INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

The opportunistic pathogen Candida albicans is a fungus that exists in a diverse range of associations with its human or animal host. C. albicans can survive in the host without overt disease symptoms and, under the appropriate circumstances, can cause disease that varies in site and severity. C. albicans infection can be localized and superficial or systemic and disseminated to a wide range of organs (reviewed in reference 43). This complexity of interactions of C. albicans with its host suggests that the fungus possesses numerous mechanisms to adapt to this diversity of host sites, a versatility undoubtedly controlled by differential gene expression. Much investigative effort has focused on defining molecular mechanisms C. albicans uses for growth and pathogenesis. One attribute of the fungus that is positively correlated with pathogenicity is adherence (reviewed in reference 7). Adherent strains of C. albicans are more virulent than those with a less-adhesive nature. Additionally, a hierarchy exists among Candida species, with the more frequently isolated pathogenic species exhibiting greater adhesive capacity (reviewed in reference 7). Adherence of C. albicans to host surfaces is also involved in the process of colonization, which may occur without accompanying pathogenesis. Investigations to understand C. albicans adhesion have involved characterization of the cell surface, since this is the initial point of contact between fungus and host (reviewed in references 7, 9, 17, 23, and 29). Adherence of C. albicans to numerous cell types, cellular components, and nonliving substances has been examined to further define adhesive relationships. Numerous obstacles exist to hamper the study of C. albicans adhesion, including widely noted growth-medium-dependent effects and differences between C. albicans strains tested in the same assay (reviewed in references 15, 30, and 45). Despite these obstacles, several C. albicans molecules involved in adhesive interactions have been identified (reviewed in references 7, 9, 17 and 23).

Characterization of the C. albicans ALS gene family has yielded data that address the major themes discussed above. The first gene in the ALS family, ALS1, was isolated in a differential screen to identify hypha-specific genes (26). Although subsequent studies demonstrated that ALS1 is not strictly hypha-specific, its sequence has significant identity with the sequence of AG1 from Saccharomyces cerevisiae, which encodes -agglutinin, a cell-surface adhesion glycoprotein that facilitates contact between haploid cells during mating (19, 37). Because C. albicans has not been observed to undergo meiosis or mating, it may be less likely that the function of Als1p is directly analogous to that of Ag1p (26). However, conservation between sequences required for the adhesive function of -agglutinin and those at the N terminus of Als1p raised the intriguing possibility that Als1p is an adhesion glycoprotein (26). Data supporting this conclusion have been published recently (16, 18).

In addition to its potential to encode an adhesion glycoprotein, other features of ALS1 prompted further study. ALS1 encodes a central domain of tandemly repeated copies of a highly conserved 108-bp sequence that, when translated, predicts a highly conserved 36-amino-acid motif (26). The tandem-repeat sequence hybridizes to several genomic fragments from C. albicans, suggesting that ALS1 belongs to a gene family (26). The existence of a gene family defined by the tandem-repeat-hybridizing fragments was demonstrated by the characterization of ALS3 (25). The size of the ALS family is difficult to estimate because of the presence of additional tandem-repeat-hybridizing fragments and of other genomic sequences that hybridize to a probe derived from the 5' end of ALS1 (25, 26).

Experiments to characterize the ALS genes and to understand their regulation were initially undertaken to lay the groundwork for studying Als protein function in C. albicans. Studying Als protein function in C. albicans is challenging because, assuming redundancy of function among proteins in the family, creation of a truly null mutant requires characterization of the entire family and disruption of many genes. We reasoned that the number of gene disruption steps could be reduced by knowing which genes were expressed under a particular growth condition. Combining a particular growth condition with specific disruptions could effectively create a null mutant. Studies of ALS gene regulation demonstrated that ALS1 and ALS3 are differentially expressed (25, 26). ALS1 expression in vitro is regulated by components of growth media, and ALS3 is hypha-specific (25, 26). In addition, expression of ALS1 was shown to vary among strains of C. albicans (25).

