Previous Article | Next Article ![]()
Journal of Bacteriology, November 1998, p. 5591-5600, Vol. 180, No. 21
Center for Microbial Pathogenesis and
Department of Microbiology, School of Medicine and Biomedical
Sciences, State University of New York at Buffalo, Buffalo, New
York 14214
Received 17 April 1998/Accepted 26 August 1998
The chiA gene of Vibrio cholerae encodes a
polypeptide which degrades chitin, a homopolymer of
N-acetylglucosamine (GlcNAc) found in cell walls of
fungi and in the integuments of insects and crustaceans.
chiA has a coding capacity corresponding to a polypeptide
of 846 amino acids having a predicted molecular mass of 88.7 kDa. A
52-bp region with promoter activity was found immediately upstream of
the chiA open reading frame. Insertional inactivation of
the chromosomal copy of the gene confirmed that expression of chitinase
activity by V. cholerae required chiA.
Fluorescent analogues were used to demonstrate that the enzymatic
activity of ChiA was specific for Chitin, a homopolymer of
N-acetylglucosamine (GlcNAc), is a major component of the
cell walls of fungi and the integuments of crustaceans and insects
(38). The molecule is one of the most abundant biopolymers
in nature and is used by many microorganisms as a source of
carbon. Utilization of chitin as a nutrient usually requires
degradation of the molecule to GlcNAc monomers. Complete degradation of chitin in both prokaryotes and eukaryotes is a two-step
process which involves successive hydrolysis of the Members of the family Vibrionaceae thrive in marine
environments where chitin is abundant. It is not surprising that many Vibrionaceae evolved systems for utilizing chitin as a
nutrient source. Chitinases have been identified in Vibrio
vulnificus (56, 61), V. harveyi
(57), and V. parahemolyticus (29, 30). Nucleotide sequence analysis indicated that the chitinase of
V. harveyi is homologous with human hexosamindase,
indicating that the two enzymes, as well as other chitinases, are
members of a phylogenically related group (56).
V. cholerae is a human intestinal pathogen that resides in
brackish and marine waters. In vitro experiments established that V. cholerae has the potential to use chitin as a sole source
of carbon for growth (15). It is likely, therefore,
that production of chitinase (29, 30, 42) by V. cholerae provides the bacterium with a readily available
nutrient source in aquatic environments. Hydrolysis of chitin by
V. cholerae is an extracellular process that requires
expression of epsE, one of a cluster of genes in the
eps locus (43, 46-48). Several proteins of
V. cholerae are dependent on the eps system for
extracellular transport, including cholera toxin (CT), an undefined
protease, and a chitinase activity (43, 48). Although
expression of chitinase activity has been reported for V. cholerae, the enzyme responsible for the activity has not
been identified. To further characterize the extracellular chitinase of V. cholerae, we cloned a gene encoding
chitinase activity. Here we report the nucleotide sequence of a cloned
endochitinase gene and establish that the protein encoded by that gene
is secreted to the extracellular environment by an
eps-dependent mechanism.
Bacterial strains, plasmids, and reagents.
Bacterial strains
and plasmids used in this investigation are listed in Table
1. Escherichia coli strains
were cultured in Luria-Bertani (LB) broth. Classical biotypes of
V. cholerae were cultured in Syncase broth (26),
El Tor biotypes of V. cholerae were grown in YEP broth
(27), and Aeromonas hydrophila was cultured in
Tryticase soy broth (Difco Laboratories, Detroit, Mich.). All strains
were maintained on LB agar. Chemical reagents were obtained from Sigma
Biochemicals (St. Louis, Mo.), Life Technologies, Inc. (Gaithersburg,
Md.), and Fisher Scientific (Springfield, N.J.). Unless otherwise
noted, ampicillin was used at 150 µg/ml, chloramphenicol was used at
10 µg/ml, tetracycline was used at 10 µg/ml, and kanamycin was used
at 50 µg/ml. All antibiotics were purchased from Sigma Biochemicals.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Endochitinase Is Transported to the Extracellular
Milieu by the eps-Encoded General Secretory Pathway of
Vibrio cholerae
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
,1-4 glycosidic bonds located
between GlcNAc monomers in chitin. Antibodies against ChiA were
obtained by immunization of a rabbit with a MalE-ChiA hybrid protein.
Polypeptides with antigenic similarity to ChiA were expressed by
classical and El Tor biotypes of V. cholerae and by the
closely related bacterium Aeromonas hydrophila.
Immunoblotting experiments using the wild-type strain 569B and the
secretion mutant M14 confirmed that ChiA is an extracellular protein
which is secreted by the eps system. The eps
system is also responsible for secreting cholera toxin, an oligomeric
protein with no amino acid homology to ChiA. These results indicate
that ChiA and cholera toxin have functionally similar extracellular
transport signals that are essential for eps-dependent
secretion.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
,1-4 glycosidic
bonds linking the GlcNAc subunits. In the first stage, endochitinase binds and degrades tetrameric and longer
polymeric forms of GlcNAc to produce the disaccharide chitobiose.
In the second step, chitobiase hydrolyzes chitobiose to GlcNAc
monomers. The enzymes for chitin degradation are usually coordinately
regulated and in several organisms are induced by chitosan, chitobiose, GlcNAc, or glucosamine (2, 7, 44).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and
plasmids used
Preparation of a genomic library of V. cholerae 569B. Preparation of a genomic library of 569B was previously reported (10). Chromosomal DNA from V. cholerae 569B was prepared by standard methods, partially digested with the restriction enzyme Sau3AI, and size fractionated by sucrose gradient centrifugation. DNA fragments 25 to 50 kbp in size were pooled and ligated to BamHI-digested cosmid vector pCOS5 (10). Ligated DNA was packaged into bacteriophage lambda capsids, using a Gigapack packaging extract (Stratagene Cloning Systems, La Jolla, Calif.), which were transfected into E. coli LE392. The average insert size of the cosmid clones was 37 kbp.
Preparation of EGC agar. LB agar medium containing ethylene glycol chitin (EGC) was prepared by mixing 600 µl of an aqueous solution of EGC (10 mg/ml; Sigma Biochemicals) and 160 µl of 1% aqueous solution of trypan blue with 16 ml of molten (56°C) LB agar. Antibiotics were added, as appropriate. EGC plates inoculated with chitinase-producing strains were incubated at 37°C until clear halos surrounding the colonies were detected.
