INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

A significant unsolved problem in the biology of bacteria is the nature of the machinery that is responsible for the segregation of daughter chromosomes with high fidelity during the cell cycle. Some insights into how chromosome segregation occurs have emerged from the recent application of cytological methods to visualize specific sites on the chromosome and their movement during the cell cycle. It has been revealed that in Bacillus subtilis and Escherichia coli the replication origin regions of newly duplicated chromosomes tend to move towards opposite poles of the cell, whereas the termini generally localize in the middle region of the cell (9, 42). Recent improvements in time-lapse microscopy have made it possible to visualize the movement of origin regions during the course of the entire cell cycle; these analyses have shown that the separation of origins occurs relatively rapidly and in the absence of cell wall synthesis (41). A similar conclusion that origin regions move apart to achieve a bipolar pattern of localization has been reached in experiments in which the subcellular position of chromosomally encoded homologs of the plasmid partition protein ParB was visualized in B. subtilis and Caulobacter crescentus (8, 23, 26). This was achieved by the use of specific antibodies in immunofluorescence experiments and by the use of a fusion of the partition protein to green fluorescent protein (GFP). The B. subtilis ParB homolog, which is known as Spo0J, specifically binds to at least eight sites spread out across a 900-kb region (~20% of the chromosome) that encompasses the replication origin of the chromosome (22). Thus, the bipolar distribution of Spo0J provides an independent demonstration that after duplication the origin regions of the chromosome become localized near the cell poles.

What proteins are involved in mediating the movement and segregation of chromosomes? Genetic studies have revealed several proteins that play significant roles in proper chromosome segregation, such as gyrase, topoisomerase IV subunits, and the XerC recombinase, which are needed for decatenation of replicated chromosomes and monomerization of chromosome dimers (40). Of special significance is the muk operon in E. coli, mutants of which give rise to a high proportion of anucleate cells and exhibit a temperature-sensitive growth defect (43). MukB is inferred to consist of globular N-terminal and C-terminal domains connected by two coiled-coil domains that are joined by a flexible hinge, and it was proposed to be a motor for chromosome segregation (29).

Another protein implicated in chromosome segregation, and the subject of the present investigation, is SMC (for structural maintenance of chromosomes). Members of the SMC family of proteins are present in bacteria, archaea, and eukaryotes and are believed to perform motor-like tasks on a chromatin template. As deduced from sequence analysis, they are composed of an N-terminal domain having an ATP-binding Walker A motif, two large central coiled-coil domains spaced by a flexible linker, and a C-terminal domain that contains the DA box motif most characteristic for the protein family (19, 25). In eukaryotic cells, SMC proteins and proteins found in a complex with SMCs have essential functions in mitotic chromosome transmission (3, 38), chromosome condensation (12, 34, 37), and maintenance of sister chromatids and cohesion (10, 25). They are also involved in other vital functions in eukaryotes: transcriptional control (21), genetic recombination (16), and repair (4). In budding yeast, where four members of an SMC family have been characterized, each smc gene is essential both for cell viability and for the maintenance of proper chromosome structure during mitosis (19, 35, 36a). It was speculated that the DNA-binding activity of SMC protein (17, 39) is involved in its capacity to mediate a variety of chromatin-based processes.

Recently, Britton et al. (5) and Moriya et al. (27) have shown that the SMC homolog of B. subtilis plays a critical role in chromosome condensation and segregation in this gram-positive bacterium. E. coli does not have a clear homolog of SMC, but it does contain three proteins with some structural similarity to SMC: MukB, SbcC, and RecN. Of these, only MukB is absent in B. subtilis. Moreover, mukB mutants display a phenotype similar to that of an smc mutant of B. subtilis (5, 29). It is therefore attractive to consider that MukB is the functional equivalent of, if not a distant relative of, SMC (7). In any event, all procaryotes whose genome sequences have been determined have either a mukB gene or an smc-like gene (7), indicating that these two types of proteins may play a ubiquitous role in chromosome condensation and segregation in bacteria.

