activity of TrwC directed against the origin of transfer of the IncW plasmid R388.
J. Mol. Biol.
246:54-62[Medline].
|
| 14.
|
Mays, T. D.,
C. J. Smith,
R. A. Welch,
C. Delfini, and F. L. Macrina.
1982.
Novel antibiotic resistance transfer in Bacteroides.
Antimicrob. Agents Chemother.
21:110-118[Abstract/Free Full Text].
|
| 15.
|
Murphy, C. G., and M. H. Malamy.
1993.
Characterization of a "mobilization cassette" in transposon Tn4399 from Bacteroides fragilis.
J. Bacteriol.
175:5814-5823[Abstract/Free Full Text].
|
| 16.
|
Murphy, C. G., and M. H. Malamy.
1995.
Requirements for strand- and site-specific cleavage within the oriT region of Tn4399, a mobilizing transposon from Bacteroides fragilis.
J. Bacteriol.
177:3158-3165[Abstract/Free Full Text].
|
| 17.
|
Parker, A. C., and C. J. Smith.
1993.
Genetic and biochemical analysis of a novel ambler class A -lactamase responsible for cefoxitin resistance in Bacteroides species.
Antimicrob. Agents Chemother.
37:1028-1036[Abstract/Free Full Text].
|
| 18.
|
Provence, D. L., and R. Curtiss, III.
1994.
Gene transfer in gram-negative bacteria, p. 317-347. In
P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Krieg (ed.), Methods for general and molecular bacteriology.
American Society for Microbiology, Washington, D.C.
|
| 19.
|
Salyers, A. A.,
N. B. Shoemaker,
A. M. Stevens, and L. Y. Li.
1995.
Conjugative transposons: an unusual and diverse set of integrated gene transfer elements.
Microbiol. Rev.
59:579-590[Abstract/Free Full Text].
|
| 20.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 21.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 22.
|
Scott, J. R., and G. G. Churchward.
1995.
Conjugative transposition.
Annu. Rev. Microbiol.
49:367-397[Medline].
|
| 23.
|
Shoemaker, N. B., and A. A. Salyers.
1988.
Tetracycline-dependent appearance of plasmidlike forms in Bacteroides uniformis 0061 mediated by conjugal Bacteroides tetracycline resistance elements.
J. Bacteriol.
170:1651-1657[Abstract/Free Full Text].
|
| 24.
|
Shoemaker, N. B.,
C. Getty,
E. P. Guthrie, and A. A. Salyers.
1986.
Regions in Bacteroides plasmids pBFTM10 and pB8-51 that allow Escherichia coli-Bacteroides shuttle vectors to be mobilized by plasmids and by a conjugative Bacteroides tetracycline element.
J. Bacteriol.
166:959-965[Abstract/Free Full Text].
|
| 25.
|
Shoemaker, N. B.,
G.-R. Wang, and A. A. Salyers.
1996.
The Bacteroides mobilizable insertion element, NBU1, integrates into the 3' end of a Leu-tRNA gene and has an integrase that is a member of the lambda integrase family.
J. Bacteriol.
178:3594-3600[Abstract/Free Full Text].
|
| 26.
|
Sia, E. A.,
D. M. Kuehner, and D. H. Figurski.
1996.
Mechanism of retrotransfer in conjugation: prior transfer of the conjugative plasmid is required.
J. Bacteriol.
178:1457-1464[Abstract/Free Full Text].
|
| 27.
| Smith, C. J. 1992. Unpublished data.
|
| 28.
|
Smith, C. J., and A. C. Parker.
1993.
Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp.
J. Bacteriol.
175:2682-2691[Abstract/Free Full Text].
|
| 29.
|
Smith, C. J., and A. C. Parker.
1996.
A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids.
Mol. Microbiol.
20:741-750[Medline].
|
| 30.
|
Smith, C. J.,
L. A. Rollins, and A. C. Parker.
1995.
Nucleotide sequence determination and genetic analysis of the Bacteroides plasmid, pBI143.
Plasmid
34:211-222[Medline].
|
| 31.
|
Smith, C. J.,
R. A. Welch, and F. L. Macrina.
1982.
Two independent conjugal transfer systems operating in Bacteroides fragilis V479-1.
J. Bacteriol.
151:281-287[Abstract/Free Full Text].
|
| 32.
|
Southern, E. M.
1975.
Detection of specific sequences among DNA fragments separated by gel electrophoresis.
J. Mol. Biol.
98:503-517[Medline].
|
| 33.
|
Tribble, G. D.,
A. C. Parker, and C. J. Smith.
1997.
The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916.
J. Bacteriol.
179:2731-2739[Abstract/Free Full Text].
|
| 34.
|
Trinh, S., and G. Reysset.
1997.
Identification and DNA sequence of the mobilization region of the 5-nitroimidazole resistance plasmid pIP421 from Bacteroides fragilis.
J. Bacteriol.
179:4071-4074[Abstract/Free Full Text].
|
| 35.
|
Weisburg, W. G.,
Y. Oyaizu,
H. Oyaizu, and C. R. Woese.
1985.
Natural relationship between Bacteroides and flavobacteria.
J. Bacteriol.
164:230-236[Abstract/Free Full Text].
|
| 36.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|