Isolation and manipulation of plasmid DNA. Plasmids were obtained from E. coli by using a modified alkaline lysis method (25) and ethidium bromide extraction (58) or by use of PlasmidPure spin filters (Sigma Biochemicals). Restriction enzymes and DNA-modifying enzymes were purchased from Life Technologies. Agarose was purchased from J. T. Baker (Phillipsburg, N.J.). DNA fragments used for subcloning were isolated from agarose gel slices by using a GeneCleanII kit (Bio 101, Inc., La Jolla, Calif.). Plasmids were transformed into E. coli by osmotic shock (35), and transformants were selected on LB agar containing appropriate antibiotics.
DNA sequencing.
Double-stranded DNA sequencing was performed
at the Sequencing Facility of the Center for Advanced Molecular Biology
and Immunology at the State University of New York at Buffalo, using
fluorescent dye primer or dye terminator chemistry. Synthetic
single-stranded oligonucleotide primers used to initiate sequencing and
for subsequent PCR were purchased from Integrated DNA Technologies,
Inc. (Coralville, Iowa). The nucleotide sequences of the synthetic
oligonucleotides used for sequencing the insert in pTDCC2 were Chi-1
(5'-[
741]GCTGTTCACTGCCCGTTG-3'), Chi-2
(5'-[732]CAACGGGCAGTGACAGC-3'), Chi-3
(5'-[
1504]GGCCAAACCGTTGGTCTA-3'), Chi-4
(5'-[1474]TAGACCAACGGTTTGGCC-3'), Chi-5
(5'-[1936]CAAGCAAGATATGAAAGC-3'), Chi-6
(5'-[
1994]CCTTCAGCGCCACC-3'), Chi-7
(5'-[252]CGGAGTGCCAGTGTG-3'), Chi-8
(5'-[
304]GAACTTTATCACTGCCAA-3'), Chi-9
(5'-[2167]AAAAACATCGGTGGTGAT-3'), Chi-10
(5'-[
2319]ACATGCAGAATATCAAG-3'), Chi-11
(5'-[2253]GTGGAATTTGGGGCGC-3'), Chi-12
(5'-[
2618]CTGCATAATTGGGGTAG-3'), and Chi-13
(5'-[2477]GCCATTGGTTTGCCATCAGG-3'). The numbers in
brackets denote the position of the first nucleotide relative to the
sequence in Fig. 2. Positive numbers are positions on the sense strand,
while negative numbers indicate positions on the antisense strand. The
T7 (5'-TAATACGACTCACTATAGGG-3') and T3
(5'-ATTAACCCTCACTAAAGGGA-3') primers are homologous to 5'
and 3' regions of pBluescriptKS
and pBluescriptSKII+ flanking the multicloning site (Stratagene).
SDS-PAGE and Western (immunoblot) assays. Isoelectric focusing-grade acrylamide and bisacrylamide were purchased from Pharmacia Biotechnology (Piscataway, N.J.). Unless otherwise noted, samples were prepared by solubilizing at 100°C for 10 min in a buffer containing 31 mM Tris (pH 6.8), 1% sodium dodecyl sulfate (SDS), 2.5% 2-mercaptoethanol, and 5% glycerol. Proteins in the solubilized samples were resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on 8.75% gels (33) which were stained for proteins with silver (37) or colloidal Coomassie brilliant blue (39). Proteins for immunoblotting were resolved by SDS-PAGE and electrophoretically transferred to nitrocellulose paper. Blots were blocked for 30 min in a 5% (wt/vol) solution of skim milk in phosphate-buffered saline and incubated in phosphate-buffered saline-5% skim milk to which mouse monoclonal antibody to the E-tag epitope (1:200; Pharmacia Biotech), rabbit anti-maltose binding protein (MBP) antiserum (1:2,000; New England Biolabs, Inc., La Jolla, Calif.), or rabbit anti-MBP-ChiA-E-tag antiserum (1:15,000) had been added. Affinity-purified rabbit anti-mouse immunoglobulin G antibodies (1:2,000; Sigma Biochemicals) were used as a second antibody when immunoblots had been initially probed with the mouse anti-E-tag monoclonal antibody. To detect antibody-bound polypeptides, immunoblots were probed with a horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (1:10,000; Sigma Biochemicals) and developed with 4-chloro-1-naphthol (20). In some cases, immunoblots were developed with a luminol reagent kit (DuPont/New England Nuclear, Wilmington, Del.). Fluorescent signals from the luminol blots were detected by exposure on Biomar Blue-sensitive autoradiographic film (Marsh Biomedical Products, Inc., Rochester, N.Y.). A Vista-S6E scanner (UMAX Technologies, Inc., Fremont, Calif.) and Molecular Analyst/PC software (Bio-Rad Laboratories, Hercules, Calif.) were used for semiquantitative densitometric analysis of the exposed films.
Preparation of culture supernatants and periplasmic extracts. Culture supernatants and periplasmic extracts of bacterial cultures having an optical density at 600 nm of between 4.1 and 5.6 for late-log-phase cultures and between 4.5 and 5.4 for stationary-phase cultures were obtained as previously described (9, 11).
GM1 ELISA for CT. Methods to measure CT in samples using ganglioside GM1-dependent enzyme-linked immunosorbent assay (ELISA) and a rabbit anti-CT antiserum were previously described (11). Purified CT (a gift from R. K. Holmes) was used as a standard.
Biochemical assays for chitinase activity.
Chitinase
activity was assayed by using chromogenic analogues of chitin (Sigma
Biochemicals). For assays using
p-nitrophenyl-N-acetyl-
-D-glucosaminide (p-NAG) (61), fresh colonies cultured overnight
on LB agar were transferred by using a sterile toothpick onto small
squares of Whatman 3MM filter paper (Schleicher & Schuell, Keene,
N.H.). Fifteen microliters of p-NAG diluted to 3.6 mg/ml in
0.1 M sodium phosphate buffer (pH 7.4) was pipetted onto each colony.
After being wetted with water, filter papers were incubated for 30 min at 37°C and observed for production of a bright yellow
color which indicated chitinase (chitobiase) activity.
4-Methylumbelliferyl (4-MU)-N-acetyl-
-D-glucosaminide,
4-MU-N-acetyl-
-D-glucosaminide, 4-MU-N-acetyl-
-D-galactosamide,
4-MU-
-D-N,N'-diacetylchitobioside, and
4-MU-
-D-N,N',N"-triacetylchitotrioside
were used for detection of chitinase activity (41).
