Previous Article | Next Article 
Journal of Bacteriology, November 1998, p. 5984-5988, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The yiaE Gene, Located at 80.1 Minutes
on the Escherichia coli Chromosome, Encodes a
2-Ketoaldonate Reductase
Do-Young
Yum,
Bong-Yong
Lee,
Dae-Hyum
Hahm, and
Jae-Gu
Pan*
Bioprocess Engineering Division, Korea
Research Institute of Bioscience and Biotechnology, Yusong, Taejon
305-600, Korea
Received 10 April 1998/Accepted 4 September 1998
 |
ABSTRACT |
An open reading frame located in the bisC-cspA
intergenic region, or at 80.1 min on the Escherichia coli
chromosome, encodes a hypothetical 2-hydroxyacid dehydrogenase, which
was identified as a result of the E. coli Genome Sequencing
Project. We report here that the product of the gene (yiaE)
is a 2-ketoaldonate reductase (2KR). The gene was cloned and expressed
with a C-terminal His tag in E. coli, and the protein was
purified by metal-chelate affinity chromatography. The determination of
the NH2-terminal amino acid sequence of the protein defined
the translational start site of this gene. The enzyme was found to be a
2KR catalyzing the reduction of 2,5-diketo-D-gluconate to
5-keto-D-gluconate, 2-keto-D-gluconate (2KDG)
to D-gluconate, 2-keto-L-gulonate to L-idonate. The reductase was optimally active at pH 7.5, with NADPH as a preferred electron donor. The deduced amino acid
sequence showed 69.4% identity with that of 2KR from Erwinia
herbicola. Disruption of this gene on the chromosome resulted in
the loss of 2KR activity in E. coli. E. coli W3110 was
found to grow on 2KDG, whereas the mutant deficient in 2KR activity was
unable to grow on 2KDG as the carbon source, suggesting that 2KR is
responsible for the catabolism of 2KDG in E. coli and the
diminishment of produced 2KDG from D-gluconate in the
cultivation of E. coli harboring a cloned gluconate
dehydrogenase gene.
 |
INTRODUCTION |
We previously reported the cloning
and expression of a gene cluster encoding three subunits of
membrane-bound gluconate dehydrogenase (GADH) from Erwinia
cypripedii in Escherichia coli (26). In the
course of further study on the conversion of D-gluconate to 2-keto-D-gluconate (2KDG) with a recombinant E. coli strain, we observed that the level of 2KDG produced in the
medium gradually decreased after the exhaustion of
D-gluconate in the medium (see Fig. 1). In an effort to
find the reason, the NADPH-dependent reductase activity catalyzing the
conversion of 2KDG to D-gluconate was detected in extracts
of E. coli cells. This result suggested the existence of
enzymes involved in ketogluconate metabolism in E. coli, as
reported for several species of the genera Corynebacterium, Brevibacterium, Erwinia, Acetobacter,
Gluconobacter, Serratia, and
Pseudomonas (20, 23, 25). In Erwinia,
Acetobacter, Gluconobacter, Serratia,
and Pseudomonas, oxidation of glucose to ketogluconates such
as 2KDG, 5-keto-D-gluconate (5KDG), and
2,5-diketo-D-gluconate (25DKG) has been shown to proceed
via membrane-bound dehydrogenases, which are linked to the electron
transport chain (2, 21). The ketogluconates or their
phosphorylated forms are unique substrates in that they enter into
central metabolism only after they are reduced by NADPH-dependent
reductases (20, 23). NADPH-dependent 2-ketoaldonate
reductase (2KR), which catalyzes the reduction of 2KDG to
D-gluconate, 25DKG to 5KDG, and
2-keto-L-gulonate (2KLG) to L-idonate (IA), has
been purified and characterized from Brevibacterium ketosoreductum (25) and Erwinia
herbicola (23). Even if the substrate specificity has
not been examined with 25DKG as a substrate, 2KDG reductases from
acetic acid bacteria also catalyze the reduction of 2KLG to IA as well
as of 2KDG to D-gluconate (1).
