Previous Article | Next Article 
Journal of Bacteriology, November 1998, p. 5885-5890, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Regulation and Physiological Role of the
DAS1 Gene, Encoding Dihydroxyacetone Synthase, in
the Methylotrophic Yeast Candida boidinii
Yasuyoshi
Sakai,*
Tomoyuki
Nakagawa,
Masayuki
Shimase, and
Nobuo
Kato
Division of Applied Life Sciences, Graduate
School of Agriculture, Kyoto University, Kitashirakawa-Oiwake,
Sakyo-ku, Kyoto 606-8502, Japan
Received 10 June 1998/Accepted 15 September 1998
 |
ABSTRACT |
The physiological role of dihydroxyacetone synthase (DHAS) in
Candida boidinii was evaluated at the molecular level. The
DAS1 gene, encoding DHAS, was cloned from the host genome,
and regulation of its expression by various carbon and nitrogen sources
was analyzed. Western and Northern analyses revealed that
DAS1 expression was regulated mainly at the mRNA level. The
regulatory pattern of DHAS was similar to that of alcohol oxidase but
distinct from that of two other enzymes in the formaldehyde
dissimilation pathway, glutathione-dependent formaldehyde dehydrogenase
and formate dehydrogenase. The DAS1 gene was disrupted in
one step in the host genome (das1
strain), and the
growth of the das1
strain in various carbon and nitrogen
sources was compared with that of the wild-type strain. The
das1
strain had completely lost the ability to grow on
methanol, while the strain with a disruption of the formate
dehydrogenase gene could survive (Y. Sakai et al., J. Bacteriol.
179:4480-4485, 1997). These and other experiments (e.g., those to
determine the expression of the gene and the growth ability of the
das1
strain on media containing methylamine or choline
as a nitrogen source) suggested that DAS1 is involved in
assimilation rather than dissimilation or detoxification of
formaldehyde in the cells.
 |
INTRODUCTION |
In methylotrophic yeasts,
formaldehyde is the key intermediate in methanol metabolism since it
stands at the branchpoint of pathways for methanol assimilation and
dissimilation. Since formaldehyde is an extremely toxic compound, its
intracellular level should be strictly regulated.
Dihydroxyacetone synthase (DHAS) (EC 2.2.1.3) catalyzes the first
reaction in the assimilation pathway by fixing formaldehyde to
D-xylulose 5-phosphate, after formaldehyde is
generated from methanol via alcohol oxidase (AOD) (EC 1.1.3.13)
(3, 11). Otherwise, in a formaldehyde oxidation
pathway, formaldehyde is dissimilated to CO2 through
enzymes, e.g., glutathione-dependent formaldehyde dehydrogenase (FLD)
(EC 1.2.1.1) and formate dehydrogenase (FDH) (EC 1.2.1.2).
So far, the physiological significance of these methanol-metabolizing
enzymes has been estimated mainly from the enzymatic properties of
purified enzyme or from phenotypes of mutants deficient in the specific
enzyme obtained via random mutagenesis. Through such analyses, for
example, FDH had been considered to be essential to the energy supply
for methylotrophic growth (2, 34). However, through gene
disruption analysis with Candida boidinii (23), the physiological role of FDH was revealed to be mainly detoxification of formate rather than stimulated energy generation. Such unexpected results with FDH led us to reevaluate the physiological roles of a key
enzyme in formaldehyde assimilation, DHAS, using a gene-disrupted strain.
Similar to other cases, the physiological function of DHAS as a
methanol assimilation enzyme has been estimated from its enzymatic properties and by analysis of a mutant obtained by random mutagenesis (13, 14). However, our previous study showed that loss of a
peroxisome membrane protein, Pmp47, not only inhibits transport of DHAS
into peroxisomes but also leads to loss of DHAS activity (26), raising the possibility that a previously derived
DHAS-deficient mutant strain (13, 14) did not represent the
specific mutation in the DHAS structural gene. In addition, we needed
to clone and disrupt the gene for DHAS in C. boidinii to
further investigate the molecular mechanism of peroxisomal transport of
DHAS in relation to the function of Pmp47. Furthermore, although the
strong and methanol-inducible promoter of the DHAS-encoding gene is
expected to be applicable to expression of various heterologous genes
in methylotrophic yeasts (37), the regulation of DHAS has
not been studied in detail.
This study was conducted (i) to see whether DHAS is involved in
detoxification of formaldehyde and (ii) to reveal how DHAS synthesis is
regulated by various carbon and nitrogen sources. First, C. boidinii DAS1, encoding DHAS, was cloned from the C. boidinii genome and its primary structure was determined. Next, the regulation of DAS1 expression by various carbon and
nitrogen sources was investigated and compared with that of other
methanol-metabolizing enzymes. Lastly, the das1
strain, a
mutant of C. boidinii harboring disrupted DAS1,
was constructed and used to study the physiological importance of the
enzyme in growth on various carbon and nitrogen sources. Our results
suggest that DHAS is involved mainly in the assimilation of
formaldehyde and that the physiological significance of DHAS for
formaldehyde detoxification is minor.
 |
MATERIALS AND METHODS |
Yeast and bacterial strains, media, and cultivation.