Conjugates dissolved initially in a small amount of dimethylformamide
were diluted in 0.1 M sodium phosphate buffer (pH 7.4) to a final
concentration of 1.43 mM. Fresh colonies from overnight LB agar plates
were transferred to squares of filter paper, and 15 µl of a 4-MU
conjugate was pipetted to the side of the colony and allowed to diffuse
into the cells by capillary transfer. After 15 min of incubation at 37°C, a few drops of an aqueous saturated sodium bicarbonate solution was pipetted onto the colony to enhance fluorescence. Colonies were
observed under 366-nm UV light for blue fluorescence which indicated
chitinase-mediated hydrolysis of the conjugates to
4-methylumbelliferone.
Construction of a frameshift mutation in chiA.
NheI-digested and Klenow-repaired pTDCC2 was self-ligated
under conditions that favored recircularization of the linearized, blunt-ended plasmid. The ligation mixture was transformed into E. coli DH5
F'tet, and transformants were selected by
plating onto LB agar containing ampicillin and tetracycline. A plasmid that had lost the NheI site was isolated and designated
pTDCC2.3.
Construction of promoter probe plasmids.
DNA fragments were
obtained by PCR from regions upstream of the chiA gene in
pTDCC2. Synthetic oligonucleotides used as PCR primers were Chi-15
(5'-GGAATT[29]CCGAAAAAGAATTGAAAGC[47]-3'), Chi-17
(5'-GGAATTCC[99]ATTGATTAACATGCA[113]-3'),
Chi-18
(5'-GGAA[123]TTCACTCTGGAGTATTAG[140]-3'), Chi-19
(5'GGAAT[157]TCTAATACAGGAGAGAAACA[176]-3'),
and Chi-20 (5'-CG
[
465]
TTGGCGTTATTGAGTG[-449]-3').
Brackets denote nucleotide positions, as noted above; restriction
sites for EcoRI are denoted by single underlining,
while the site for BamHI is denoted by a double underline.
pTDCC2 was used as a template in PCR using the following reaction
conditions: 30 s at 92°C, 45 s at 45°C, and 60 s at
72°C (30 cycles). DNA fragments obtained from the reactions were
digested with EcoRI and BamHI and ligated into
the same sites of the multicloning site of the promoter probe vector
pRS415 (53).
Engineering a chiA mutant of 569B.
The suicide
plasmid pKAS32 (55) was used for allelic exchange
mutagenesis. The chiA gene was insertionally inactivated by ligating an end-repaired EcoRI fragment of pUC4K (Pharmacia
LKB Biotechnology) into the unique intragenic HpaI site
of pTDCC2. This intermediate plasmid was designated pATK-1. A
KpnI/SstI fragment of pATK-1 was subsequently
ligated into equivalent sites of the suicide plasmid pKAS32 to produce
pJPF3. The suicide plasmid was then transformed into E. coli S17
pir (36) and conjugated into 569Bstp10rif, a spontaneous streptomycin- and
rifampin-resistant mutant of 569B. A single ampicillin-resistant
transconjugant having pJPF3 integrated into the genome was grown
overnight in LB broth without antibiotic selection at 37°C. Overnight
cultures were plated on LB agar containing streptomycin (30 µg/ml) to
select for clones in which the plasmid sequences had been deleted from the chromosome by recombination between the wild-type and mutant copies
of the chiA genes. Streptomycin-resistant clones were
screened for loss of plasmid-encoded ampicillin resistance and for loss of chitinase activity on EGC agar. A transconjugant that was ampicillin sensitive and chitinase negative was designated
569B(chiA::Kanr). PCR analysis using
the oligonucleotides Chi-2 and Chi-4 and Southern hybridization using
pKAS32 and a PCR-derived fragment of chiA as hybridization
probes were used to confirm the allelic exchange of chiA in
569B(chiA::Kanr).
Engineering a malE-chiA fusion.
PCR
was used to facilitate engineering a malE-chiA
chimera by fusing the malE gene to a fragment encoding the
entire structural gene of chiA excluding the putative signal
peptide. A DNA fragment containing the chiA gene was
amplified from pTDCC2.6, a recombinant plasmid in which sequences
encoding a 13-amino-acid E-tag epitope (Pharmacia Biotech) was fused in
frame to the 3' end of chiA. Oligonucleotide primers used in
the PCR were Chi-Mal
(5'-GGTCTAGA[241]TATAACTGTGCCGGAGTG-3') and
Blue-619 (5'-GTAAAACGACGGCCAGTGA-3'). The numbers in
brackets denote the position of the first nucleotide in the sense
strand relative to the sequence in Fig. 2. Use of Chi-Mal in the PCR incorporated an XbaI site (underlined) into the
amplified DNA fragment at a position immediately 5' to the triplet
codon for tyrosine-23, the predicted NH2-terminal amino
acid of the mature ChiA protein. Blue-619 is homologous to a region of
the multicloning site in pTDCC2.6 downstream of the 3' ligation joint
of the DNA insert. The amplified DNA was digested with the restriction
enzymes XbaI and HindIII, and the resulting
2.5-kbp fragment was ligated to the expression vector pmal-p2 in the
XbaI-HindIII sites to produce an in-frame
hybrid of malE to chiA. After transformation of
the ligation mixture into E. coli DH5
F'tet, clones
were analyzed by restriction mapping and one clone harboring a plasmid
with an appropriate restriction map was screened on EGC agar to confirm a ChiA+ phenotype. The junction sites of plasmid pJL1 were
sequenced to confirm the in-frame fusion.
Amylose affinity chromatography. The MBP-ChiA-E-tag fusion protein was purified by established methods using sucrose extraction (18, 19) and amylose affinity chromatography (New England Biolabs). The purity of the MBP-ChiA fusion protein was determined by SDS-PAGE and immunoblotting using a rabbit anti-MBP antiserum (New England Biolabs) and an anti-E-tag mouse monoclonal antibody (Pharmacia Biotech).