Until now, no ketoaldonate reductase has been reported for E. coli. We report here that the product of the yiaE gene,
located in the bisC-cspA intergenic region at 80.1 min on
the E. coli chromosome, is a 2KR; in addition, the
diminishment of produced 2KDG from D-gluconate in the
cultivation of recombinant E. coli harboring a cloned
membrane-bound GADH gene is due to 2KR as the cytosolic enzyme
responsible for conversion of 2KDG to D-gluconate. We found
also that E. coli W3110 grows on 2KDG as the sole carbon source.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
E. coli W3110
(22) and DH5
[F
endA1 hsdR17
(rK
mK+) supE44
thi-1 recA1 gyrA relA1
(argF-lac)U169
deoR
80lacZ
M15] (16) were used as
host strains. Strain JC7623 (recBC sbcBC) (24) was used for site-directed insertion mutagenesis. Strain W3110 (yiaE::Km) was constructed by P1 transduction of a
yiaE::Km allele into strain W3110. E. coli strains were routinely grown at 37°C in Luria broth (LB) or
M9 minimal medium (16) with carbohydrate. For mutant
characterization, M9 medium with 2KDG as the carbon source was used.
Where appropriate, ampicillin (100 µg/ml) and kanamycin (15 µg/ml)
were included in the growth media.
Bioconversion of D-gluconate to 2KDG by recombinant
E. coli harboring the cloned GADH gene.
The seed
culture of recombinant E. coli W3110(pGA313) (26)
was grown in EP medium, which consists of 0.5 g of yeast extract (Difco), 0.3 g of peptone (Difco), 0.01 g of
KH2PO4, 0.05 g of NaCl, and 0.1 g of
NH4Cl (pH 7.0) in 100 ml of distilled water. The flask was
inoculated with cells obtained from a fresh plate of a strain, followed
by incubation at 37°C for 12 h on a rotary shaker. The 50 ml of
seed culture of recombinant E. coli was inoculated into 1 liter of EP medium containing 30 g of
D-gluconate/liter in a 2-liter fermentor and cultivated at
37°C for 24 h with aeration at 1 vvm and agitation at 500 rpm.
Bacterial growth was measured by the optical density at 600 nm.
DNA preparation and manipulation.
Total DNA from E. coli was prepared by using QIAGEN Genomic Tips. DNAs of the vector
plasmids were prepared by a rapid alkaline lysis procedure
(5). General DNA manipulations were carried out as described
by Maniatis et al. (16). DNA sequencing of both strands was
performed with an ABI373 automated sequencer with dye-labelled
terminators (Applied Biosystems Division of Perkin-Elmer).
Oligonucleotides were synthesized by Bioneer (Chungweon, Korea).
Enzyme assay and determination of D-gluconate, 2KDG,
5KDG, 2KLG, 25DKG, and IA.
2KR activity was assayed as described
previously (18). The reaction was monitored for an initial
decrease in absorbance at 340 nm (
= 6.22 mM
1
cm
1). One unit of activity corresponds to the production
of 1 µmol of NADP+ per min. The protein concentration of
each sample was determined by the BCA protein assay kit (Pierce).
D-Gluconate, 2KDG, 5KDG, 2KLG, 25DKG, and IA in the
reaction mixtures were determined by high-pressure liquid
chromatography (HPLC) with an HPX-87C column (Bio-Rad) at 30°C at a
flow rate of 0.5 ml of 0.008 N H2SO4 per min as
the eluent.
Cloning of the yiaE gene.
The design of the
primers (2KRA-5' [5'ACGGGTGGTCACGACCTGAACAT3'] as the
forward primer and 2KRA-3' [5'ATGAACGGTTCGCTGGGTGTGCT3'] as the reverse primer [see Fig. 2]) for PCR was based on the
published yiaE nucleotide sequence (GenBank accession no.
AE000432) (6). PCR was carried out in a GeneAmp PCR system
2400 (Perkin-Elmer) with 30 cycles of denaturation for 30 s at
95°C, annealing for 30 s at 65°C, and extension for 2 min at
72°C, followed by a 5-min extension period at 72°C. The PCR
products were cleaved with BclI, and the 1.5-kb DNA fragment
was ligated into pUC19 which had been digested with BamHI.