C.
boidinii TK62 (ura3) (22), which was derived
from C. boidinii S2, was used as the host for mutagenesis.
C. boidinii GC, which is a URA3 gene convertant
from strain TK62 (25), was used as the wild-type control
strain. Escherichia coli JM109 (29) was used for
plasmid preparation and for the construction of a C. boidinii genomic library.
Complex YPD and synthetic MI media were used for cultivation of
C. boidinii strains (24). YPD medium consisted of
1% (wt/vol) Bacto-Yeast Extract and 2% (wt/vol) Bacto-Peptone (Difco
Laboratories, Detroit, Mich.) and 2% glucose. Synthetic MI medium
consisted of 0.28% (wt/vol) KH2PO4, 0.06%
(wt/vol) MgSO4 · 7H2O, 0.045% (wt/vol)
EDTA · 2Na, 0.0055% (wt/vol)
CaCl2 · 2H2O, 0.004% (wt/vol) FeCl2 · 6H2O, 0.00085% (wt/vol)
MnSO4 · 3H2O, 0.0011% (wt/vol) ZnSO4 · 7H2O, 0.0002% (wt/vol)
CuSO4 · 5H2O, 0.00014% (wt/vol) CoCl2 · 2H2O, 0.00013% (wt/vol)
Na2MoO4 · 2H2O, 0.0002%
(wt/vol) H3PO3, 0.00003% (wt/vol) KI, and
carbon and nitrogen sources. The carbon source was one of the
following, unless stated otherwise: 2% (wt/vol) glucose, 2% (vol/vol)
glycerol, 1% (vol/vol) methanol, 0.5% (vol/vol) oleic acid, or 0.6%
(wt/vol) D-alanine. Tween 80 (Sigma Chemical, St. Louis,
Mo.) was added to oleic acid medium at a concentration of 0.05%
(vol/vol). The nitrogen source used was one of the following: 0.76%
(wt/vol) ammonium chloride, 0.5% (wt/vol) methylamine hydrochloride,
or 0.3% (wt/vol) choline chloride. The initial pH of the medium was
adjusted to 6.0. Cultivation was performed aerobically at 28°C with
reciprocal shaking, and growth was monitored by measuring the optical
density at 610 nm. Methanol induction of the das1
strain
was performed by transferring YPD-grown cells to methanol-MI medium at
an optical density at 610 nm of 0.5 and subsequently incubating them
for 16 h.
Preparation of crude extracts and enzyme assays.
Yeast cells
were broken on a 3110BX mini-beadbeater (Biospec Products,
Bartlesville, Okla.) in buffer A containing glass beads (diameter, 0.5 mm). Buffer A consisted of 50 mM potassium phosphate (pH 7.0), 5 mM
MgCl2, 0.5 mM thiamine pyrophosphate, 1 mM dithiothreitol, 1 mM EDTA, and 0.024% phenylmethylsulfonylfluoride. Glass beads and
cell debris were removed by centrifugation at 12,000 × g for 10 min at 4°C. DHAS activity was determined as described
previously by using
-hydroxypyruvate as the substrate
(38). Formaldehyde was determined by the method of Nash
(19). One unit of DHAS activity was defined as the amount of
protein required to consume 1 µmol of formaldehyde in 1 min.
AOD (
35), FLD (
33), FDH (
33), and
catalase (CTA) (
1) activities were determined as described
previously, and the
enzyme activity was defined according to the
literature in each
case. Protein was determined by the method of
Bradford with a
protein assay kit (Bio-Rad Laboratories, Hercules,
Calif.) by
using bovine serum albumin as the
standard.
Protein methods.
Standard 10% Laemmli gels (15),
with the separating gel at pH 9.2, were employed. Immunoblotting was
performed by the method of Towbin et al. (36) with the ECL
detection kit (Amersham, Arlington Heights, Ill.). Anti-DHAS polyclonal
antibody was as described previously (26).
Determination of the N-terminal amino acid sequence.
DHAS
was purified by the method of Kato et al. (12). The
N-terminal amino acid sequence of the purified enzyme was determined by
automated Edman degradation by using a Shimadzu PSQ-2 protein sequencer
(Shimadzu, Kyoto, Japan).
DNA and RNA methods.
Yeast DNA was purified by the method of
Cryer et al. (4) or Davis et al. (5). Total RNAs
were extracted from C. boidinii cells by using ISOGEN
(Nippon Gene, Toyama, Japan). Southern and Northern analyses were
performed as described previously (22, 27). The gel-purified
DNA fragment was 32P labeled by the random primer method
(6). The 1.8-kb EcoRV-BglII fragment
harboring the C. boidinii DAS1 coding region and the 0.9-kb
ClaI-HindIII fragment harboring the C. boidinii ACT1 (actin) coding region (26) were used for
Northern analyses.