Preparation of rabbit antiserum. Hyperimmune antiserum to the affinity-purified MBP-ChiA fusion protein was obtained from subcutaneous immunization of a New Zealand White rabbit (5). Immunizations and serum collection were performed by the Monoclonal Antibody Center at the State University of New York at Buffalo.
| |
RESULTS |
|---|
|
|
|---|
Cloning of chiA. Chitinases are commonly produced by members of the family Vibrionaceae (61). To determine if chitinase was produced by V. cholerae 569B, EGC agar was stab inoculated with the strain. After 24 h of incubation, the site around the colony was surrounded by a large zone of clearing, indicating hydrolysis of the EGC (data not shown). To isolate the gene or genes that encoded the chitinase activity, approximately 800 cosmid clones of a 569B genomic library were screened for the ability to hydrolyze EGC. Three cosmid clones were identified by the ability to elicit a zone of clearing in the EGC agar. To determine if the cosmid clones had common DNA inserts, cosmid DNA prepared from each clone was digested with the restriction enzyme BamHI and the fragments were resolved by agarose gel electrophoresis. All three cosmids had identical BamHI restriction patterns (data not shown). Similar results were obtained when the cosmids were digested with SalI, providing strong evidence that the inserts of the three cosmids were identical. The cosmid from one of the clones was designated pTDCC1 (Fig. 1, streak 2).
|
F'tet produced one chitinase-positive clone having a plasmid
which was designated pTDCC2 (Fig. 1, streak 4). Nucleotide
sequencing of the 2,915-bp Sau3AI insert revealed an
open reading frame (ORF) of 2,538 bp having the capacity to encode a
polypeptide of 846 amino acids. A ribosomal binding site was found
upstream of the ORF which was terminated by a TAA translation termination codon. Downstream of the translation termination
codon was a nucleotide sequence having characteristics of a
transcription terminator. A potential signal peptidase I cleavage site
(Ala-X-Ala) (60) was found proximal to a series of
hydrophobic amino acids at the N-terminal end of the predicted
polypeptide. The arrangement of amino acids was consistent with a
signal sequence that likely mediates transport of the encoded
polypeptide across the cytoplasmic membrane. The amino acid sequence
encoded by the ORF in pTDCC2 had limited homology to the
chitodextrinase of V. furnissii (33), the
chitinase precursor of Aeromonas sp. strain 10S-24
(52), and chitinases produced by several other bacterial
species (see Fig. 8).
Confirming the ORF by frameshift mutagenesis.
To confirm that
the ORF in pTDCC2 encoded the chitinase activity observed on EGC agar,
we used a unique NheI site to engineer a
1 frameshift
mutation in the putative gene (Fig. 2).
Chitinase activity was not produced by E. coli
DH5
F'tet cells which had been transformed with pTDCC2.3, the plasmid
encoding the mutated ORF (Table 2). Based
on the analysis of the nucleotide sequence and phenotypic
characterization of the mutated plasmid, the 2,538-bp ORF in pTDCC2 was
designated chiA.
|
|
Use of allelic exchange to engineer a chiA mutant of 569B. To demonstrate that the chiA gene encoded the major chitinase activity of 569B, the wild-type copy of the gene in the chromosome was replaced by an insertionally inactivated copy of chiA. The mutant, 569B(chiA::Kanr), exhibited little or no endochitinase activity on EGC agar (Fig. 3). In addition, Western blotting of 569B(chiA::Kanr) with the anti-ChiA antiserum confirmed that the mutant did not produce immunoreactive protein (data not shown). We surmise that the slight residual chitinolytic activity evident in the EGC agar assay was due to nonspecific chitin degradation. An alternative explanation is that V. cholerae likely expresses, in addition to endochitiase, a chitobiase which degrades chitobiose, an intermediate molecule in the degradative pathway of chitin. It is possible that chitobiase has some minor reactivity against EGC.
|
Mapping the chiA promoter.
Expression of
chiA was likely a result of the activity of an endogenous
promoter within the 3.0-kbp insert of pTDCC2, since nucleotide sequence
analysis of the pTDCC2 showed that chiA was positioned in
the orientation opposite that of the lac promoter in the
vector. Rather than having no effect on expression, addition of
isopropyl-
-D-thiogalactopyranoside (IPTG) to
cultures of E. coli DH5
F'tet(pTDCC2)
caused a decrease in chitinase activity (Fig. 1, streak 4). This
observation suggested that the promoter was present in the 174 nucleotides that preceded the ATG initiation codon of the gene. To map
the promoter of chiA more precisely, four DNA fragments
isolated by PCR from the 5' end of the insert of pTDCC2 (nucleotides 31 to 465, 99 to 465, 123 to 465, and 157 to 465) were cloned into pRS415
(53), a vector engineered for promoter analysis. When
introduced into 569B, only pZ1 expressed high levels of
-galactosidase activity; pZ3 containing nucleotides 98 to 465 expressed very little
-galactosidase, as did plasmids containing
shorter segments of the DNA upstream of chiA (Table 3). These results strongly suggested that
promoter activity for chiA was located within a 69-bp region
bounded by nucleotides 29 and 97 (Fig. 2). Sequences homologous to
consensus
35 and
10 hexamers which are components of most
70-like promoters were not evident in the 68-bp region.
It should be noted that 569B exhibited a low level of endogenous
-galactosidase activity (pRS415 [Table 3]), but this background
did not interfere with the measurements of promoter activity.
|
Defining the substrate specificity ChiA.
To determine the
substrate specificity of the enzyme encoded by chiA, we
employed a rapid test method that used a series of 4-MU conjugates
(41). Hydrolysis of the glycosidic bonds of the conjugates
releases 4-umbelliferone, which fluorescences with a strong blue light
when illuminated with UV irradiation. Five different 4-MU conjugates
were used in these experiments:
4-MU-N-acetyl-
-D-glucosaminide, 4-MU-N-acetyl-
-D-glucosaminide, 4-MU-N-acetyl-
-D-galactosaminide, 4-MU-
-D-N,N'-diace-tylchitobiose, and 4-MU-
-D-N,N',N"-triacetylchitotriose. When
expressed in DH
F'tet, pTDCC2 directed the hydrolysis of 4-MU-
-D-N,N'-diacetylchitobiose and
4-MU-
-D-N,N',N"-triacetylchitotriose (Table 2). DH5
F'tet(pTDCC2) did not react with
4-MU-N-acetyl-
-D-glucosaminide, 4-MU-N-acetyl-
-D-glucosaminide, or 4-MU-N-acetyl-
-D-galactosaminide. DH5
F'tet(pTDCC2)
also did not hydrolyze p-NAG, a conjugate that releases a
yellow pigment when the glycosidic bonds are cleaved (61). A
minor amount of hydrolytic activity for
4-MU-N-acetyl-
-D-glucosaminide was
evident after prolonged incubation of the substrate on
DH5
F'tet(pTDCC2) cells. It was concluded from the pattern of
degradation of the synthetic substrates that ChiA encoded by pTDCC2 was
likely an endochitinase capable of hydrolyzing
,1-4 glycosidic
bonds.
Production of anti-ChiA hyperimmune serum.