The resulting plasmid, designated pHD2, was sequenced to confirm that
the sequence of the insert was identical to that of the yiaE gene.
Disruption of the yiaE gene.
To construct the
yiaE disruption strain, plasmid pHD-Km, with kanamycin
resistance, was constructed. To introduce the 1.2-kb BamHI
fragment (Km, Tn903) of pUC4K (Pharmacia) in the middle of
the yiaE gene, a new BamHI site was generated by
PCR with oligonucleotides 5'TGCGCACGTGGATCCAGCGCCAT3'
and 5'CTTTGGCTTCAACATGCCCATCCTC3' (the nucleotide
positions correspond to nucleotides [nt] 838 to 860 and 861 to 885, respectively; the BamHI restriction site is underlined, and
the point-mutated position is shown in boldface type). PCR was carried
out with pHD2 as a template. The PCR product was ligated after
polynucleotide kinase treatment. The resulting plasmid, pHD-Bam, was
digested with BamHI and ligated with the 1.4-kb
BamHI fragment (Km) of pUC4K. An insertion mutation
generated in the plasmid-encoded yiaE gene was used to
generate a chromosomal mutation in E. coli. Plasmid pHD-Km,
linearized with ScaI, was used to transform JC7623
(recBC sbcBC) to Kmr by the procedure outlined
by Winans et al. (24). The Kmr-carrying fragment
integrated into the chromosome was transferred by P1-mediated
transduction (17) to strain W3110. Transductants were
screened for Kmr colonies, and the
yiaE::Km disruption in the chromosome was
confirmed by PCR with primers 2KRA-5' and 2KRA-3' (see Fig. 4B).
Purification of C-terminal His6-tagged 2KR.
For
purification of 2KR in E. coli, a plasmid which adds a
six-histidine tag onto the C terminus of the yiaE gene
product was constructed. 2KRA-5', the primer for cloning, was used as a
forward primer. The reverse PCR primer,
5'GGGgaattcAGTGATGGTGATGGTGATGGTCCGCGACGTGCGGATTCACAC3', contained an EcoRI restriction site (lowercase), a
complementary C-terminal nucleotide sequence of yiaE
(underlined), and an additional sequence encoding His6
(boldface type, including the sequence tcA, which is complementary to
the stop codon). PCR was carried out under the same conditions as used
for cloning. The PCR product was cleaved with BclI and
EcoRI, and the 1.4-kb DNA fragment was ligated into pUC19
which had been digested with BamHI and EcoRI. The
resulting plasmid, designated pUCHisC, was verified to contain the
published yiaE nucleotide sequences.
The His6-tagged fusion protein was purified from
recombinant E. coli cells by using Ni-nitrilotriacetic acid
(NTA) resin (QIAGEN). Centrifugations were carried out at 4°C, and
column chromatographies were carried out at room temperature. For 2KR
purification, the cell pellet from a 500-ml culture of E. coli DH5
(pUCHisC) was suspended in a solution of 20 ml of 50 mM
Na-phosphate (pH 8.0) and 0.3 M NaCl and sonicated on ice. The
resulting cell lysate was centrifuged at 16,000 × g
and was passed directly over a column containing 1.6 ml of Ni-NTA resin
(QIAGEN). After the column was washed with a solution of 30 ml of 50 mM
Na-phosphate (pH 8.0), 0.3 M NaCl, and 10% glycerol, the C-terminal
His6-tagged 2KR was eluted with 4 ml of 50 mM Na-citrate
buffer (pH 6.0). Sodium dodecyl sulfate (SDS)-polyacrylamide slab gel
electrophoresis was done by Laemmli's method (14).
NH2-terminal amino acid sequence of 2KR.
Purified protein on SDS-polyacrylamide gels was electroblotted onto a
polyvinylidene difluoride (PVDF) transfer membrane (Millipore) for
1 h at 100 V in a Bio-Rad Trans-Blot apparatus. The PVDF membrane was stained with 0.1% Coomassie blue R-250 in 50% (vol/vol) methanol for 30 s and then destained for 3 min with 10% (vol/vol) acetic acid in 50% methanol. The NH2-terminal amino acid sequence
of the 2KR, immobilized on a PVDF membrane, was determined with an Applied Biosystems model 470A sequencer.
 |
RESULTS AND DISCUSSION |
Bioconversion of D-gluconate to 2KDG by recombinant
E. coli harboring the GADH gene and 2KDG reduction
activity.