Here we report on the intracellular localization of SMC in B. subtilis during the course of the cell cycle. Using immunofluorescence microscopy, we show that SMC localized to the chromosomes and also to discrete foci at polar positions in the cell. Polar foci were preferentially observed in cells at an early stage of the cell cycle, but their formation did not require cytokinesis. Our data are consistent with the idea that SMC is loaded onto chromosomes from the polar foci and that it mediates chromosome condensation following or during DNA replication.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Bacterial strains and plasmids. B. subtilis PY79 (wild type) and its derivatives were grown in complete Luria-Bertani medium or in defined S750 glucose minimal medium (41). Strain RL861 (Pspac ftsZ [24]) was grown in the presence of 1 mM IPTG (isopropyl--D-thiogalactopyranoside). Filamentation was induced by centrifuging mid-exponential phase cells, washing the cells twice, and resuspending the cells in the original volume of medium lacking IPTG, followed by 2 h of growth. The B. subtilis smc open reading frame-containing clone was assembled by joining two PCR-generated fragments (primers 5'GGGGATCCATGTTCCTCAAACGTTTAG3'/5'GTTTCGTCACATCTCCTAGC3' [pAS384] and 5'GCTTGCGAAGCTTCTCGGGC3'/5'TTCTCGAGTTACTGAACGAATTCTTTTG3' [pAS383]) into pT7(R)blue (Novagen). Genomic DNA from the strain isogenic to that containing the published smc sequence (a gift from Kunio Yamane, Tsukuba, Japan) was used as a template for PCR. Inserts in all constructed plasmids were verified by sequencing. The BamHI-AgeI and AgeI-XhoI fragments of pAS384 and pAS383, respectively, were cloned into the BamHI and XhoI sites of pBluescriptII (KS+). The resulting plasmid, pAS380, contained a BamHI site just upstream of the smc ATG codon. The variant of this vector containing a putative smc promoter, pAS388, was constructed by replacing the BamHI-AgeI portion of pAS380 with the PCR-generated BamHI-AgeI fragment (primers 5'ACAATTGGATCCCCCTTATGACTCAGGG3'/5'GTTTCGTCACATCTCCTAGC3') containing the 100-bp sequence upstream of the ATG codon. To generate a plasmid for disruption of the smc locus, a 586-bp PstI-EcoRV fragment in the 5' smc region from pAS388 was replaced by a kanamycin resistance cassette from pDG792 (BGSC), generating pSMC388kan. PY79 was transformed with ScaI-linearized pSMC388kan, with the resulting Kan^r transformants (5 µg/ml) verified by PCR and Western blotting, generating strain PG388. The vector containing a 3' portion of smc, pAS391, was constructed by cloning the PCR-generated BamHI-EcoRI fragment from pAS383 containing the 3' part of the smc open reading frame (nucleotides 1911 to 3558) into the corresponding sites of pJM103 (13). To generate a vector for deletion of the SMC C-terminal region, the central part of smc (primers 5'GAAGAGCTGCATGGTAAATG3'/5'GACAGAAACTTGTACCGTTC3') was PCR amplified and cloned into pT7(R)blue (pAS382); the SpeI-SpeI fragment of pAS382 (nucleotides 877 to 3020 of smc) was then cloned into the XbaI site of pJM103, establishing pAS385. PY79 was transformed with pAS385 selecting for chloramphenicol resistance (5 µg/ml), resulting in a single (Campbell-like) crossover integration of the plasmid. The generated strain, PG385, contains a truncated smc gene lacking its 3' one-sixth portion and expresses C-terminally truncated SMC protein, as verified by PCR and Western blotting.

Purification of an internal SMC fragment and generation of affinity-purified antibodies. To construct the E. coli expression vector pAS387, the internal smc fragment generated by the Asp718 restriction endonuclease of pAS380 was cloned into the corresponding site of pRSETa (Invitrogen). pAS387 was transformed into E. coli BL21(DE3)/pLysS (Novagen). The resulting transformants were grown in Luria-Bertani medium until mid-log phase, induced with 1 mM IPTG, and harvested after 2 h of further incubation, followed by sonic disruption. The 45-kDa recombinant polypeptide was purified sequentially by IMAC (ProBond resin; Invitrogen) and by elution of the corresponding band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Immunofluorescence microscopy. Immunofluorescence microscopy was performed according to Pogliano et al. (31). Cells were fixed with 0.0625% glutaraldehyde or 100% methanol, which resulted in indistinguishable staining patterns. Affinity-purified antibodies were employed in a 1:10 dilution; crude sera were used at a 1:800 dilution. Likewise, fluorescein isothiocyanate (FITC)- or Cy3-labelled secondary antibodies showed similar subcellular staining of SMC. DNase I (1 µg/ml) treatment of cells followed fixation for 15 min in phosphate-buffered saline.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