To expedite the
process of obtaining purified ChiA for raising antibodies, a
malE-chiA fusion was constructed by using the expression vector pmal-p2 (New England Biolabs) and a PCR-amplified fragment of pTDCC2.6. Ligation of the amplified fragment into pmal-p2
by directional cloning positioned the chiA gene into the vector such that an in-frame fusion to the 3' end of malE
fusion was produced. Introduction of the fusion plasmid pJL1
into DH5
F'tet produced a strain that expressed strong
IPTG-inducible chitinase activity on EGC agar (Fig. 1, streak
7).
F'tet(pJL1) (data not shown). Immunization of a rabbit with the affinity-purified preparation produced a high-titer antiserum that reacted in immunoblots with a 90-kDa polypeptide encoded by pTDCC1 and pTDCC2 (Fig.
4) and with an immunoreactive
polypeptide of similar size in 569B. The antiserum also reacted
with a polypeptide of 127 kDa in DH5
F'tet(pJL1), which
was consistent with the predicted size of the MBP-ChiA fusion protein.
A smaller polypeptide of 42 kDa in the immunoblots that reacted
with the anti-MBP-ChiA antiserum was likely the endogenous MalE of
E. coli. No immunoreactive polypeptide of
similar size was detected in 569B, indicating that V. cholerae did not express a protein with antigenic similarity to
MalE. Immunoblotting of whole cells of V. cholerae
showed that the preimmune rabbit serum did not react with ChiA (data
not shown).
|
Expression of ChiA in classical and El Tor biotypes of V. cholerae and in A. hydrophila. Bacterial cultures of two classical biotypes (569B and 0395) and two El Tor biotypes (U1 and JBK70) of V. cholerae were analyzed for reactivity to the anti-ChiA antiserum. All four strains synthesized immunoreactive polypeptides that were similar in size to the recombinant polypeptide encoded by pTDCC2 (Fig. 5). A smaller immunoreactive polypeptide having an apparent molecular mass of 65 kDa was also present in all four strains. No protein of V. cholerae corresponding to the 42-kDa MalE of E. coli was detected in the anti-ChiA immunoblots.
|
Extracellular transport of ChiA. Chitinases in other species are typically extracellular proteins. To establish whether ChiA was transported to the extracellular medium by V. cholerae, culture supernatants and periplasmic extracts isolated from late-log-phase and stationary-phase cultures of 569B were analyzed by SDS-PAGE and immunoblotting for ChiA (Fig. 6A). In late-log-phase cultures of 569B, two immunoreactive polypeptides were found in the culture supernatant. The major polypeptide had an apparent molecular mass of 90 kDa, which was equivalent in size to recombinant ChiA. A minor, faster-migrating polypeptide of 76 kDa was also evident. Periplasmic extracts of 569B cultures contained only the 90-kDa polypeptide. Semiquantitative densitometric analysis of the immunoblots demonstrated that the majority of the total immunoreactive protein (69.4%) of 569B was located in the culture supernatant of late-log-phase cultures (Fig. 6).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Mechanisms for extracellular transport of proteins have been identified in a diverse number of bacteria. Klebsiella oxytoca (44), Erwinia chrysanthemi (22), Erwinia carotovora (34), Pseudomonas aeruginosa (1), Xanthomonas campestris (13), and A. hydrophila (3) contain a cluster of genes that encode the main terminal branch of the general secretory pathway (GSP). Recently, it was determined that V. cholerae has a cluster of genes that are homologous to the secretory clusters in those bacteria. At least 12 genes are encoded by the eps cluster of V. cholerae (43, 47, 48). Extracellular transport of CT, an oligomeric enterotoxin produced by the bacterium, is dependent on expression of the eps genes (11, 43, 47, 48). Here we provide strong evidence that the eps system of V. cholerae is also involved in extracellular transport of ChiA.
The degree of shared homology observed among the secretory systems of
the diverse bacteria does not enable the systems to be interchanged. In
most cases, extracellular proteins are secreted only by their cognate
secretory systems. For example, E. chrysanthemi secretes a pectate lyase, but the pectate lyase of E. chrysanthemi is not secreted by K. oxytoca
(22). The type I heat-labile enterotoxin LT-I, a protein
that is highly homologous to CT, is secreted by V. cholerae and seven species of the family Vibrionaceae
but not by E. chysanthemi, Xanthomonas
maltophilia, or K. pneumoniae (43). Of the
secretory systems that have been well described, it appears that the
eps system of V. cholerae is the most
promiscuous. Previous investigations established that the
eps system of V. cholerae promotes secretion
not only of CT and LT-I but also of the B polypeptides of
LT-IIa and LT-IIb, two members of the type II heat-labile enterotoxins of enterotoxigenic E. coli (11). ChiA can
now be added to the list of extracellular proteins secreted by the
eps system. The ability of CT, LT-I, LT-IIa, LT-IIb, and
ChiA to traffic through the same secretory pathway suggests that each
of the proteins has an extracellular transport signal that is
recognized by the eps system. The molecular structures of
the signals in the five proteins have not been identified, but there is
growing evidence that the signals are not composed of a linear array of
conserved amino acids. CT and the type II enterotoxins have little if
any amino acid homology yet are secreted with equal efficiency by V. cholerae (11). From those observations,
it was hypothesized that the transport signals in these three proteins
were likely conserved conformation-dependent motifs. Since ChiA is not
homologous to CT or to the type II enterotoxins, it is likely that the
extracellular transport signal in ChiA is also a conformation-dependent
motif. A similar situation was observed in K. oxytoca, where
two nonadjacent regions of pullulanase were required to promote
translocation of a
-lactamase fusion protein across the outer
membrane (50, 51). It is possible that many if not all
extracellular transport signals in proteins transported by
eps-like secretory systems are comprised of
conformation-dependent domains. If that is indeed the case,
experiments to define the structures of the transport signals may
require high-resolution crystal structures of the proteins.