Cloning and sequencing of the C. boidinii DAS1
gene.
In order to construct a pBluescript II KS+ gene library
(Stratagene, La Jolla, Calif.), C. boidinii S2 genomic DNA
was digested with EcoRI. The DNA fragments corresponding to
approximately 8.3 kb were inserted into the EcoRI site of
pBluescript II KS+ and transformed into E. coli JM109.
Transformants were transferred onto a Biodyne nylon membrane (Pall Bio
Support, East Hills, N.Y.). After lysis of the transformants and
binding of the liberated DNA to nylon membrane, these blots were colony
hybridized by using a 32P-labeled partial DHAS cDNA (the
0.5-kb fragment harboring the 3' half from the second XbaI
site in the coding region to the poly(A) tail) as the probe. This DHAS
cDNA clone, obtained during screening for methanol-inducible
peroxisomal genes, was a generous gift from J. M. Goodman,
University of Texas, Southwestern Medical Center at Dallas
(8). Positive clones were found to harbor a reactive 8.3-kb
EcoRI fragment, and the recovered plasmid was named pDAS1.
pDAS1 was sequenced by using a PRISM DyeDeoxy Terminator Cycle
sequencing kit and a model 373A DNA sequencer (Applied BioSystems, Foster City, Calif.) or by the dideoxy termination method of Sanger et
al. (30).
Disruption and expression of the DAS1 gene.
Transformation of C. boidinii TK62 and the das1
ura3 strain was performed by the modified lithium acetate method
(21). pDAS1 DNA was digested with EcoRV to
liberate the 3.8-kb fragment, including most of the DHAS-encoding
region. The remaining linear 7.5-kb fragment and the 4.3-kb
SacI-XhoI fragment of C. boidinii URA3
DNA from pSPR (28) were made blunt ended with T4 polymerase (Takara Co. Ltd., Kyoto, Japan) and then ligated, yielding the DAS1 disruption vector, pDAS
. pDAS
had the C. boidinii URA3 DNA as a selectable marker and the truncated
DAS1-flanking sequences. After digestion of pDAS
with
PstI and SalI, the liberated 8.8-kb fragment was
used to transform C. boidinii TK62 to uracil prototrophy. The gene disruption was confirmed by genomic Southern analysis using
EcoRI-digested genomic DNA from each transformant and the 32P-labeled 1.8-kb EcoRI-EcoRV
fragment harboring the 5'-flanking region of DAS1 as the
probe. The das1
strain was reverted to uracil auxotrophy
after 5-fluoroorotidic acid selection, yielding the das1
ura3 strain, by our previously described procedure
(28). The das1
aod1
strain was derived
by replacing a 1,579-bp StyI fragment within the
AOD1 coding region (27) of the das1
ura3 strain with the 4.3-kb SacI-XhoI
fragment of C. boidinii URA3 DNA from pSPR (28).
The
DAS1 expression plasmid was constructed by introducing
the PCR-amplified
DAS1 coding region, having two flanking
NotI
sites, into pNoteI (
20). The primers used
for PCR amplification
were as follows: forward primer,
5'GCGGCCGCAAATGGCTCTCGCAAAAGCTGC3';
reverse primer,
5'GCGGCCGCTTATAAATGATTTTGATCATGTTTTG3'. The identity
of the
PCR product obtained was confirmed by DNA sequence analysis.
The
constructed plasmid had the
DAS1 coding gene under control
of the
C. boidinii AOD1 promoter and the
C. boidinii
URA3 gene.
The plasmid was linearized with
BamHI and
introduced into the
C. boidinii das1
ura3 strain.
Nucleotide sequence accession number.
The nucleotide
sequence of DAS1 has been submitted to GenBank and assigned
accession no. AF086822.
 |
RESULTS AND DISCUSSION |
Primary structure of C. boidinii DAS1.
During sequencing
of the cDNA library clones obtained from methanol-grown C. boidinii ATCC 32195 (8), Goodman et al. had found a
partial clone that coded for an open reading frame (ORF) similar to the
deduced amino acid sequence of Hansenula polymorpha DHAS
(8a, 10) (unpublished data). Using this putative
DAS1 fragment as the probe, we obtained the complete
DAS1 clone from the genomic library of C. boidinii S2. DAS1 consists of a 2,118-bp ORF
corresponding to a protein of 706 amino acid residues (Fig. 1). This ORF was identified as the gene
encoding DHAS based on (i) the identity of the N-terminal amino acid
sequence, NH2-ALAKAASINDDIHDLTMRAFR-, derived with that of
the purified DHAS protein; (ii) agreement of the calculated molecular
mass of this protein (78,132 Da) with that of the purified DHAS as
determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) (78 kDa); and (iii) the loss of DHAS activity in the
das1
strain (described below). The sequence encoded by
the DAS1 coding region showed greater similarity to the
deduced amino acid sequence of the H. polymorpha DAS product (69% identity) (10) than to the sequences of other
transketolases from Saccharomyces cerevisiae (7,
31) and Pichia stipitis (17) (39 to 41%
identity) (Fig. 1). All of these transketolases contained transketolase
signature 1 (amino acid residues 22 to 42) (16),
transketolase signature 2 (residues 482 to 517) (16, 32),
the catalytic domain of transketolase (residues 418 to 434)
(7), and a possible thiamine pyrophosphate binding domain (residues 165 to 196) (9, 32) (Fig. 1).