In this study, we present data to further characterize the ALS genes and their encoded proteins. Two new genes, ALS2 and ALS4, are described. Similar to previously characterized ALS genes, ALS2 and ALS4 are shown to be differentially regulated. Comparison of ALS gene sequences yielded a generalized ALS gene structure that fits another C. albicans gene, ALA1 (18). Here, we recognize the place of ALA1 in the ALS family. Analysis of sequence features of the five predicted Als proteins suggests that they are localized on the C. albicans cell surface, a property demonstrated by indirect immunofluorescence with an anti-Als antiserum. Taken together, the data presented here demonstrate that the cell-surface-localized Als proteins could account for a significant portion of the strain- and growth-medium-dependent differences in adhesion commonly noted in the C. albicans literature.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Media and strains. All standard growth media and strains were described previously (25, 26). C. albicans B311 used in this study was purchased from the American Type Culture Collection; other isolates of B311 used in previous studies were not used here.

Library screening and DNA sequencing of ALS genes. Construction of the fosmid library and PCR screening with primers specific for the consensus tandem-repeat sequence were described previously (25). Fosmids that were positive in the PCR screen were grouped on the basis of PCR products (25); a representative fosmid was chosen from each group for subcloning and DNA sequencing of each ALS allele. Fosmids chosen were 19F-1 (ALS2-1), 20F-3 (ALS2-2), 20E-6 (ALS4-1), and 29F-9 (ALS4-2). These fosmids were purified and digested with a variety of restriction enzymes. Southern blots of these digests were probed with an 870-bp KpnI fragment from ALS1 that encodes only tandem-repeat sequences (26) to identify fragments likely to encode related ALS genes. These fragments were subcloned into pUC vectors (57) and transformed into Escherichia coli DH5MCR (Gibco BRL). Plasmid purification and DNA sequencing were conducted as described previously (26). DNA sequencing of the tandem-repeat regions of ALS genes was limited to that required to determine that the tandem repeats conformed to the consensus pattern derived from ALS1 and that the tandem-repeat domain did not encode anything besides head-to-tail copies of the 108-bp sequence. This was accomplished with a combination of repeat-region subclones and production of nested deletions with a double-stranded nested deletion kit (Amersham Pharmacia Biotech). Sequences were reported as domains 5' and 3' of the tandem-repeat domain. Both alleles of ALS2 and ALS4 from C. albicans 1161 were sequenced and deposited separately. Accession numbers for other sequences discussed here include L25902 (ALS1 [26]), U87856 (ALS3 [25]), and AF025429 (ALA1/ALS5 [18]).

ALS2- and ALS4-specific probes. A 164-bp fragment located immediately 3' of the tandem-repeat domain was amplified by PCR and found to detect both ALS2 and ALS4. This PCR fragment was amplified with the forward primer 5' TCCGAGTCCATTCCAGTACTAA 3' and the reverse primer 5' GTTACAGCATCACTAGAAGGAATATC 3'. The standard PCR for these primers and others described below included 1 µM (each) primer, 0.2 mM (each) deoxynucleoside triphosphate, 1.5 mM MgCl₂, 1× Promega PCR buffer, 2.5 U of Promega Taq DNA polymerase, and 10 to 100 ng of template DNA.

ALS5 probe. A probe encoding only tandem-repeat sequences from ALA1/ALS5 (18) was synthesized by PCR with the forward primer 5' GGTACAAGTTCCACTGCCAAA 3' and the reverse primer 5' AAGACAGTTCTTCCAATGGATCA 3'. These primers amplified two products from genomic DNA of C. albicans 1177, one at approximately 200 bp and the other at approximately 680 bp. These two products were presumably due to amplification of tandem-repeat regions from each allele of ALS5 in this strain. The 680-bp fragment was cloned into pCR2.1 (Invitrogen) and transformed into E. coli TOP10F' cells (Invitrogen). The DNA sequence of the cloned PCR fragment conformed to the consensus tandem-repeat sequence of ALS5 (18).

Nucleic acid blots. Southern blotting was performed as described previously (26) with the digoxigenin nonradioactive nucleic acid labeling and detection system (Boehringer Mannheim). Blots probed with the ALS1 or ALS5 tandem-repeat sequence were hybridized at 65°C overnight. Blots were washed in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS) at room temperature for 30 min and then with 0.5× SSC-0.1% SDS at 65°C for 1 h.

