Previous Article | Next Article ![]()
Journal of Bacteriology, November 1998, p. 6023-6030, Vol. 180, No. 22
Department of Biology and Center for
Molecular Genetics, University of California, San Diego, La Jolla,
California 92093-0322,1 and
Institut
fuer Biotechnologie, Technische Universitaet Graz, A-8010 Graz,
Austria2
Received 1 June 1998/Accepted 9 September 1998
The par region of the stably maintained
broad-host-range plasmid RK2 is organized as two divergent operons,
parCBA and parDE, and a cis-acting
site. parDE encodes a postsegregational killing system, and
parCBA encodes a resolvase (ParA), a nuclease (ParB), and a
protein of unknown function (ParC). The present study was undertaken to
further delineate the role of the parCBA region in the
stable maintenance of RK2 by first introducing precise deletions in the
three genes and then assessing the abilities of the different
constructs to stabilize RK2 in three strains of Escherichia
coli and two strains of Pseudomonas aeruginosa. The
intact parCBA operon was effective in stabilizing a
conjugation-defective RK2 derivative in E. coli MC1061K and
RR1 but was relatively ineffective in E. coli MV10 Plasmids use a variety of mechanisms
to maintain themselves within bacterial populations. Plasmid-encoded
systems for stable maintenance include copy number control, active
partitioning systems, multimer resolution, and postsegregational
killing (18). RK2, identical to RP4, is a 60-kb
broad-host-range plasmid that exists in Escherichia coli at
five to eight copies/chromosome (40). It is a member of the
IncP The parCBA operon comprises a 2.3-kb region and encodes
three proteins, ParA, ParB, and ParC. The ParA protein, along with its
res site, located between promoters
PparCBA and PparDE, functions as a site-specific recombination system homologous to the
Tn3 family of resolvases (13). parB
encodes a nuclease with homology to a Staphylococcus
nuclease (9, 17a). The function of ParC has yet to be
determined. The role of these three proteins in stabilizing RK2, other
than multimer resolution by ParA, is not known. It has been proposed
that these three proteins together make up or contribute to an active
partitioning complex (15, 17a, 33, 37, 38).
Recently, it was shown that the parCBA region is capable of
stabilizing both minireplicons of RK2 and the intact RK2 plasmid in
E. coli and several other gram-negative bacteria (12c,
37). These studies involved the use of an RK2 plasmid with
deletions of the par operons (37) and reinsertion
of the intact parCBA and parDE operons together
or separately into the intact RK2 plasmid with par deletions
(12c). It was found that the parCBA region could
stabilize RK2 but that the level of stability provided was dependent on
the strain and the growth conditions under which the assays were
carried out. In order to further characterize the parCBA
operon and its role in the stabilization of RK2, precise deletions
which maintained the translational coupling arrays were made in each of
the three structural genes, and the resulting deletion derivatives were
cloned into RK2 with par deletions. The stability of these
various constructs in three strains of E. coli and two
strains of Pseudomonas aeruginosa was then determined. Furthermore, the ability of two multimer resolution systems,
cer of the ColE1 plasmid and loxP/Cre of the P1
plasmid, to replace the parCBA operon for plasmid
stabilization was assessed. It is clear from the results obtained that
parA, along with its res site, can in some
circumstances provide a significant level of plasmid stabilization in
the absence of parB and parC in both E. coli and P. aeruginosa. In addition, the
loxP/Cre multimer resolution system provides a substantial
level of stability in the absence of the parCBA operon in
all three E. coli strains. It is not clear from the results
whether these different resolution systems act solely to increase the
number of plasmid monomer units for segregation or whether they play a
role in a more complex process of stabilization of plasmid RK2 during
cell growth and division.
Materials.
Restriction endonucleases, the Klenow fragment of
E. coli DNA polymerase, T4 DNA ligase, linkers, and shrimp
alkaline phosphatase were obtained from commercial suppliers and used
as recommended by the manufacturers. Antibiotics were obtained from
Sigma Chemical Co. (St. Louis, Mo.).
Strains and media.