SMC is present during growth but is depleted during stationary phase. Polyclonal antibodies were raised against an internal fragment of SMC roughly corresponding to the second coiled-coil domain (see Materials and Methods). The antibodies specifically reacted with a protein of approximately 150 kDa that was present in a whole-cell extract of B. subtilis cells that had been harvested at the mid-exponential phase of growth in rich medium (Fig. 1, lane 1). No such species was detected with preimmune serum or immune serum that had been depleted of anti-SMC antibodies (not shown). Further evidence that the 150-kDa polypeptide is SMC was obtained by the use of an smc null mutant, as described below. We note that SMC migrates somewhat slower in SDS-PAGE than expected from its true size of 135 kDa, a property that has also been observed for SMC from eukaryotic cells (38). Interestingly, little or no SMC was detected in extracts from cells harvested 2 h after the end of exponential-phase growth (lane 2), an observation that suggests that SMC is depleted from stationary-phase cells.

View larger version (11K): [in this window] [in a new window]   FIG. 1.   Western blot analysis of SMC. Extracts that were prepared from cells collected from 150-µl samples of culture medium normalized to an optical density at 600 nm of 1 were loaded in each lane. The extracts were then fractionated by SDS-PAGE in an 8% gel. Western blot analysis was carried out with anti-SMC antibodies. The extracts were from cells of B. subtilis PY79 harvested during the mid-exponential phase or growth (lane 1) of 2 h after entry into stationary phase (lane 2) or from mid-exponential-phase cells of the null mutant strain PG388 (lane 3) or the C-terminal deletion mutant strain PG385 (lane 4).

SMC is associated with the chromosome but also localizes to discrete foci near opposite poles of the cell. We wished to determine the intracellular localization of SMC and therefore employed immunofluorescence microscopy. In agreement with the results of Western blot analysis (above), strong signals were detected in cells (from five independent cultures) grown in rich medium at various temperatures during the mid-exponential phase of growth (see, for example, Fig. 2A and B) but not in cells (>2,000 cells from three independent cultures were examined) that had entered stationary phase (see, for example, Fig. 2C; note that background signal in Fig. 2C was increased relative to that of other FITC panels in Fig. 2 to make the background visible).

View larger version (36K): [in this window] [in a new window]   FIG. 2.   Immunofluorescence microscopy of B. subtilis cells grown in rich medium with anti-SMC antibodies (FITC or Cy3 secondary antibodies; DAPI or PI staining of nucleoids). All cells were grown at 37°C except for smc mutant cells, which were grown at 20°C. Bars, 2 µm. (A) Field of PY79 cells harvested during the exponential phase of growth. Arrows indicate the presence of SMC foci in filaments i and ii; SMC foci are not present in filament iii. (B) Detail of two PY79 cells harvested during exponential growth. (C) PY79 cells harvested 2 h after entry into stationary phase. (D)Exponential-phase cells of PY79 that had been treated with DNase (the lines indicate the positions of septa which are visible as shadows in Nomarski images). (E) RL861 (Pspac ftsZ) grown in the absence of IPTG for 2 h. (F) PG388 cells (smc knockout) harvested during exponential growth. (G) PG385 cells (3' deletion of smc) harvested during exponential growth. With the exception of panel C, all FITC or PI images were scaled to the same intensity per pixel value of the highest and lowest signals. The background signal in panel C was increased to make it visible, because scaling to the same value as that use for the other panels would have yielded no detectable signal.

SMC foci are preferentially present in younger cells but absent in cells after chromosome segregation. Next, we asked whether the appearance of SMC in polar foci was associated with particular stages of the cell cycle. To investigate this question, we studied cells growing in minimal medium with glucose as the carbon source. Under these conditions, B. subtilis cells grow slowly (the generation time was 83 min) and do not initiate multiple rounds of DNA replication during each cell cycle (35, 36). In this experiment, the ends of cells (indicated by white lines in Fig. 3A) in the filaments were visualized by treatment with PI, which results in background staining of the cytosol and thereby causes counterstaining of septa, which are apparent as dark regions between cells (20).

View larger version (54K): [in this window] [in a new window]   FIG. 3.   Immunofluorescence microscopy of B. subtilis PY79 cells grown in minimal glucose medium with affinity-purified antibodies against SMC. Cells of PY79 were grown at 37°C and fixed during exponential phase. Bars, 2 µm. (A) Filaments i and ii contain short cells that have polar SMC foci, as indicated by arrows, whereas filaments iii and iv show longer cells lacking polar SMC structures. Lines indicate septa in filaments, as visualized by counterstaining with PI. (B) Two large cells (>2.8 µm) that have SMC foci (arrows) between segregated nucleoids.