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of the deduced amino acid sequence of the
C. boidinii DAS1 (Cb DAS1) product with sequences
of H. polymorpha DHAS (Hp DAS) (GenBank accession
no. X02424 [10]), S. cerevisiae
transketolase 1 (Sc TKT1) (GenBank accession no. X73224
[31]) and transketolase 2 (Sc TKT2)
(GenBank accession no. X73532 [31]), and P. stipitis transketolase (Ps TKT1) (GenBank accession no.
Z26486 [17]). White letters indicate amino acid
residues identical to those of the C. boidinii DAS1
product.
|
|
Regulation of DAS1 expression by various carbon and
nitrogen sources.
The activities of methanol-metabolizing enzymes
in C. boidinii cells grown on different carbon and nitrogen
sources were studied. As shown in Table
1, when NH4Cl was used as the
sole nitrogen source for growth, DHAS activity was induced by methanol
but was not induced by glucose, glycerol, or other peroxisome-inducing carbon sources, i.e., oleate and D-alanine. DHAS induction
by methanol was repressed by glucose (Table 1; glucose + methanol) but not by glycerol (Table 1; glycerol + methanol). Methylamine and choline, when used as nitrogen sources, are known to be metabolized to formaldehyde in yeast cells (18). When either of these
substrates was used as a nitrogen source together with glycerol as the
carbon source, we observed induction of DHAS activity (Table 1;
MA/glycerol or Chl/glycerol). In contrast, when glucose was used as the
carbon source, DHAS activity was not induced (Table 1; MA/glucose or Chl/glucose). These results indicate that DHAS activity was induced by
methanol or formaldehyde and that induction of DHAS activity suffers
from repression by glucose but not by glycerol.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Relative activities of enzymes related to methanol
metabolism during growth on various carbon and
nitrogen sourcesa
|
|
As shown in Table
1, regulation of DHAS was more like that of AOD than
the other two enzymes, FDH and FLD, both involved
in the formaldehyde
oxidation pathway; i.e., AOD and DHAS showed
complete repression by
glucose, while FLD and FDH did not, when
formaldehyde was generated in
the cells via methylamine or choline
metabolism.
Next,
DAS1 expression was monitored at the protein and mRNA
levels. We conducted Western and Northern analyses by using crude
extracts and total RNAs extracted from
C. boidinii cells
grown
on each carbon and nitrogen source (Fig.
2). These regulatory
patterns of
DAS1 expression and the regulatory pattern of DHAS
enzyme
activity (Table
1) coincided each other. Therefore, the
regulation of
DHAS activity was confirmed to be controlled mainly
at the mRNA level.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Regulation of DAS1 expression in C. boidinii. (A) Western analysis. Protein (20 µg) was separated by
SDS-PAGE and detected with anti-DHAS polyclonal antibodies. (B)
Northern analysis. Total RNA (20 µg) was loaded in each lane and
probed with either the 32P-labeled DAS1 or the
32P-labeled ACT1 (actin) DNA as described in
Materials and Methods. Carbon sources in each lane are as follows:
lanes 1, 8, and 9, glucose; lanes 2, 6, and 7, glycerol; lane 3, methanol; lane 4, oleate; lane 5, D-alanine; and lane 10, glucose plus methanol. Nitrogen sources in each lane are as follows:
lanes 1, 2, 3, 4, 5, and 10, NH4Cl; lanes 6 and 8, methylamine; and lanes 7 and 9, choline. The concentrations of carbon
and nitrogen sources are described in Materials and Methods.
|
|
Disruption of the DAS1 gene causes defects in growth on
methanol and glycerol-plus-methanol media.
Disruption of the
DAS1 gene was confirmed by Southern analysis with
EcoRI-digested DNA from each transformant (Fig.
3A). The DNA from the wild-type strain
gave a signal of 8.3 kb; this signal shifted to 8.8 and 5.5 kb in the
das1
and das1
ura3 strains, respectively,
as expected for disruption and deletion of the URA3 sequence, caused by a homologous recombination (Fig. 3B).