When expressed in E. coli, CT and the type II
heat-labile enterotoxins LT-IIa and LT-IIb accumulate in the
periplasm of the cell. A similar pattern of periplasmic accumulation of
extracellular proteins was observed when the genes for amylase
(17), aerolysin (24), and protease
(45) of A. hydrophila and the gene for pullulanase of K. pneumoniae (12) were expressed
in E. coli. For pullulanase, mobilization of the
proteins out of the periplasm of E. coli required
coexpression of the pul cluster, the cognate secretory
system (12). However, when the genes for CT, LT-IIa, and
LT-IIb were expressed in E. coli, low but significant
amounts of the proteins were found in the extracellular medium
(11). Hydrolysis of EGC by DH5
(pTDCC2) suggested that
recombinant ChiA was also released to the extracellular
medium. Using
-lactamase as a marker for periplasmic
proteins, we found that recombinant ChiA, CT, LT-IIa, and
LT-IIb in the culture supernatants of E. coli could be
attributed to passive release by natural autolysis of the cells (data
not shown). Results from these control experiments did not rule out the
possibility that small amounts of ChiA are actively transported in
E. coli. The chitinases of Serratia
marcescens (28) and A. hydrophila
(6) were mostly found in the extracellular medium when the
genes for these proteins were cloned in E. coli. The
mechanism by which these chitinases were transported to the medium has
not been elucidated. An intriguing possibility is that E. coli transports the chitinases across the
outer membrane by an intrinsic secretory system. Genes
homologous to those encoding the main terminal branch of the GSP
have been identified in E. coli (14).
Complementation experiments using the pul system of
K. oxytoca showed that at least two of the
E. coli genes, gspO and gspG,
were functional (14). Although it has not been demonstrated that the gsp secretory system of E. coli is
expressed under most laboratory conditions, it is an interesting
proposition that gsp genes may be involved in transport of
the chitinases of S. marcescens and A. hydrophila across the E. coli outer membrane.
Low-level transport of ChiA by the gsp system could be
responsible for the extracellular chitinase activity of E. coli harboring chiA genes. Expression of
chiA in E. coli gsp mutants will be required
to test this rather speculative hypothesis.
The predicted molecular mass of the recombinant ChiA was in good agreement with the size of the largest immunoreactive protein detected in the anti-ChiA immunoblots of 569B. Time course experiments demonstrated that while a 90-kDa immunoreactive protein was present in the culture supernatants from late-log-phase cultures of 569B, little if any 90-kDa polypeptide was evident in culture supernatants from stationary-phase cultures. In those culture supernatants, the predominant immunoreactive molecule was a 65-kDa polypeptide. Results from preliminary experiments using EGC zymograms indicated that the 65-kDa polypeptide was enzymatically active (data not shown). While it is possible that the 65-kDa polypeptide was simply a degradative product of the 90-kDa polypeptide, it is equally possible that ChiA is purposely processed to the smaller polypeptide by factors that are expressed only when the cells enter stationary phase.
Amino acid sequence analysis showed that ChiA has homology to chitinases produced by the soil bacteria Bacillus licheniformis (GenBank entry U71214), Janthinobacterium lividum (16), and Alteromonas sp. (21), as well as the marine species V. harveyi (GenBank entry U81496), Vibrio furnissii (32), Aeromonas sp. strain 10S-24 (52), and Aeromonas caviae (54) (Fig. 8). Significant homology to ChiA was confined to a 38-amino-acid domain. The degree of sequence similarity observed among the chitinases suggests an importance for the domain in enzymatic activity. Structure-function studies of the chitinase of Aeromonas sp. strain 10S-24 (52) and of related chitinases indicated that this domain may have chitin-binding activity. Although conserved in structure, the location of the putative chitin-binding domain is divergent. In ChiA of V. cholerae and the chitinases of V. furnissii, Aeromonas sp. strain 10S-24, and J. lividum, the domain is located in the amino-terminal third of the proteins. In the chitinases of V. harveyi, A. caviae, and B. licheniformis, the domain is located in the carboxyl-terminal third of the proteins. Mutational analysis will be needed to confirm the role of the domain in enzymatic activity of ChiA.
|
Degradation of chitin by free-living V. cholerae is
thought to begin with binding of the bacterium to the homopolymer by a chitin-binding surface receptor. In vivo experiments demonstrated that
the chitin-binding receptor also has affinity for ligands on the
surfaces of rabbit epithelial cells and chicken erythrocytes (49). Binding to the cell surface was inhibited by
GlcNAc, the monomeric unit of chitin.
,1-4-linked glycosidic
bonds occur frequently in glycosylated molecules found on the surfaces
of many epithelial cells. It is tempting to speculate that
V. cholerae may bind to intestinal cells by interaction
between the chitin-binding receptor and an unidentified glycosylated
cell surface molecule. Furthermore, it is conceivable that the
,1-4-linked glycosidic bonds in these cell surface molecules are
cleaved by chitinases produced by V. cholerae. It will
be interesting to determine if ChiA has hydrolytic activity for
glycosylated molecules on the intestinal epithelial cell surface and
whether mutations in chiA reduce the virulence of the
pathogen.
Translocation of proteins across membranes is a fundamental property of prokaryotic and eukaryotic cells. To better understand the process of protein translocation, it will be necessary to elucidate the mechanisms by which the secretory systems recognize and transport extracellular proteins. Investigations into extracellular secretion of ChiA and other proteins by V. cholerae will facilitate experiments to discover the cognate transport signals and how those signals interact with components of the secretory machinery. Current experiments are focused on the use of genetics to delimit the regions of CT and ChiA that are required for extracellular transport.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by research grant R29AI37817 from the National Institutes of Health to T.D.C. and by funds from the School of Medicine and Biomedical Sciences at the State University of New York at Buffalo.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: 138 Farber Hall, Dept. of Microbiology, 3435 Main St., State University of New York at Buffalo, Buffalo, NY 14214. Phone: (716) 829-3364. Fax: (716) 829-3889. E-mail: connell{at}acsu.buffalo.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bally, M., A. Filloux, M. Akrim, G. Ball, A. Lazdunski, and J. Tommassen. 1992. Protein secretion in Pseudomonas aeruginosa: characterization of seven xcp genes and processing of secretory apparatus components by prepilin peptidase. Mol. Microbiol. 6:1121-1131[Medline]. (Erratum, 6:2745.) |
| 2. | Bennett, C. B., and M. A. Hood. 1980. Effects of cultural conditions on the production of chitinase by a strain of Bacillus megatarium. Dev. Ind. Microbiol. 21:357-363. |
| 3. |
Bo, J. N., and S. P. Howard.
1991.
Mutagenesis and isolation of Aeromonas hydrophila genes which are required for extracellular secretion.
J. Bacteriol.
173:1241-1249 |
| 4. | Brammuci, M. G., E. M. Twiddy, W. B. Baine, and R. K. Holmes. 1981. Isolation and characterization of hypertoxinogenic (htx) mutants of Escherichia coli KL320(pCG86). Infect. Immun. 32:1134-1044. |
| 5. |
Campagnari, A. A.,
M. R. Gupta,
K. C. Dudas,
T. F. Murphy, and M. A. Apicella.
1987.