Since the ketogluconate metabolism in E. coli
is not known, we considered the possibility of using E. coli
as an efficient host strain for bioconversion processing of
D-gluconate to 2KDG with the cloned GADH gene
(26). Unexpectedly, as shown in Fig. 1, the produced 2KDG in the medium
decreased slightly after 18 h of cultivation. This time point
coincided with the point at which D-gluconate was depleted
in the medium, which indicated that 2KDG could be used as a carbon
source. In Erwinia sp., 2KDG can be converted to
D-gluconate by NAD(P)H-dependent reduction, and
D-gluconate is phosphorylated to 6-phosphogluconate and
further metabolized through the pentose phosphate pathway
(23). Therefore, we checked the 2KDG reduction activity of
E. coli cell extracts. As a result, NADPH-dependent
reductase activity catalyzing the conversion of 2KDG to
D-gluconate was detected in the extracts of E. coli cells. The activity also catalyzed the reduction of 25DKG to
5KDG and 2KLG to IA. Therefore, we expected the existence of 2KR in
E. coli.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Time course of bioconversion of D-gluconate
to 2KDG by E. coli harboring the cloned GADH gene. E. coli W3110(pGA313) was grown in a 2-liter fermentor at 37°C with
aeration at 1 vvm and agitation at 500 rpm.
|
|
Characterization of the putative 2-hydroxyacid dehydrogenase gene
(yiaE) of E. coli.
Because the E. coli Genome Sequencing Project has been completed (6,
19), we tried to find putative hydroxyacid reductases or
dehydrogenases among unidentified proteins encoded by E. coli genes to find the gene encoding an enzyme catalyzing the
conversion of 2KDG to D-gluconate. As a result, a putative
2-hydroxyacid dehydrogenase gene (yiaE) (6, 19),
showing homology with phosphoglycerate dehydrogenase and
hydroxypyruvate reductase, was found in the bisC-cspA
intergenic region, or at 80 min on the E. coli chromosome.
To characterize the protein encoded by yiaE, the gene was
amplified by PCR with chromosomal DNA from E. coli W3110 as
the template. Cell extracts of recombinant E. coli harboring
pHD2 showed 2KDG reductase activity at about 10 times the level of
wild-type E. coli. This activity was also found to catalyze
the reduction of 25DKG to 5KDG and 2KLG to IA. As a result, the enzyme
encoded by yiaE was designated 2KR. The open reading frame
corresponding to yiaE might start with either the ATG at nt
355 to 357 or the ATG at nt 367 to 369 (Fig.
2). The ATG at nt 367 to 369 appears to
be a functional initiator because it is preceded by a possible
ribosome-binding sequence, GGAG (nt 357 to 360). The gene consists of
972 bp, encoding a polypeptide of 324 amino acids and a calculated
molecular weight of 35,399. In the GenBank/EMBL/DDBJ database, the
sequence has 328 amino acids, rather than the 324 amino acids that we
have determined. The deduced amino acid sequence of 2KR showed 69.4%
identity to that of 2KR (3) (the sequence has not been
deposited in the databases) from E. herbicola (Fig.
3). The amino acid sequence of a
Bacillus subtilis hypothetical protein (EMBL accession no. Z99121) similar to glycerate dehydrogenase showed a high level of
similarity (44.4%) to that of 2KR. Therefore, we are characterizing the protein of B. subtilis to examine the possibility that
it could also be a 2KR. Comparison of the predicted amino acid sequence of 2KR with those of other oxidoreductases, including glycerate dehydrogenase of Hyphomicrobium metylovorum (12),
D-3-phosphoglycerate dehydrogenase of Haemophilus
influenzae (10), formate dehydrogenase of Solanum
tuberosum (9), and D-lactate dehydrogenase
of E. coli (8), showed identities of 26.8, 25.0, 23.1, and 18.8%, respectively, for the entire amino acid sequences.