Methanol-induced cells of the das1
strain did not show
any DHAS activity but exhibited AOD (1.8 U/mg of protein), CTA (2,611 U/mg of protein), FLD (0.62 U/mg of protein), and FDH (0.40 U/mg of
protein) activities comparable to the levels for the wild-type strain
(Table 1). Western analysis using anti-DHAS antibody showed no signal
in the cell extracts of the das1
strain and the
das1
ura3 strain (Fig. 3C).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
One-step disruption of the DAS1 gene in
C. boidinii. (A) Restriction map of the cloned fragment and
disruption strategy. The lightly shaded boxes and arrows at both ends
of URA3 show repeated sequences for homologous recombination
to remove the URA3 gene after the gene disruption. (B)
Genomic Southern analysis of EcoRI-digested total DNAs (3 µg of each) from the host strain TK62 (lane 1), the
das1 strain (lane 2), and the das1 ura3
strain (lane 3) probed with the 32P-labeled 1.8-kb
EcoRI-EcoRV fragment, including the 5'-flanking
region of DAS1. (C) Immunoblot analysis of strain TK62 (lane
1), the das1 strain (lane 2), and the das1
ura3 strain (lane 3) with extracts of methanol-induced cells and
anti-DHAS polyclonal antibody.
|
|
The
das1
strain had lost the ability to grow on methanol
both in a batch culture (Fig.
4A) and in
a methanol-limited chemostat
culture (
D = 0.05
h
1). Again, these results differed from the growth of the
fdh1
strain, which was retarded in a methanol batch
culture and one-fourth
the maximum yield in a methanol-limited
chemostat culture (
23).
The growth of the
das1
strain on methanol was restored by the
expression of the coding region
of the
DAS1 gene under control
of the
C. boidinii
AOD1 promoter (Fig.
4A).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Growth of the wild-type and das1 strains
on various carbon and nitrogen sources. MA, methylamine. Symbols: ,
wild-type strain; , das1 strain; ,
aod1 · das1 strain; , das1
strain expressing DAS1 under control of the AOD1
promoter. O.D. 610, optical density at 610 nm.
|
|
Growth of the
das1
strain had a prolonged lag period on
medium containing glycerol plus methanol (Fig.
4C) relative to the
rate
for the wild-type strain. This growth inhibition may be due
mainly to
the toxicity of formaldehyde produced by AOD from methanol
in the
medium, since this growth retardation was not observed
in the
das1
aod1
strain, the double disruptant of
AOD1 and
DAS1 (Fig.
4C). In contrast to its
growth on glycerol-plus-methanol
medium, the
das1
strain
showed the same growth as the wild-type
strain in media containing
glycerol and methylamine (Fig.
4D)
and glycerol and choline (data not
shown).
Physiological role of DHAS as an assimilatory enzyme.
The
syntheses of methanol-assimilatory and -dissimilatory enzymes have been
considered to be regulated under the same control system through
methanol induction and glucose repression (14). In C. boidinii, the regulatory pattern of DHAS was similar to that of
AOD. However, the regulation of AOD and DHAS was clearly distinct from
the regulation of enzymes in the dissimilation pathway, i.e., FDH and FLD.
Our previous study of
FDH1 regulation and gene disruption
revealed that the main physiological role of the glutathione-dependent
formaldehyde oxidation pathway is detoxification of formaldehyde
and
formate (
23). Comparison of the present results with those
obtained in the previous study has revealed several differences
in both
regulation and knockout effect between the
DAS1 and
FDH1 genes. (i) The
fdh1
strain retained the
ability to grow on methanol,
but the
das1
strain did not.
(ii) The
FDH1 expression was observed
under all conditions
where formaldehyde is generated in the cells,
i.e., with media
containing glucose and methylamine, glucose and
choline, glycerol and
methylamine, glycerol and choline, and glycerol
plus methanol. However,
DAS1 expression was not detected in glucose-methylamine
or
glucose-choline medium. (iii) The defect in growth of the
fdh1
strain was observed in all media where
FDH1 expression occurred.
In contrast, even though
DAS1 was expressed in glycerol-methylamine
and
glycerol-choline media, we could not observe any defect in
growth of
the
das1
strain on these
media.
These results represent differences in the physiological roles of
DAS1 and
FDH1: the main role of DHAS may be
fixation of
formaldehyde into cell constituents, which is different
from that
of FDH, which is involved in the detoxification of formate.
This
was supported by the observation that the wild-type strain had
a
growth yield ca. four times higher than those of the
das1
strain
or the
das1
aod1
strain on medium
containing glycerol plus methanol
(Fig.
4C). Furthermore, the growth
yields of these two
das1
strains
on medium containing
methanol plus glycerol were the same as those
on glycerol medium (Fig.
4B). These results indicate that methanol
was not assimilated in these
das1
strains during growth on medium
containing glycerol
plus methanol and strongly suggest that DHAS
is involved mainly in the
assimilation of
formaldehyde.
In a previous study, we showed that Pmp47 is necessary for the
translocation and folding of DHAS but not of AOD or CTA
(
26).