Antigenic diversity of lipooligosaccharides of nontypable Haemophilus influenzae.
Infect. Immun.
55:882-887 |
| 6. |
Chen, J. P.,
F. Nagayama, and M. C. Chang.
1991.
Cloning and expression of a chitinase gene from Aeromonas hydrophila in Escherichia coli.
Appl. Environ. Microbiol.
57:2426-2428 |
| 7. |
Clarke, P. H., and M. V. Tracey.
1956.
The occurrence of chitinase in some bacteria.
J. Gen. Microbiol.
14:188-196 |
| 8. | Conley, E. C., and J. R. Saunders. 1984. Recombination-dependent recircularization of linearized pBR322 plasmid DNA following transformation of Escherichia coli. Mol. Gen. Genet. 194:211-218[Medline]. |
| 9. |
Connell, T. D., and R. K. Holmes.
1992.
Characterization of hybrid toxins produced in Escherichia coli by assembly of A and B polypeptides from type I and type II heat-labile enterotoxins.
Infect. Immun.
60:1653-1661 |
| 10. |
Connell, T. D.,
A. J. Martone, and R. K. Holmes.
1995.
A new mobilizable cosmid vector for use in Vibrio cholerae and other Gram bacteria.
Gene
153:85-87[Medline].
|
| 11. | Connell, T. D., D. J. Metzger, M. Wang, M. G. Jobling, and R. K. Holmes. 1995. Initial studies of the structural signal for extracellular transport of cholera toxin and other proteins recognized by Vibrio cholerae. Infect. Immun. 63:4091-4098[Abstract]. |
| 12. | d'Enfert, C., A. Ryter, and A. P. Pugsley. 1987. Cloning and expression in Escherichia coli of the Klebsiella pneumoniae genes for production, surface localization and secretion of the lipoprotein pullulanase. EMBO J. 6:3531-3538[Medline]. |
| 13. | Dums, F., J. M. Dow, and M. J. Daniels. 1991. Structural characterization of protein secretion genes of the bacterial phytopathogen Xanthomonas campestris pathovar campestris: relatedness to secretion systems of other gram-negative bacteria. Mol. Gen. Genet. 229:357-364[Medline]. |
| 14. |
Francetic, O., and A. P. Pugsley.
1996.
The cryptic general secretory pathway (gsp) operon of Escherichia coli K-12 encodes functional proteins.
J. Bacteriol.
178:3544-3549 |
| 15. |
Garay, E.,
A. Arnau, and C. Amaro.
1985.
Incidence of Vibrio cholerae and related vibrios in a coastal lagoon and seawater influenced by lake discharges along an annual cycle.
Appl. Environ. Microbiol.
50:426-430 |
| 16. | Gleave, A. P., R. K. Taylor, B. A. Morris, and D. R. Greenwood. 1995. Cloning and sequencing of a gene encoding the 69-kDa extracellular chitinase of Janthinobacterium lividum. FEMS Microbiol. Lett. 131:279-288[Medline]. |
| 17. |
Gobius, K. S., and J. M. Pemberton.
1988.
Molecular cloning, characterization, and nucleotide sequence of an extracellular amylase gene from Aeromonas hydrophila.
J. Bacteriol.
170:1325-1332 |
| 18. | Hajishengallis, G., S. K. Hollingshead, T. Koga, and M. W. Russell. 1995. Mucosal immunization with a bacterial protein antigen genetically coupled to cholera toxin A2/B subunits. J. Immunol. 154:4322-4332[Abstract]. |
| 19. | Hajishengallis, G., S. M. Michalek, and M. W. Russell. 1996. Persistence of serum and salivary antibody responses after oral immunization with a bacterial protein antigen genetically linked to the A2/B subunits of cholera toxin. Infect. Immun. 64:665-667[Abstract]. |
| 20. | Hawkes, R., E. Niday, and J. Gordon. 1982. A dot-immunobinding assay for monoclonal and other antibodies. Anal. Biochem. 119:142-147[Medline]. |
| 21. | Hayashi, K., S. Sato, R. Takano, H. Tsujibo, H. Orikoshi, C. Imada, Y. Okami, Y. Inamori, and S. Hara. 1995. Identification of the positions of disulfide bonds of chitinase from a marine bacterium, Alteromonas sp. strain O-7. Biosci. Biotechnol. Biochem. 59:1981-1982[Medline]. |
| 22. |
He, S. Y.,
M. Lindeberg,
A. K. Chatterjee, and A. Collmer.
1991.
Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu.
Proc. Natl. Acad. Sci. USA
88:1079-1083 |
| 23. | Holmes, R. K., M. L. Vasil, and R. A. Finkelstein. 1975. Studies on toxinogenesis in Vibrio cholerae. III. Characterization of nontoxinogenic mutants in vitro and in experimental animals. J. Clin. Investig. 55:551-560. |
| 24. | Howard, S. P., and J. T. Buckley. 1986. Molecular cloning and expression in Escherichia coli of the structural gene for the hemolytic toxin aerolysin from Aeromonas hydrophila. Mol. Gen. Genet. 204:289-295[Medline]. |
| 25. |
Ish-Horowicz, D., and J. F. Burke.
1981.
Rapid and efficient cosmid cloning.
Nucleic Acids Res.
9:2989-2998 |
| 26. | Iwanaga, M., and T. Kuyyakanond. 1987. Large production of cholera toxin by Vibrio cholerae O1 in yeast extract peptone water. J. Clin. Investig. 25:2314-2316. |
| 27. | Iwanaga, M., K. Yamamoto, N. Higa, Y. Ichinose, N. Nakasone, and M. Tanabe. 1986. Culture conditions for stimulating cholera toxin production by Vibrio cholerae El Tor. Microbiol. Immunol. 30:1075-1083[Medline]. |
| 28. | Jones, J. D. G., K. L. Grady, T. V. Suslow, and J. R. Bedbrook. 1986. Isolation and characterization of genes encoding two chitinase enzymes from Serratia marcescens. EMBO J. 5:467-473[Medline]. |
| 29. | Kaneko, T., and R. R. Colwell. 1975. Adsorption of Vibrio parahemolyticus onto chitin and copepods. Appl. Microbiol. 29:269-274[Medline]. |
| 30. |
Kaneko, T., and R. R. Colwell.
1973.
Ecology of Vibrio parahemolyticus in Chesapeake Bay.
J. Bacteriol.
113:24-32 |
| 31. | Kaper, J. B., H. Lockman, M. M. Baldini, and M. M. Levine. 1984. Recombinant nontoxinogenic Vibrio cholerae strains as attenuated cholera vaccine candidates. Nature 308:655-658[Medline]. |
| 32. |
Keyhani, N. O., and S. Roseman.