View larger version (45K): [in this window] [in a new window]   FIG. 4.   Correlation of cell size with polar foci. PY79 cells in the exponential phase of growth in minimal glucose medium were fixed and immunostained for SMC. The clear presence of polar foci was scored with solid bars; the absence of polar foci was scored with shaded bars. In several cells that were >3 µm long, SMC foci were detectable at the midcell position between segregated nucleoids; these are not indicated in the diagram.

SMC foci form between nucleoids in aseptate filaments. To investigate if polar SMC foci are associated with the poles or the septa, strain RL861, in which the cell division gene ftsZ is under control of the inducible spac promoter, was grown in the absence of IPTG. Under these conditions, the cells become depleted of FtsZ and form long filaments lacking septa (2, 24). In these filaments, nucleoids are spaced at regular intervals corresponding to those in wild-type filaments (Fig. 2E, DAPI stain), since segregation of chromosomes does not require septation. Immunofluorescent staining of such filaments revealed that SMC foci were regularly spaced between pairs of separated nucleoids, with smaller foci sometimes being present between such pairs (Fig. 2E). These results show that SMC foci are capable of forming at regular positions in the absence of septa or cell poles.

Absence of polar foci in an smc insertion-deletion mutant. To investigate whether the polar foci were indeed due to SMC, we carried out immunofluorescence experiments using an smc insertion-deletion mutant. To disrupt the smc gene, B. subtilis PY79 was transformed with a plasmid in which a 500-bp fragment in the 5' region of smc (starting at the 234th codon) was replaced by a kanamycin resistance cassette by marker replacement (double) recombination. This created an insertion mutation (smc388) in which only about the first 20 percent of the gene was left intact, and indeed no SMC was detected by Western blot analysis in a whole-cell extract from cells of the insertion mutant (strain PG388) (Fig. 1, lane 3). In agreement with the findings of Britton et al. (5) and Moriya et al. (27), the mutant cells were viable at 20°C but grew about eightfold more slowly than did the wild type. The mutant was temperature sensitive and failed to grow at temperatures above 25°C in rich medium. At permissive temperature, about 9% of the cells were anucleate, as judged by using an overlay of images of DAPI staining and phase contrast of fixed cells. Nucleoid staining in fixed cells revealed that the chromosomes were greatly decondensed (Fig. 2F), as opposed to the much more regularly shaped chromosomes present in wild-type cells. As was recently shown (5, 27), these results indicate that smc performs an essential function in B. subtilis and is involved in maintenance of chromosome structure and in the segregation process. To insure that the deletion of smc had no polar effect on expression of the downstream srb gene, which is also essential for viability of B. subtilis (30), plasmid pAS391, containing a 3' portion of smc and a chloramphenicol resistance marker, was integrated into the B. subtilis chromosome by single-reciprocal (Campbell-like) recombination. Transformants (PG391) showed no detectable phenotype, validating the effects of smc disruption.

The C-terminal region of SMC is dispensable for polar localization but is required for viability and chromosome condensation. Insertion into smc of a plasmid (pAS385) containing an internal fragment of the gene extending from codon 292 to codon 1006 by single-reciprocal (Campbell-like) recombination generated a truncated smc gene that was lacking the 3' part of the codon sequence. Mutant cells (PG385) harboring the plasmid insertion produced a truncated SMC protein, which was expected to lack the putative DNA-binding domain in the C-terminal region of the protein (Fig. 1, lane 4). As evident from the Western blot (Fig. 1, lane 4), a faint band corresponding to wild-type SMC was also detectable in the mutant. We interpret the small amount of wild-type protein as being due to the presence (because of selective pressure) of a small proportion of cells in which pAS385 had undergone excision from the chromosome, which restored an intact smc gene. We believe that we could recognize such cells under fluorescence microscopy by the presence of a small number of cells each with a strongly condensed nucleoid (not shown).