Further analysis with the
DAS1 gene and the
das1
strain obtained
in this study will enable us to
reveal the relationship between
DHAS import into peroxisomes and the
function of Pmp47 at the
molecular
level.
 |
ACKNOWLEDGMENTS |
We thank Joel M. Goodman for generously donating the partial cDNA
clone for DHAS.
This work was partly supported by a grant-in-aid for Scientific
Research from the Ministry of Education, Science, Sports and Culture,
Japan, to Y.S.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Applied Life Sciences, Graduate School of Agriculture, Kyoto
University, Kitashirakawa-Oiwake, Sakyo-ku, Kyoto 606-8502, Japan.
Phone: 81-75-753-6455. Fax: 81-75-753-6385. E-mail:
ysakai{at}kais.kyoto-u.ac.jp.
 |
REFERENCES |
| 1.
|
Bergmeyer, H. U.
1955.
Zur Messung von Katalase Aktivitäten.
Biochem. Z.
327:255-258[Medline].
|
| 2.
|
Bystrykh, L. V.,
L. R. Aminova, and Y. A. Trotsenko.
1988.
Methanol metabolism in mutants of the methylotrophic yeast, Hansenula polymorpha.
FEMS Microbiol. Lett.
51:89-94.
|
| 3.
|
Bystrykh, L. V.,
A. P. Sokolov, and Y. A. Trotsenko.
1981.
Purification and properties of dihydroxyacetone synthase from the methylotrophic yeast, Candida boidinii.
FEBS Lett.
132:324-328.
|
| 4.
|
Cryer, D. R.,
R. Eccleshal, and J. Murmer.
1975.
Isolation of yeast DNA.
Methods Cell Biol.
12:39-44[Medline].
|
| 5.
|
Davis, R. W.,
M. Thomas,
J. Cameron,
T. P. St. John,
S. Scherer, and R. A. Padgett.
1980.
Rapid DNA isolations for enzymatic and hybridization analysis.
Methods Enzymol.
65:404-411[Medline].
|
| 6.
|
Feinberg, A. P., and B. Vogelstein.
1983.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:6-13[Medline].
|
| 7.
|
Fletcher, T. S.,
I. L. Kwee,
T. Nakada,
C. Largman, and B. M. Martin.
1992.
DNA sequence of the yeast transketolase gene.
Biochemistry
31:1892-1896[Medline].
|
| 8.
|
Garrard, L. J., and J. M. Goodman.
1989.
Two genes encode the major membrane-associated protein of methanol-induced peroxisomes from Candida boidinii.
J. Biol. Chem.
264:13929-13937[Abstract/Free Full Text].
|
| 8a.
| Goodman, J. M. Unpublished data.
|
| 9.
|
Hawkins, C. F.,
A. Borges, and P. N. Perham.
1989.
A common structural motif in thiamin pyrophosphate-binding enzymes.
FEBS Lett.
255:77-82[Medline].
|
| 10.
|
Janowicz, Z.,
M. Eckart,
C. Drewke,
R. Roggenkamp,
C. P. Hollenberg,
J. Maat,
A. M. Ledeboer,
C. Visser, and C. T. Verrips.
1985.
Cloning and characterization of the DAS gene encoding the major methanol assimilatory enzyme from the methylotrophic yeast Hansenula polymorpha.
Nucleic Acids Res.
13:3043-3062[Abstract/Free Full Text].
|
| 11.
|
Kato, N.,
T. Higuchi,
C. Sakazawa,
T. Nishizawa,
Y. Tani, and H. Yamada.
1982.
Purification and properties of a transketolase responsible for formaldehyde fixation in a methanol-utilizing yeast, Candida boidinii (Kloeckera sp.) no. 2201.
Biochim. Biophys. Acta
715:143-150[Medline].
|
| 12.
|
Kato, N.,
T. Nishizawa,
C. Sakazawa,
Y. Tani, and H. Yamada.
1979.
Xylulose 5-phosphate-dependent fixation of formaldehyde in a methanol-utilizing yeast, Kloeckera sp. no. 2201.
Agric. Biol. Chem.
43:2013-2015.
|
| 13.
|
Koning, W. D.,
K. Bonting,
W. Harder, and L. Dijkhuizen.
1990.
Classical transketolase functions as the formaldehyde-assimilating enzyme during growth of a dihydroxyacetone synthase-negative mutant of the methylotrophic yeast Hansenula polymorpha on mixtures of xylose and methanol in continuous culture.
Yeast
6:117-125.
|
| 14.
|
Koning, W. D.,
M. A. G. Gleeson,
W. Harder, and L. Dijkhuizen.
1987.
Regulation of methanol metabolism in the yeast Hansenula polymorpha. Isolation and characterization of mutants blocked in methanol assimilatory enzymes.
Arch. Microbiol.
147:375-382.
|
| 15.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 16.
|
Lindqvist, Y.,
G. Schneider,
U. Ermler, and M. Sundstrom.
1992.