1996.
The chitin catabolic cascade in the marine bacterium Vibrio furnissii. Molecular cloning, isolation, and characterization of a periplasmic beta-N-acetylglucosaminidase.
J. Biol. Chem.
271:33425-33432 |
| 33. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 34. | Lindeberg, M., G. P. Salmond, and A. Collmer. 1996. Complementation of deletion mutations in a cloned functional cluster of Erwinia chrysanthemi out genes with Erwinia carotovora out homologues reveals OutC and OutD as candidate gatekeepers of species-specific secretion of proteins via the type II pathway. Mol. Microbiol. 20:175-190[Medline]. |
| 35. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 36. |
Miller, V. L., and J. J. Mekalanos.
1984.
Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR.
Proc. Natl. Acad. Sci. USA
81:3471-3475 |
| 37. | Morrissey, J. H. 1981. Silver stain for proteins in polyacrylamide gels: a modified procedure with enchanced uniform sensitivity. Anal. Biochem. 117:307-310[Medline]. |
| 38. | Muzzarelli, R. A. A. 1977. Chitin. Pergamon Press, Inc., Elmsford, N.Y. |
| 39. | Neuhoff, V., N. Arold, D. Taube, and W. Ehrhardt. 1988. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 9:255-262[Medline]. |
| 40. |
Newland, J. W.,
B. A. Green, and R. K. Holmes.
1984.
Transposon-mediated mutagenesis and recombination in Vibrio cholerae.
Infect. Immun.
45:428-432 |
| 41. |
O'Brien, M., and R. R. Colwell.
1987.
A rapid test for chitinase activity that uses 4-methylumbelliferyl-N-acetyl- -D-glucosaminide.
Appl. Environ. Microbiol.
53:1718-1720 |
| 42. | Ohtakara, A., M. Mitsutomi, and Y. Uchida. 1979. Purification and some properties of chitinase from Vibrio sp. J. Ferment. Technol. 57:169-177. |
| 43. | Overbye, L. J., M. Sandkvist, and M. Bagdasarian. 1993. Genes required for extracellular secretion of enterotoxin are clustered in Vibrio cholerae. Gene 132:101-106[Medline]. |
| 44. | Pugsley, A. P., C. d'Enfert, I. Reyss, and M. G. Kornacker. 1990. Genetics of extracellular protein secretion by gram-negative bacteria. Annu. Rev. Genet. 24:67-90[Medline]. |
| 45. |
Rivero, O.,
J. Anguita,
C. Paniagua, and G. Naharro.
1990.
Molecular cloning and characterization of an extracellular protease gene from Aeromonas hydrophila.
J. Bacteriol.
172:3905-3908 |
| 46. | Sandkvist, M., and M. Bagdasarian. 1996. Secretion of recombinant proteins by Gram-negative bacteria. Curr. Opin. Biotechnol. 7:505-511[Medline]. |
| 47. |
Sandkvist, M.,
L. O. Michel,
L. P. Hough,
V. M. Morales,
M. Bagdasarian,
M. Koomey, and V. J. DiRita.
1997.
General secretion pathway (eps) genes required for toxin secretion and outer membrane biogenesis in Vibrio cholerae.
J. Bacteriol.
179:6994-7003 |
| 48. | Sandkvist, M., V. Morales, and M. Bagdasarian. 1993. A protein required for secretion of cholera toxin through the outer membrane of Vibrio cholerae. Gene 123:81-86[Medline]. |
| 49. | Sasmal, D., B. Guhathakurta, A. N. Ghosh, C. R. Pal, and A. Datta. 1992. N-acetyl-D-glucosamine-specific lectin purified from Vibrio cholerae 01. FEMS Microbiol. Lett. 77:217-224[Medline]. |
| 50. |
Sauvonnet, N.,
I. Poquet, and A. P. Pugsley.
1995.
Extracellular secretion of pullulanase is unaffected by minor sequence changes but is usually prevented by adding reporter proteins to its N- or C-terminal end.
J. Bacteriol.
177:5238-5246 |
| 51. | Sauvonnet, N., and A. P. Pugsley. 1996. Identification of two regions of Klebsiella oxytoca pullulanase that together are capable of promoting beta-lactamase secretion by the general secretory pathway. Mol. Microbiol. 22:1-7[Medline]. |
| 52. | Shiro, M., M. Ueda, T. Kawaguchi, and M. Arae. 1996. Cloning of a cluster of chitinase genes from Aeromonas sp. no. 10S-24. Biochem. Biophys. Acta 1305:44-48[Medline]. |
| 53. | Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96[Medline]. |
| 54. |
Sitrit, Y.,
C. E. Vorgias,
I. Chet, and A. B. Oppenheim.
1995.
Cloning and primary structure of the chiA gene from Aeromonas caviae.
J. Bacteriol.
177:4187-4189 |
| 55. | Skorupski, K., and R. K. Taylor. 1996. Positive selection vectors for allelic exchange. Gene 169:47-52[Medline]. |
| 56. |
Somerville, C. C., and R. R. Colwell.
1993.
Sequence analysis of the beta-N-acetylhexosaminidase gene of Vibrio vulnificus: evidence for a common evolutionary origin of hexosaminidases.
Proc. Natl. Acad. Sci. USA
90:6751-6755 |
| 57. | Soto-Gil, R. W., and J. W. Zyskind. 1984. Cloning of Vibrio harveyi chitinase and chitobiase genes in Escherichia coli, p. 209-223. In J. P. Zikakis (ed.), Chitin, chitosan, and related enzymes. Academic Press, Inc., Orlando, Fla. |
| 58. | Stemmer, W. P. 1991. A 20-minute ethidium bromide/high-salt extraction protocol for plasmid DNA. BioTechniques 10:726[Medline]. |
| 59. |
Taylor, R. K.,
V. L. Miller,
D. B. Furlong, and J. J. Mekalanos.
1987.
Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin.
Proc. Natl. Acad. Sci. USA
84:2833-2837 |
| 60. | von Heijne, G. 1984. How signal sequences maintain cleavage specificity. J. Mol. Biol. 173:243-251[Medline]. |
| 61. |
Wortman, A. T.,
C. C. Somerville, and R. R. Colwell.
1986.
Chitinase determinants of Vibrio vulnificus: gene cloning and applications of a chitinase probe.
Appl. Environ. Microbiol.
52:142-145 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»