Production of anti-Als antiserum. Hyperimmune anti-Als serum raised in a New Zealand White rabbit was a gift from George Livi (SmithKline Beecham Pharmaceuticals). The anti-Als serum was raised against four 10-mer peptides derived from the N-terminal domain of Als1p (26). These peptides were chosen because they were likely to be in a hydrophilic, surface-exposed region of the mature, folded protein as predicted by secondary-structure algorithms (14). Peptides from the N-terminal region of Als1p were selected because this portion of the protein was predicted to be relatively free of glycosylation compared to other regions of the protein (26). The peptides selected were GWSLDGTSAN (amino acids 53 to 62), FYSGEEFTTF (amino acids 98 to 107), TGSSTDLEDS (amino acids 139 to 148), and NTVTFNDGDK (amino acids 156 to 165). These peptides were linked to keyhole limpet hemocyanin (KLH) and combined in equal quantities prior to emulsification in Freund's complete adjuvant (Sigma). The emulsion was injected into the rabbit at multiple subcutaneous sites. A blood sample was collected from the marginal ear vein 14 days later. A booster immunization was administered 4 weeks after the initial immunization. The booster immunization was performed with the mixture of four KLH-linked peptides emulsified in incomplete Freund's adjuvant (Sigma). A blood sample was collected 14 days after the booster immunization, and the anti-Als titer was assayed on a Western blot of a heterologously produced soluble N-terminal fragment of Als1p (see below). Four total-booster injections were performed, with the anti-Als titer increasing following each round. Increasing titer was judged by increasing dilutions of serum required to obtain an equivalent Western blot signal. Serum collected from the rabbit was stored in small aliquots at 80°C. Preimmune serum collected from the same rabbit in which the anti-Als serum was raised and a commercially purchased anti-KLH serum (ICN) were both utilized as negative controls.

Indirect immunofluorescence of C. albicans cells. Cells of strain SC5314 were grown in YPD until they reached late stationary phase; at this stage of growth, cultures typically have a density of approximately 5 × 10⁸ cells/ml. Cells from this culture were washed twice in phosphate-buffered saline (PBS) (per liter: 10 g of NaCl, 0.25 g of KCl, and 1.43 g of Na₂HPO₄ [pH 7.2 to 7.3]) and counted. A fresh culture of RPMI 1640 (catalog no. 11875-085; Gibco BRL) was inoculated at a density of 5 × 10⁶ cells/ml. This culture was incubated at 37°C and 120 rpm for 1 h 45 min. One hundred microliters of this culture was spread into an area of a cleaned glass slide that had been delineated by etching with a diamond pen. Slides were washed thoroughly in PBS before we proceeded. Slides were blocked with 200 µl of 1.5% normal goat serum (Jackson Research Laboratories) diluted in PBS and incubated for 10 min at room temperature in a humid chamber. Excess normal serum was drained from slides, and 200 µl of a primary antibody solution was added. Two different primary antisera were used, a 1:100 dilution of the anti-Als serum purified on a protein G column according to the manufacturer's instructions (MAbTrap G II column; Amersham Pharmacia Biotech) and a 1:500 dilution of the preimmune serum from the rabbit in which anti-Als serum was raised. Immunoglobulin G (IgG) concentrations of these preparations were roughly equivalent; a lower dilution of the protein-G-purified serum was used to account for the dilution that occurs during the purification procedure. Primary antiserum was incubated on slides for 1 h at 4°C in a humid chamber. Slides were washed thoroughly in ice-cold PBS. The secondary antibody, fluorescein-isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (heavy plus light chains) (catalog no. 111-095-003; Jackson Research Laboratories) was diluted 1:2,500 from a 0.75 mg/ml stock and incubated on slides for 1 h at 4°C in a humid chamber. Slides were washed thoroughly in ice-cold PBS and stored in darkness at 4°C until they were viewed later the same day.