Other reductases related to ketogluconate metabolism, two 25DKG
reductases from Corynebacterium sp. (4, 11) and a
5KDG reductase from Gluconobacter oxydans (13),
did not show significant similarity to 2KR.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide sequence of the yiaE gene coding
for 2KR. The putative ribosome-binding site (SD), the putative 10 and
35 regions of the promoter site, and the 22 residues of 2KR
determined by NH2-terminal amino acid sequencing are
underlined. Facing arrows show an inverted repeat. Primers 2KRA-5' and
2KRA-3' were used for PCR.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
Sequence alignment of 2KRs from E. coli and
E. herbicola. Identical amino acids are indicated by
asterisks.
|
|
Purification and characterization of His6-tagged
2KR.
The His-tagged protein was purified by metal-chelate affinity
chromatography on a Ni-NTA column. Figure
4 shows SDS-polyacrylamide gel
electrophoresis (PAGE) of various fractions during purification of the
His-tagged E. coli 2KR. The elution volumes of the purified enzyme were compared with those of standard proteins following Sephacryl S-200 gel filtration, and this comparison showed that the
molecular weight of the protein was about 74,000 (data not shown).
Following SDS-PAGE, the protein yielded a single band when stained with
Coomassie blue (Fig. 4). The molecular weight was estimated to be
36,000, which coincided with the calculated molecular weight of the
protein deduced from the nucleotide sequence. These results indicate
that the native enzyme may exist as a dimer. The molecular weight and
subunit structure of 2KR from E. coli are similar to those
of 2KR from B. ketosoreductum (25). The NH2-terminal 22-amino-acid sequence was determined to
be
NH2-Met-Lys-Pro-Ser-Val-Ile-Leu-Tyr-Lys-Ala-Leu-Pro-Asp-Asp-Leu-Leu-Gln-Arg-Leu-Gln-Glu-His, which was identical to deduced amino acid residues 1 to 22 (Fig. 2).
This result shows that the ATG at nt 367 to 369, preceded by a possible
ribosome-binding sequence, GGAG (nt 357 to 360), rather than the ATG at
nt 355 to 357, is a functional initiator. The reductase was optimally
active at pH 7.5, with NADPH as a preferred electron donor. The 2KR in
this work was found to catalyze the reduction of 25DKG to 5KDG, 2KDG to
D-gluconate, and 2KLG to IA. The reductase was inactive
toward 5KDG, D-fructose, and L-sorbose in the
presence of NADPH or NADH. The substrate specificity of 2KR is similar
to those from E. herbicola (23) and B. ketosoreductum (25).

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 4.
SDS-12.5% PAGE monitoring purification of E. coli His6-tagged 2KR from E. coli
DH5 (pUCHisC), as described in Materials and Methods. Lane 1, molecular mass markers (Sigma); lane 2, whole-cell lysate; lane 3, fraction passed through column; lane 4, eluate from Ni-NTA column.
|
|
Disruption and complementation of the yiaE gene.
We disrupted the chromosomal yiaE gene by homologous
recombination to make a host strain in which 2KDG is not metabolized when the conversion of D-glucose or D-gluconate
to 2KDG by recombinant E. coli harboring the cloned GADH
gene (26) is attempted. For this purpose, we constructed
pHD-Km (Fig. 5A), containing a kanamycin resistance gene in the coding sequence of yiaE on pUC19.
Insertional disruption generated in the plasmid-encoded yiaE
was used to generated chromosomal disruption. The linearized pHD-Km was
used to transform E. coli JC7623. About 50 kanamycin-resistant colonies were isolated, and 5 colonies were picked.
Insertion of the kanamycin resistance gene into the yiaE
gene was confirmed by PCR with primers 2KRA-5' and 2KRA-3' (Fig. 5B).