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The principal contribution of this investigation is the discovery that SMC exhibits two patterns of subcellular localization. Some SMC was found associated with the chromosome. In addition, however, discrete foci of SMC were observed near the cell poles. Whereas the association of SMC with the chromosomes was disrupted by treatment of fixed cells with DNase, the polar foci remained intact during enzyme treatment. The results obtained with DNase treatment strengthen the view that some SMC is indeed associated with the chromosome and indicate that the localization of SMC near the cell poles is not dependent upon the maintenance of an intact chromosome. Experiments with a truncated form of SMC demonstrated that the C-terminal region of the protein, which is inferred to contain a putative ATPase domain (33), is required for association of SMC with the chromosome. Removal of the C-terminal region of the protein did not, however, impair the capacity of SMC to form polar foci. Thus, information for the polar localization of SMC evidently resides in the remaining N-terminal region of the protein. Using a fusion of SMC to GFP, Britton et al. (5) have also obtained evidence indicating that SMC associates with the cell poles.

These findings raise the question of the nature of the topological mark near the ends of cells that recruits SMC and allows for the formation of the polar foci. Whatever the nature of the mark, it is not the septum or the pole of the cell itself that is responsible for recruiting SMC. Strikingly, aseptate filaments generated by depriving cells of the cell division protein FtsZ exhibited SMC foci at regular intervals along their length. The ends of cells are generated by septum formation during the previous round of cell division. The observation that polar foci are formed in aseptate filaments indicates that whatever mark exists near the ends of cells that is responsible for recruiting SMC, its formation does not depend on cytokinesis. Possibly, the localization of SMC to foci is determined by DNA-free spaces between nucleoids in the cell or by the interaction of SMC with the edges of nucleoids. Other proteins, such as FtsZ and MinE in E. coli, are known to localize specifically to potential division sites even in the absence of cell division (1, 32). SMC, however, localizes to positions corresponding to polar sites, which do not depend on the formation of a division septum. Therefore, SMC might impart the positional information that is responsible for the segregation of chromosomes to opposite poles in wild-type cells and in opposite directions in aseptate filaments.

A further intriguing aspect of the subcellular localization of SMC is that the capacity to form polar foci was influenced by the growth phase of the cells and the stage of the cell cycle. Thus, cells became depleted of SMC after they entered stationary phase, and, in slowly growing cells that contained only one or two chromosomes, polar foci were principally present in young cells prior to or coincident with chromosome segregation. At stages following separation of chromosomes, polar SMC foci were no longer detectable, indicating that these structures may disassemble during the cell cycle. In further support for cell cycle-dependent formation of SMC foci, we have found that in large cells, SMC foci were frequently observed between segregated chromosomes such that, after division, the newborn cell would already have at least one polar SMC focus.

Recent work by Britton et al. (5) and Moriya et al. (27) and corroborating results presented here show that the SMC protein is needed for chromosome condensation and that an smc mutant frequently generates anucleate cells. Perhaps the polar foci are storage depots for SMC. Additionally or alternatively, SMC may be recruited onto chromosomes from the polar foci. In light of recent findings indicating that after duplication the replication origin regions of the chromosome move towards opposite poles of the cell (8, 9, 22, 23, 41, 42), release of SMC from the polar foci and recruitment onto chromosomes may mediate chromosome condensation and hence nucleoid segregation, as previously proposed (42). Segregation of nucleoids has been shown to be dependent on a prior phase of protein synthesis (6, 11). Conceivably, this may be due to a requirement for the synthesis of SMC early in the cell cycle.

Chromosome condensation in B. subtilis is also known to depend on the histone-like HBsu protein, which is essential for viability and which localizes to the nucleoid (18). Similarly, histone-like proteins HU, IHF, and H-NS are involved in chromosome compaction in E. coli (28). Interestingly, whereas the loss of MukB causes a heat-sensitive phenotype in E. coli, the absence of both HU and MukB is lethal. This finding suggests that HU and MukB may play partially overlapping roles in nucleoid condensation and segregation (15). Conceivably, the presence of HBsu may similarly partially compensate for the loss of SMC function in B. subtilis and allow inefficient chromosome partitioning at permissive temperatures.

Intriguingly, two other proteins involved in the process of chromosome segregation were shown to locate in a bipolar fashion. One is Spo0J, which binds to several sites around the chromosomal origins and after replication is rapidly segregated to polar positions in the cell (8, 23). Possibly, interaction of Spo0J and SMC at the poles triggers the release of SMC from the foci. The other protein is a subunit (ParC) of the topoisomerase IV protein, which decatenates replicated chromosomes. The ParC subunit was shown to localize to the cell poles in B. subtilis (14). These findings are consistent with the idea that at least a part of the segregation machinery may accumulate at the poles and, upon completion of replication, be released onto chromosomes.