Heterologous expression of an N-terminal fragment of Als1p in S. cerevisiae. A PCR product encoding the N-terminal 433 amino acids of Als1p was produced with the forward primer 5' CCCCCCCATGGTTCAACAATTTACATTGTTATTCCTATA 3' and the reverse primer 5' CCCCCGTCGACCAGTGGAACTTGTACCACCACTGTGTCA 3'. The PCR product derived from C. albicans B311 genomic DNA was digested with NcoI and SalI and cloned into the NcoI-SalI-digested S. cerevisiae expression vector p138NB. Features of this vector have been described previously (38, 42). Briefly, the expression vector contains the TRP1 selectable marker and partial 2µm sequences for maintenance at high copy number. Expression is driven by the copper-inducible CUP1 gene promoter. A multiple cloning site is present in the vector downstream of the CUP1 promoter and upstream of the CYC1 transcription terminator. Shuttle vector functions allowed a correct construct, pLH109, to be selected in E. coli DH5MCR (Gibco BRL). Plasmid pLH109 was transformed into the S. cerevisiae strain YPH 274 (a/ ura3-52/ura3-52 lys2-801^amber/lys2-801^amber ade2-101^ochre/ade2-101^ochre trp1-1/trp1-1 his3-200/his3-200 leu2-1/leu2-1 [50]). The resulting S. cerevisiae strain was grown in synthetic complete medium without tryptophan (22). A 500-ml culture was grown to late stationary phase at 30°C. Cells were harvested from this culture, washed twice in fresh synthetic complete medium without tryptophan, and resuspended in 30 ml of fresh medium. Expression from the CUP1 promoter was induced by the addition of 150 µM CuSO₄. Induced cells were grown for 4 h at 30°C with 200 rpm shaking. Cells were collected by centrifugation, and the resulting culture supernatant was brought to 70% saturation with ammonium sulfate to precipitate proteins, including the secreted N-terminal portion of Als1p. The ammonium sulfate precipitation was incubated overnight at 4°C on a rocker platform and then harvested by centrifugation at 15,000 rpm (31,000 × g) for 30 min in a Beckman JA-17 rotor. Supernatant was decanted, and the precipitate was dissolved in PBS. The dissolved precipitate was thoroughly dialyzed against PBS in 12,000- to 14,000- molecular-weight-cutoff dialysis tubing (Spectrum Laboratories, Inc.). The dialysate was concentrated in a Centricon-10 unit (Amicon, Inc.) and run on a 12.5% Tris-glycine polyacrylamide gel (31). S. cerevisiae YPH274 transformed with blank p138NB plasmid was processed concurrently as a negative control. Coomassie blue R-250 (Sigma) and silver staining (Bio-Rad) indicated the presence of a single protein band at approximately 65 kDa in samples from YPH274(pLH109) that was not present in YPH274(p138NB). This band was presumed to be the N-terminal portion of Als1p. Its identity was confirmed by Western blotting with the anti-Als antiserum described above.

N-terminal amino acid sequencing of the Als1p-derived fragment. The 65-kDa band in the supernatant of the YPH274(pLH109) culture was well separated from the sparse number of protein bands present on the acrylamide gel. To determine the N-terminal amino acid sequence of the 65-kDa Als1p fragment, a 12.5% polyacrylamide gel of supernatant sample was run. Proteins from the gel were electroblotted to a polyvinylidene difluoride membrane (Gelman Sciences, Inc.) with a 10 mM CAPS [3-(cyclohexylamino)-1-propanesulfonic acid] (Sigma) (pH 11.0)-10% methanol buffer in a Bio-Rad TransBlot apparatus. The polyvinylidene difluoride membrane was rinsed thoroughly with deionized water and stained with 0.2% Coomassie blue R-250 in 45% methanol-10% acetic acid. The membrane was destained with 50% methanol-1% acetic acid and air dried, and the Als1p-derived fragment was excised with a new razor blade. N-terminal amino acid sequencing was performed by the Iowa State University Protein Facility with a model 492 Procise protein sequencer and a model 140C analyzer (Applied Biosystems, Inc.).