The inserted DNA sequence was transferred to strain W3110 by
bacteriophage P1-mediated transduction. The functional disruption of
the yiaE chromosomal gene was confirmed by an in vitro
activity assay for 2KR, in vitro conversion of 2KDG to
D-gluconate, and PCR. Disruption of the gene on the
chromosome resulted in the loss of 2KR activity in strains JC7623
(yiaE::Km) and W3110
(yiaE::Km) (Table
1). Further confirmation of chromosomal disruption was evident based on complementation experiments. In order
to test for the ability of the yiaE gene to complement the 2KR-deficient phenotype of strain W3110
(yiaE::Km), plasmid pHD2 was introduced into the
mutant. Plasmid pHD2 restored 2KR activity (Table 1).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Disruption of the chromosomal yiaE gene of
E. coli. (A) Structure of pHD-Km. A BamHI site
was generated in the middle of the yiaE gene, and a 1.4-kb
BamHI fragment containing the kanamycin resistance gene was
inserted at the BamHI site of pHD-Bam. The resulting
plasmid, pHD-Km, was linearized with ScaI before P1
transduction. (B) Confirmation of correct disruption of the
yiaE gene by PCR. PCR with primers 2KRA-5' and 2KRA-3' (Fig.
2) was done with chromosomal DNAs from E. coli W3110 and its
mutant strain as templates. Lane 1, 1-kb ladder; lane 2, PCR product
with W3110 genomic DNA as a template; lane 3, PCR product with W3110
(yiaE::Km) genomic DNA as a template; lane 4, BamHI-digested PCR product with W3110
(yiaE::Km) genomic DNA; lane 5, pUC4K digested
with BamHI.
|
|
Growth of E. coli on 2KDG.
The metabolism related
to ketogluconate use has been characterized in acetic acid bacteria and
in Erwinia sp., which produce ketogluconates as incomplete
oxidation products of glucose via membrane-bound dehydrogenases
(2, 21). The metabolic pathways involved in the use of such
ketogluconates in Corynebacterium and Erwinia
spp. have been studied (20, 23). The pathways in the two
microorganisms are quite similar except that in Erwinia sp.,
25DKG is converted to 5KDG, but in Corynebacterium sp.,
25DKG is converted to 2KDG before being converted to gluconate. As
ketogluconates are used through the pentose phosphate pathway in acetic
acid bacteria, the ketogluconate reductases have been presumed to
function in regenerating NADP+ rather than in providing
carbon (1, 15). The ketogluconate metabolism in E. coli has been unknown, and it has been reported that no strain of
E. coli utilizes 2KDG as the sole carbon source (7). However, in our experiment, E. coli W3110
grew on M9 medium containing 2KDG as the sole carbon source while the
mutant W3110 (yiaE::Km), deficient in 2KR
activity, was unable to grow on 2KDG (Table 1). This result indicated
that 2KDG enters into central metabolism only after it is reduced to
D-gluconate by 2KR. Thus, 2KR is responsible for the
catabolism of 2KDG in E. coli and the diminishment of 2KDG
produced from D-gluconate in the cultivation of E. coli harboring a cloned gluconate dehydrogenase gene. The generation time of E. coli W3110 on minimal medium
containing 2KDG was about 27.8 h, compared to a generation time of
about 1.3 h on glucose (Fig. 6). In
the mutant W3110 (yiaE::Km) harboring plasmid
pHD2, the growth rate was about six times higher than in W3110.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Growth of E. coli on 2KDG and
D-glucose. E. coli W3110 (circles), W3110
(yiaE::Km) (squares), and W3110
(yiaE::Km) harboring pHD2 (triangles) were grown
on M9 minimal medium containing 2KDG (solid symbols) or
D-glucose (open symbols).
|
|
To check whether the reductase is inducible by ketogluconate, the
specific 2KR activities in
E. coli W3110 cells were assayed
after cultivation in media containing ketogluconate (Table
2).