Three-dimensional structure of transketolase, a thiamine diphosphate dependent enzyme, at 2.5 Å resolution.
EMBO J.
11:2373-2379[Medline].
|
| 17.
|
Metzger, M. H., and C. P. Hollenberg.
1994.
Isolation and characterization of the Pichia stipitis transketolase gene and expression in a xylose utilising Saccharomyces cerevisiae transformant.
Appl. Microbiol. Biotechnol.
42:319-325[Medline].
|
| 18.
|
Mori, N.,
K. Shirakawa,
K. Uzura,
Y. Kitamoto, and Y. Ichikawa.
1988.
Formation of ethylene glycol and trimethylamine from choline by Candida tropicalis.
FEMS Microbiol. Lett.
51:41-44.
|
| 19.
|
Nash, T.
1953.
The colorimetric estimation of formaldehyde by means of the Hantzsch reaction.
Biochem. J.
55:416-421[Medline].
|
| 20.
|
Sakai, Y.,
M. Akiyama,
H. Kondoh,
Y. Shibano, and N. Kato.
1996.
High-level secretion of fungal glucoamylase using the Candida boidinii gene expression system.
Biochim. Biophys. Acta
1308:81-84[Medline].
|
| 21.
|
Sakai, Y.,
T. K. Goh, and Y. Tani.
1993.
High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.
J. Bacteriol.
175:3556-3562[Abstract/Free Full Text].
|
| 22.
|
Sakai, Y.,
T. Kazarimoto, and Y. Tani.
1991.
Transformation system for an asporogenous methylotrophic yeast, Candida boidinii: cloning of the orotidine-5'-phosphate decarboxylase gene (URA3), isolation of uracil auxotrophic mutants, and use of the mutants for integrative transformation.
J. Bacteriol.
173:7458-7463[Abstract/Free Full Text].
|
| 23.
|
Sakai, Y.,
A. P. Murdanoto,
T. Konishi,
A. Iwamatsu, and N. Kato.
1997.
Regulation of the formate dehydrogenase gene, FDH1, in the methylotrophic yeast Candida boidinii and growth characteristics of an FDH1-disrupted strain on methanol, methylamine, and choline.
J. Bacteriol.
179:4480-4485[Abstract/Free Full Text].
|
| 24.
|
Sakai, Y.,
T. Rogi,
R. Takeuchi,
N. Kato, and Y. Tani.
1995.
Expression of Saccharomyces adenylate kinase gene in Candida boidinii under the regulation of its alcohol oxidase promoter.
Appl. Microbiol. Biotechnol.
42:860-864[Medline].
|
| 25.
|
Sakai, Y.,
T. Rogi,
T. Yonehara,
N. Kato, and Y. Tani.
1994.
High-level ATP production by a genetically-engineered Candida yeast.
Bio/Technology
12:291-293[Medline].
|
| 26.
|
Sakai, Y.,
A. Saiganji,
H. Yurimoto,
K. Takabe,
H. Saiki, and N. Kato.
1996.
The absence of Pmp47, a putative yeast peroxisomal transporter, causes defect in transport and folding of a specific matrix enzyme.
J. Cell Biol.
134:37-51[Abstract/Free Full Text].
|
| 27.
|
Sakai, Y., and Y. Tani.
1992.
Cloning and sequencing of the alcohol oxidase-encoding gene (AOD1) from the formaldehyde-producing asporogenous methylotrophic yeast, Candida boidinii S2.
Gene
114:67-73[Medline].
|
| 28.
|
Sakai, Y., and Y. Tani.
1992.
Directed mutagenesis in an asporogenous methylotrophic yeast: cloning, sequencing, and one-step gene disruption of the 3-isopropylmalate dehydrogenase gene (LEU2) of Candida boidinii to derive doubly auxotrophic marker strains.
J. Bacteriol.
174:5988-5993[Abstract/Free Full Text].
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 31.
|
Schaaff-Gerstenschlager, I.,
G. Mannhaupt,
I. Vetter,
F. K. Zimmermann, and H. Feldmann.
1993.
TKL2, a second transketolase gene of Saccharomyces cerevisiae; cloning, sequence and deletion analysis of the gene.
Eur. J. Biochem.
217:487-492[Medline].
|
| 32.
|
Schenk, G.,
R. Layfield,
J. M. Candy,
R. G. Duggleby, and P. F. Nixon.
1997.
Molecular evolutionary analysis of the thiamine-diphosphate-dependent enzyme, transketolase.
J. Mol. Evol.
44:552-572[Medline].
|
| 33.
|
Schütte, H.,
J. Flossdorf,
H. Sahm, and M.-R. Kula.
1976.
Purification and properties of formaldehyde dehydrogenase and formate dehydrogenase from Candida boidinii.
Eur. J. Biochem.