Nucleotide sequence accession numbers. Both alleles of ALS2 and ALS4 from C. albicans 1161 were sequenced and deposited separately. GenBank accession numbers are AF024580 (5' domain) and AF024581 (3' domain) (ALS2-1), AF024582 and AF024583 (ALS2-2), AF024584 and AF024585 (ALS4-1), and AF024586 and AF024587 (ALS4-2).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

ALS2 and ALS4 complete the set of genes that hybridize with the ALS1 tandem-repeat probe. An 870-bp KpnI fragment derived from within the tandem-repeat domain of ALS1 hybridizes with several genomic fragments from C. albicans and C. stellatoidea; the number of hybridizing fragments depends upon the strain examined (26). The 10 copies of the 108-bp tandem-repeat element from ALS1 in strain B792 were aligned to derive a consensus sequence (26). PCR primers based on the most-conserved regions of the tandem-repeat sequence were used to screen a fosmid library from C. albicans 1161 (25). By this technique, fosmids were noted to yield different PCR product patterns and were grouped accordingly (25). Characterization of a representative fosmid from one of the groups yielded ALS3 (25); fosmids from the other groups encoded alleles of two other ALS genes, designated ALS2 and ALS4. Restriction enzyme analysis and hybridization with ALS-gene-specific probes indicated that ALS2 and ALS4 accounted for the remaining fragments that hybridize with the ALS1 tandem-repeat probe in genomic DNA from C. albicans 1161 (Fig. 1). A similar analysis with 12 C. albicans and two C. stellatoidea strains indicated that, in each strain, all four ALS genes are present and account for all of the restriction fragments that hybridize with the ALS1 tandem-repeat probe (data not shown). Varying numbers of tandem-repeat-hybridizing fragments originally noted in each strain (26) were due to differences between allelic fragments encoding the same gene and to comigration of larger restriction fragments (data not shown).

View larger version (43K): [in this window] [in a new window]   FIG. 1.   Designation of genomic DNA fragments that encode ALS genes. Southern blots of BglII- or HindIII-digested genomic DNA from C. albicans 1161 were hybridized with an 870-bp KpnI fragment from ALS1 that contained only tandem-repeat sequences (26). ALS alleles corresponding to each of these restriction fragments were identified on separate blots with gene-specific probes developed previously (25, 26) or in this study. Allelic fragments were deduced by data from several experiments and sources, including physical mapping of C. albicans chromosomes (11, 48), restriction mapping of specific fosmid clones, DNA sequence analysis, and gene regulation studies (25, 26). Molecular size markers (in kilobases) are included between the blots.

Designation of C. albicans ALS5 and its place in the ALS family. Characterization of ALS1, ALS2, ALS3, and ALS4 yielded a generalized three-domain structure for ALS genes. Another recently characterized C. albicans gene, called ALA1 (18), also fits this basic motif and belongs to the ALS family. Because the name ALA1 has been previously used to denote an alanyl tRNA synthetase in S. cerevisiae (44), and because C. albicans nomenclature follows the S. cerevisiae precedent (48), we propose that the gene described by Gaur and Klotz (18) be called ALS5.

View larger version (46K): [in this window] [in a new window]   FIG. 2.   Southern blots of BglII genomic DNA fragments hybridized with ALS1 and ALS5 tandem-repeat probes. Genomic DNA from a variety of C. albicans and C. stellatoidea strains was digested with BglII, blotted and probed with an 870-bp KpnI ALS1-tandem-repeat-specific probe (left panel). The blot was stripped and reprobed with a PCR-amplified ALS5 tandem-repeat fragment PCR amplified from C. albicans 1177 (right panel). Molecular size markers (in kilobases) are indicated at the left for each blot.