2KR activities were found in cells
cultivated both in LB and in
LB containing carbohydrate, and there was
no significant induction
of 2KR by carbohydrate except that higher
activity in the presence
of
D-glucose or
D-gluconate was found. This result suggests that
the
yiaE gene is expressed constitutively in
E. coli.
The existence of 2KR in
E. coli suggests strongly that the
other ketogluconate reductases, 5KDG reductase or 25DKG reductase,
and
the related ketogluconate metabolism may also exist. Further
studies on
the identification of other ketogluconate reductases
and their
physiological roles in
E. coli are in
progress.
 |
ACKNOWLEDGMENT |
This investigation was supported by grant HS1810 from the
Ministry of Science and Technology of Korea (MOST).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Bioprocess
Engineering Division, Korea Research Institute of Bioscience and
Biotechnology (KRIBB), P.O. Box 115, Yusong, Taejon 305-600, Korea.
Phone: 82-42-860-4483. Fax: 82-42-860-4594. E-mail:
jgpan{at}kribb4680.kribb.re.kr.
 |
REFERENCES |
| 1.
|
Ameyama, M., and O. Adachi.
1982.
2-Keto-D-gluconate reductase from acetic acid bacteria.
Methods Enzymol.
89:203-209.
|
| 2.
|
Ameyama, M.,
K. Matsushita,
E. Shinagawa, and O. Adachi.
1987.
Sugar-oxidizing respiratory chain of Gluconobacter suboxydans. Evidence for a branched respiratory chain and characterization of respiratory chain-linked cytochromes.
Agric. Biol. Chem.
51:2943-2950.
|
| 3.
| Anderson, S., R. A. Lazarus, H. I. Miller,
and R. K. Stafford. July 1991. U.S. patent 5,032,514.
|
| 4.
|
Anderson, S.,
C. B. Marks,
R. Lazarus,
J. Miller,
K. Stafford,
J. Seymour,
D. Light,
W. Rastetter, and D. Estell.
1985.
Production of 2-keto-L-gulonate, an intermediate in L-ascorbate synthesis, by a genetically modified Erwinia herbicola.
Science
230:144-149[Abstract/Free Full Text].
|
| 5.
|
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523[Abstract/Free Full Text].
|
| 6.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1462[Abstract/Free Full Text].
|
| 7.
|
Buissiere, J.,
G. Brault, and L. Le Minor.
1981.
Utilization and fermentation of 2-ketogluconate by Enterobacteriaceae.
Ann. Microbiol. (Paris)
132:191-195[Medline].
|
| 8.
|
Bunch, P. K.,
F. Mat-Jan,
N. Lee, and D. P. Clark.
1997.
The ldhA gene encoding the fermentative lactate dehydrogenase of Escherichia coli.
Microbiology
143:187-195[Abstract/Free Full Text].
|
| 9.
|
Colas des Francs-Small, C.,
F. Ambard-Bretteville,
I. D. Small, and R. Remy.
1993.
Identification of a major soluble protein in mitochondria from nonphotosynthetic tissues as NAD-dependent formate dehydrogenase.
Plant Physiol.
102:1171-1177[Abstract].
|
| 10.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J. F. Tomb,
B. A. Dougherty,
J. M. Merrick, et al.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512[Abstract/Free Full Text].
|
| 11.
|
Grindley, J. F.,
M. A. Payton,
H. van de Pol, and K. G. Hardy.
1988.
Conversion of glucose to 2-keto-L-gulonate, an intermediate in L-ascorbate synthesis, by a recombinant strain of Erwinia citreus.
Appl. Environ. Microbiol.
54:1770-1775[Abstract/Free Full Text].
|
| 12.
|
Izumi, Y.,
T. Yoshida,
H. Kanzaki,
S. Toki,
S. S. Miyazaki, and H. Yamada.
1990.
Purification and characterization of hydroxypyruvate reductase from a serine-producing methylotroph, Hyphomicrobium methylovorum GM2.
Eur. J. Biochem.
190:279-284[Medline].
|
| 13.
|
Klasen, R.,
S. Bringer-Meyer, and H. Sahm.
1995.
Biochemical characterization and sequence analysis of the gluconate:NADP 5-oxidoreductase gene from Gluconobacter oxydans.
J. Bacteriol.
177:2637-2643[Abstract/Free Full Text].
|
| 14.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 15.
|
Levering, P. R.,
G. Weenk,
W. Olijve,
L. Dijkhuizen, and W. Harder.
1988.
Regulation of gluconate and ketogluconate production in Gluconobacter oxydans ATCC 621-H.