62:151-160[Medline].
|
| 34.
|
Sibirny, A. A.,
V. M. Ubiyvovk,
M. V. Gonchar,
V. I. Titorenko,
A. Y. Voronovsky, and Y. G. Kapultsevich.
1990.
Reactions of direct formaldehyde oxidation to CO2 are non-essential for energy supply of yeast methylotrophic growth.
Arch. Microbiol.
154:566-575.
|
| 35.
|
Tani, Y.,
Y. Sakai, and H. Yamada.
1985.
Isolation and characterization of a mutant of a methanol yeast, Candida boidinii S2, with higher formaldehyde productivity.
Agric. Biol. Chem.
49:2699-2706.
|
| 36.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 37.
|
Tschopp, J. F.,
P. F. Burst,
J. M. Cregg,
S. A. Stillman, and T. R. Gingeras.
1987.
Expression of a lacZ gene from two methanol-regulated promoters in Pichia pastoris.
Nucleic Acids Res.
15:3859-3876[Abstract/Free Full Text].
|
| 38.
|
Yanase, H.,
M. Okuda,
K. Kita,
Y. Sato,
K. Shibata,
Y. Sakai, and N. Kato.
1995.
Enzymatic preparation of [1,3-13C]dihydroxyacetone phosphate from [13C]methanol and hydroxypyruvate using the methanol-assimilating system of methylotrophic yeasts.
Appl. Microbiol. Biotechnol.
43:228-234.
|
Journal of Bacteriology, November 1998, p. 5885-5890, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yano, T., Takigami, E., Yurimoto, H., Sakai, Y.
(2009). Yap1-Regulated Glutathione Redox System Curtails Accumulation of Formaldehyde and Reactive Oxygen Species in Methanol Metabolism of Pichia pastoris. Eukaryot Cell
8: 540-549
[Abstract]
[Full Text]
-
Sasano, Y., Yurimoto, H., Yanaka, M., Sakai, Y.
(2008). Trm1p, a Zn(II)2Cys6-Type Transcription Factor, Is a Master Regulator of Methanol-Specific Gene Activation in the Methylotrophic Yeast Candida boidinii. Eukaryot Cell
7: 527-536
[Abstract]
[Full Text]
-
Seo, J.-G., Park, S. W., Park, H., Kim, S. Y., Ro, Y. T., Kim, E., Cho, J. W., Kim, Y. M.
(2007). Cloning, characterization and expression of a gene encoding dihydroxyacetone synthase in Mycobacterium sp. strain JC1 DSM 3803. Microbiology
153: 4174-4182
[Abstract]
[Full Text]
-
Nakagawa, T., Yamada, K., Fujimura, S., Ito, T., Miyaji, T., Tomizuka, N.
(2005). Pectin utilization by the methylotrophic yeast Pichia methanolica. Microbiology
151: 2047-2052
[Abstract]
[Full Text]
-
Mitsui, R., Kusano, Y., Yurimoto, H., Sakai, Y., Kato, N., Tanaka, M.
(2003). Formaldehyde Fixation Contributes to Detoxification for Growth of a Nonmethylotroph, Burkholderia cepacia TM1, on Vanillic Acid. Appl. Environ. Microbiol.
69: 6128-6132
[Abstract]
[Full Text]
-
Molin, M., Norbeck, J., Blomberg, A.
(2003). Dihydroxyacetone Kinases in Saccharomyces cerevisiae Are Involved in Detoxification of Dihydroxyacetone. J. Biol. Chem.
278: 1415-1423
[Abstract]
[Full Text]
-
Lee, B., Yurimoto, H., Sakai, Y., Kato, N.
(2002). Physiological role of the glutathione-dependent formaldehyde dehydrogenase in the methylotrophic yeast Candida boidinii. Microbiology
148: 2697-2704
[Abstract]
[Full Text]
-
Nakagawa, T., Miyaji, T., Yurimoto, H., Sakai, Y., Kato, N., Tomizuka, N.
(2000). A Methylotrophic Pathway Participates in Pectin Utilization by Candida boidinii. Appl. Environ. Microbiol.
66: 4253-4257
[Abstract]
[Full Text]
-
Mitsui, R., Sakai, Y., Yasueda, H., Kato, N.
(2000). A Novel Operon Encoding Formaldehyde Fixation: the Ribulose Monophosphate Pathway in the Gram-Positive Facultative Methylotrophic Bacterium Mycobacterium gastri MB19. J. Bacteriol.
182: 944-948
[Abstract]
[Full Text]
-
Nakagawa, T., Imanaka, T., Morita, M., Ishiguro, K., Yurimoto, H., Yamashita, A., Kato, N., Sakai, Y.
(2000). Peroxisomal Membrane Protein Pmp47 Is Essential in the Metabolism of Middle-chain Fatty Acid in Yeast Peroxisomes and Is Associated with Peroxisome Proliferation. J. Biol. Chem.
275: 3455-3461
[Abstract]
[Full Text]