Sequences in the N-terminal domain of Als proteins are highly conserved and encode a secretory signal peptide. Sequences N-terminal of the tandem-repeat domain were highly conserved in each predicted Als protein, with amino acid identity between different proteins ranging from 68 to 86% (Fig. 3). Identity of the nucleotide sequences encoding the N-terminal domain was 73 to 90%. At the start of each coding region was a hydrophobic sequence with hallmarks of a secretory signal peptide (54). To test whether the hydrophobic N terminus functioned as a signal sequence, a construct expressing the N-terminal 433 amino acids of Als1p under control of the CUP1 promoter was transformed into S. cerevisiae (see Materials and Methods). Supernatants from cultures of the CuSO₄-induced construct and a control strain harboring the blank expression plasmid were run on SDS-polyacrylamide gels (31). Coomassie blue and silver staining of these gels indicated that a major protein species was present at approximately 65 kDa in supernatant from cells with the Als1p construct and absent from cells transformed with blank vector (data not shown). N-terminal amino acid sequencing of the 65-kDa protein yielded the sequence Lys-Thr-Ile-Thr and indicated true secretion of the N-terminal Als1p fragment with resultant loss of the first 17 amino acids (Fig. 3). Cleavage following Ala17 was correctly predicted by the Signalase program (21), which is based on the predictive algorithms of von Heijne (54) and identifies sites for signal peptide cleavage. Analysis of the other Als protein sequences with the Signalase program predicted signal peptide cleavage at the same site, which was conserved in each of the Als amino acid sequences characterized to date (Fig. 3). Because signal sequences have been shown to be processed similarly in S. cerevisiae and C. albicans (39), it is likely that the same processing site is utilized by C. albicans.

View larger version (78K): [in this window] [in a new window]   FIG. 3.   Alignment of N-terminal amino acid sequences predicted from genes in the ALS family. Amino acid sequences were predicted by the translation of ALS gene sequences 5' of the start of the tandem-repeat domain. Sequences included are Als1p (26), Als2p and Als4p (this study), Als3p (25), and Als5p/Ala1p (18). Sequences were aligned with default parameters of the PILEUP program of Genetics Computer Group software (14). A consensus sequence (Cons), indicating amino acids conserved in all sequences, is provided below the alignment. The vertical line (designated SSC) between residues 17 and 18 denotes the site of signal sequence cleavage demonstrated biochemically for Als1p and predicted by computer algorithm to be conserved for the remaining proteins. Boxed regions labelled 1, 2, 3, and 4 correspond to the four 10-mer peptides from Als1p used to raise the rabbit polyclonal anti-Als antiserum used in indirect immunofluorescence studies. The boxed Als2p and Als4p sequences (labelled Probe) correspond to the region in the nucleotide sequence from which ALS2- and ALS4-specific oligonucleotides were derived. Boxed sequences between alleles of Als2p or Als4p indicate nonconserved amino acid sequences predicted from allelic nucleotide sequences. Consensus N glycosylation sites (2) are underlined in the Als2p sequences at positions 253 and 315. All CUG codons have been changed from Leu to Ser (46, 55).

Sequences C-terminal of the tandem-repeat domain are divergent but have a serine-threonine-rich composition. Of the three domains present in Als proteins, the domain C-terminal of the tandem repeats was the least conserved across the family. This domain varied in sequence and length in the predicted Als proteins but exhibited similar amino acid sequence compositions (Table 1). The serine-threonine richness of this domain was consistent with the possibility of abundant O glycosylation (27). This feature, along with the presence of consensus sites for N glycosylation, predicted that the C-terminal domain was heavily glycosylated (Table 1). Both of these features were also observed in the tandem-repeat domain, which was similarly predicted to be heavily glycosylated.

View larger version (23K): [in this window] [in a new window]   FIG. 4.   Alignment of the C-terminal amino acid sequences of Als proteins. Approximately the last 50 amino acids of each predicted Als protein sequence were aligned, to demonstrate sequence conservation in this region. A consensus sequence indicating amino acids conserved in every protein is indicated below the multiple alignment. The putative GPI addition sites are indicated by arrows. The larger arrow over the Gly residue suggests that this is the more likely GPI attachment site.