Arch. Microbiol.
149:534-539.
|
| 16.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 17.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 18.
|
Miller, J. V.,
D. A. Estell, and R. A. Lazarus.
1987.
Purification and characterization of 2,5-diketo-D-gluconate reductase from Corynebacterium sp.
J. Biol. Chem.
262:9016-9020[Abstract/Free Full Text].
|
| 19.
|
Sofia, H. J.,
V. Burland,
D. L. Daniels,
G. Plunkett III, and F. R. Blattner.
1994.
Analysis of the Escherichia coli genome. V. DNA sequence of the region from 76.0 to 81.5 minutes.
Nucleic Acids Res.
22:2576-2586[Abstract/Free Full Text].
|
| 20.
|
Sonoyama, T.,
B. Kageyama,
S. Yagi, and K. Mitsushima.
1987.
Biochemical aspects of 2-keto-L-gulonate accumulation from 2,5-diketo-D-gluconate by Corynebacterium sp. and its mutants.
Agric. Biol. Chem.
51:3039-3047.
|
| 21.
|
Sonoyama, T.,
B. Kageyama,
S. Yagi, and K. Mitsushima.
1988.
Facultatively anaerobic bacteria showing high productivities of 2,5-diketo-D-gluconate from D-glucose.
Agric. Biol. Chem.
52:667-674.
|
| 22.
|
Tabata, S.,
A. Higashitani,
M. Takanami,
K. Akiyama,
Y. Kohara,
Y. Nishimura,
A. Nishimura,
S. Yasuda, and Y. Hirota.
1989.
Construction of an ordered cosmid collection of the Escherichia coli K-12 W3110 chromosome.
J. Bacteriol.
171:1214-1218[Abstract/Free Full Text].
|
| 23.
|
Truesdell, S. J.,
J. C. Sims,
P. A. Boerman,
J. L. Seymour, and R. A. Lazarus.
1991.
Pathways for metabolism of ketoaldonic acids in an Erwinia sp.
J. Bacteriol.
173:6651-6656[Abstract/Free Full Text].
|
| 24.
|
Winans, S. C.,
S. J. Elledge,
J. H. Krueger, and G. C. Walker.
1985.
Site-directed insertion and deletion mutagenesis with cloned fragments in Escherichia coli.
J. Bacteriol.
161:1219-1221[Abstract/Free Full Text].
|
| 25.
|
Yum, D.-Y.,
S.-S. Bae, and J.-G. Pan.
1998.
Purification and characterization of the 2-ketoaldonate reductase from Brevibacterium ketosoreductum ATCC 21914.
Biosci. Biotechnol. Biochem.
62:154-156[Medline].
|
| 26.
|
Yum, D.-Y.,
Y.-P. Lee, and J.-G. Pan.
1997.
Cloning and expression of a gene cluster encoding three subunits of membrane-bound gluconate dehydrogenase from Erwinia cypripedii ATCC 29267 in Escherichia coli.
J. Bacteriol.
179:6566-6572[Abstract/Free Full Text].
|
Journal of Bacteriology, November 1998, p. 5984-5988, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Eschenfeldt, W. H., Stols, L., Rosenbaum, H., Khambatta, Z. S., Quaite-Randall, E., Wu, S., Kilgore, D. C., Trent, J. D., Donnelly, M. I.
(2001). DNA from Uncultured Organisms as a Source of 2,5-Diketo-D-Gluconic Acid Reductases. Appl. Environ. Microbiol.
67: 4206-4214
[Abstract]
[Full Text]
-
Pujol, C. J., Kado, C. I.
(2000). Genetic and Biochemical Characterization of the Pathway in Pantoea citrea Leading to Pink Disease of Pineapple. J. Bacteriol.
182: 2230-2237
[Abstract]
[Full Text]
-
Yum, D.-Y., Lee, B.-Y., Pan, J.-G.
(1999). Identification of the yqhE and yafB Genes Encoding Two 2,5-Diketo-D-Gluconate Reductases in Escherichia coli. Appl. Environ. Microbiol.
65: 3341-3346
[Abstract]
[Full Text]