Cell-surface localization of Als proteins by indirect immunofluorescence. The predicted amino acid sequences of the Als proteins suggested that they were localized on the cell surface. Features such as an N-terminal signal peptide, a C-terminal GPI addition site, repeated sequences, and C-terminal regions rich in serine and threonine have all been noted in other yeast cell-surface proteins (reviewed in reference 8). Cell-surface localization of Als proteins was demonstrated by indirect immunofluorescence with a rabbit polyclonal antiserum raised against four KLH-linked 10-mer peptides from Als1p. Subsequent characterization of additional ALS genes indicated that the 10-mer peptide sequences were highly conserved in the predicted amino acid sequences for other proteins of the Als family (Fig. 3). Recognition of Als1p and Als3p by the anti-Als antiserum was demonstrated by Western blotting of heterologously produced protein fragments (data not shown); other Als proteins remain to be tested.

View larger version (67K): [in this window] [in a new window]   FIG. 5.   Indirect immunofluorescence of C. albicans SC5314 germ tubes. YPD-grown C. albicans cells of strain SC5314 were induced to form germ tubes by inoculation into RPMI 1640 medium. Panels A, C, and E are light micrographs corresponding to the fluorescent micrographs in panels B, D, and F, respectively. Cells in panels B and D were treated with anti-Als antiserum followed by FITC-labelled goat-anti-rabbit IgG. Cells in panel F were stained with preimmune serum from the same rabbit in which the anti-Als serum was raised, followed by staining with the FITC-labelled secondary antiserum. The arrow in panel B indicates a large mother yeast cell that has lost its fluorescence. Arrows in panel D indicate small mother yeast cells for which fluorescence is still visible.

Variability in ALS gene size and expression pattern. It is well documented that the sizes of ALS genes in any C. albicans strain are highly variable (25, 26). In certain strains, alleles of a given ALS gene produce different-sized proteins due to variation in the numbers of tandem-repeat copies present in each allele (Table 1). Also, certain Als proteins are likely to be larger than others, with Als1p in one strain, for example, being twice the size of Als1p in another strain (26).

View larger version (34K): [in this window] [in a new window]   FIG. 6.   ALS4 expression in YPD-grown C. albicans cells. Strain SC5314 was grown overnight in YPD; cells from this culture were used to inoculate fresh YPD medium. Immediately after inoculation (0 h) and at each hour for the next 8 h, an aliquot of cells was removed. Cells were counted to generate a growth curve (right panel) and harvested for RNA extraction and Northern blotting with an ALS4-specific probe (left panel). A fragment of the C. albicans TEF1 gene was used as a control for equal loading of RNA.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

PCR screening of a C. albicans fosmid library with primers based on the consensus tandem-repeat sequence of ALS1 yielded fosmids encoding ALS3 (25), ALS2, and ALS4. These genes account for the ALS1-tandem-repeat-hybridizing fragments detected in high-stringency Southern blots of C. albicans genomic DNA (26). An additional gene described in the literature, ALA1 (18), also belongs in the ALS family and is designated ALS5. Although ALS5 encodes tandem repeats similar to those in ALS1, there is sufficient nucleotide sequence divergence between the two consensus repeat sequences that they detect different genomic fragments on high-stringency Southern blots.

Sequences N-terminal of the tandem repeats are highly conserved in the five aligned Als proteins; however, sequences C-terminal of the tandem repeats are divergent. N-terminal hydrophobic sequences function as a signal peptide which is cleaved following Ala17, a site conserved in each Als protein. C-terminal conserved hydrophobic sequences within the last 50 amino acids of each predicted Als protein have characteristics of the site for GPI addition. These observations are consistent with cell-surface localization of Als proteins, a feature demonstrated by indirect immunofluorescence with an anti-Als serum. The anti-Als serum stains both mother yeasts and germ tubes, with the intensity of staining of the mother yeast diminishing as the germ tube elongates.

Analysis of expression patterns of the two newly characterized ALS genes indicates that the expression of ALS4 is correlated with the growth phase of the culture. ALS2 message was not detected in vitro despite the fact that a wide variety of growth conditions were tested. These data support previous evidence that genes in the ALS family are differentially regulated.

Als protein profile on the C. albicans cell surface. The profile of Als proteins on the C. albicans cell surface is highly variable and depends upon several factors, including growth conditions and strain (Table 1) (25, 26). Indirect immunofluorescence experiments demonstrated that the Als protein profile on the C. albicans surface is dynamic. Both mother yeasts and germ tubes stain with an anti-Als serum, and staining of the mother yeast diminishes with germ tube elongation. Possible explanations for the diminishing fluorescence of the mother yeast include migration of the Als proteins from the mother yeast to the growing germ tube, masking of the Als protein antigens on the mother yeast by synthesis of new cell wall material, and shedding of the Als protein antigens into the culture medium. Migration of cell wall material from mother yeast to germ tube is unlikely in light of data published by Staebell and Soll (51), which demonstrated growth of a germ tube predominantly by apical expansion. Masking of cell-surface proteins by carbohydrate or by glycosylation of other proteins has been discussed in the context of C. albicans cell-surface hydrophobicity (20, 41). Because the N-terminal epitope recognized by the anti-Als antiserum is predicted to be glycosylation free, it is unlikely that the epitope is masked by the direct addition of carbohydrate. However, modification of preexisting glycosylated cell-surface proteins or the production of new ones might explain the diminished fluorescence of the mother yeast. Another possible reason for the diminishing fluorescence of the mother yeast is the shedding of antigens into the culture medium, a phenomenon that is well documented (reviewed in reference 40). High-molecular-weight mannoproteins within the range of sizes predicted for Als proteins are among those shed (1, 40). Previous work by Brawner and Cutler described a C. albicans cell-surface antigen with the same pattern of expression we observed with our anti-Als serum (4-6). Immunogold electron microscopy with a monoclonal IgM indicated that the antigen studied by Brawner and Cutler was associated with the outer flocculent layer of the cell surface (4-6); they discussed shedding of the antigen into the growth medium as an explanation for its diminished intensity on the mother yeast during germ tube elongation.

Nature of the putative binding domain. Als proteins were named because of the similarities between predicted Als sequences and the sequence of -agglutinin of S. cerevisiae. Information about the well-characterized -agglutinin has provided numerous clues about the localization and function of Als proteins (36). The most-significant sequence identity between Als proteins and -agglutinin exists between the first 300 amino acids of each protein (26). Within this region, -agglutinin has an immunoglobulin fold structure that is characteristic of many different cell adhesion molecules (10, 13, 35, 56). Because the Als proteins have significant sequence similarity to Ag1p across domain-sized blocks, they are likely to have a three-dimensional structure similar to that of -agglutinin (34). This observation implicates the first 300 amino acids of the Als protein N terminus as a putative binding domain. Examination of Cys residues in the two sequences indicates that the six Cys residues in the first 300 amino acids of -agglutinin are conserved in the first 300 amino acids of all Als proteins; however, in this region, each Als protein contains two additional Cys residues that are not found in -agglutinin. Conservation of the eight Cys residues in the first 300 amino acids of each mature Als protein strongly suggests structural similarity in this portion of each molecule. Additional studies are planned to predict the structure of the putative binding domain of Als proteins and to evaluate its relatedness to the immunoglobulin fold.

Als protein function. The growing size of the ALS family prompts questions about the function of the encoded proteins and conservation of function between proteins in the family. Als protein function was addressed by two recent studies in which S. cerevisiae was transformed with a C. albicans library seeking C. albicans genes that could confer an adhesive phenotype on the nonadherent S. cerevisiae. In the first study, expression of ALA1/ALS5 in S. cerevisiae conferred adherence to fibronectin, laminin, type IV collagen, and buccal epithelial cells (18). In the second study, the expression of ALS1 in S. cerevisiae conferred adherence to endothelial cells and to cells from an esophageal epithelial line (16). Conclusions drawn in both these studies are consistent with our ideas about the function of Als proteins. The nature of the adhesive interaction observed in these studies, however, needs further clarification to determine whether adhesion is due to the putative N-terminal binding domain or to another portion of the molecule. One portion of the molecule with the potential to mediate an adhesive effect is the region predicted to be highly glycosylated. The effect of protein must be separated from that of the likely carbohydrate in order to define the nature of the adhesive interaction.