The bacteria used and their sources are
listed in Table 1. E. coli
strains were grown in Luria-Bertani (LB) medium (29) (GIBCO
BRL Scientific, Grand Island, N.Y., or Sigma). Antibiotics used for
plasmid selection with E. coli were added to final
concentrations of 250 µg/ml for penicillin, 50 µg/ml for kanamycin,
50 µg/ml for spectinomycin, 25 µg/ml for chloramphenicol, 10 µg/ml for tetracycline, 15 µg/ml for gentamicin, and 10 µg/ml for
nalidixic acid. P. aeruginosa strains were grown in nutrient
broth (NB) (Difco Laboratories, Detroit, Mich.). Antibiotics used for
plasmid selection with P. aeruginosa were added to final
concentrations of 500 µg/ml for spectinomycin, 100 µg/ml for
carbenicillin, and 75 µg/ml for rifampin.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Role of the parCBA Operon of the
Broad-Host-Range Plasmid RK2 in Stable Plasmid Maintenance

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
lac.
In the two strains in which the parCBA operon was
effective, deletions in parB, parC, or both
parB and parC caused an approximately twofold
reduction in the stabilizing ability of the operon, while a deletion in
the parA gene resulted in a much greater loss of
parCBA activity. For P. aeruginosa
PAO1161Rifr, the parCBA operon provided little
if any plasmid stability, but for P. aeruginosa
PAC452Rifr, the RK2 plasmid was stabilized to a substantial
extent by parCBA. With this latter strain, parA
and res alone were sufficient for stabilization. The
cer resolvase system of plasmid ColE1 and the loxP/Cre system of plasmid P1 were tested in comparison
with the parCBA operon. We found that, not unlike what was
previously observed with MC1061K, cer failed to stabilize
the RK2 plasmid with par deletions in strain MV10
lac,
but this multimer resolution system was effective in stabilizing the
plasmid in strain RR1. The loxP/Cre system, on the other
hand, was very effective in stabilizing the plasmid in all three
E. coli strains. These observations indicate that the
parA gene, along with its res site, exhibits a
significant level of plasmid stabilization in the absence of the
parC and parB genes but that in at least one
E. coli strain, all three genes are required for maximum
stabilization. It cannot be determined from these results whether or
not the stabilization effects seen with parCBA or the
cer and loxP/Cre systems are strictly due to a
reduction in the level of RK2 dimers and an increase in the number of
plasmid monomer units or if these systems play a role in a more complex
process of plasmid stabilization that requires as an essential step the
resolution of plasmid dimers.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
family of plasmids and can be stably maintained in a wide range
of gram-negative bacteria (12, 33, 37, 38, 40). A stability
region of RK2 designated par is comprised of five genes in
two divergently oriented autoregulated operons, parCBA and
parDE (15, 33, 38). The coding frames in each of
the two operons are translationally coupled. parDE encodes a
postsegregational killing system and comprises a 0.7-kb region. The
ParD protein acts as an antitoxin to neutralize the toxic effects of
the ParE protein (22). This system has a function similar to
that of the postsegregational killing systems of plasmids F
(ccd), R1 (kis/kid), R100 (pemI/pemK),
and P1 (phd/doc) in ensuring that plasmid-free cells that
may arise after cell division do not survive (7, 14, 20, 21, 24,
25, 28).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids
Plasmid constructions. All DNA manipulations, such as restriction enzyme digestion, filling in of 5' overhangs with the Klenow fragment, shrimp alkaline phosphatase treatment, DNA ligation, agarose gel electrophoresis, and transformation of E. coli, have been described elsewhere (27). Plasmid DNA was isolated by either the boiling lysis (19) or the alkaline lysis (27) procedure. Construction of the pCE61 and pCE61-2.3 plasmids has been described elsewhere (12c). Several deletion constructs in which different Par proteins were truncated while retaining translational coupling were constructed. A derivative of pCE61 carrying the parCBA operon with deletions in both parC and parB was constructed as follows. An SphI-BamHI fragment carrying the parA gene was isolated from plasmid pGMA7 (15) and ligated to pUC18 digested with SphI and BamHI, resulting in plasmid pUCGMA7. The BamHI fragment from pGMA41 (15) containing the promoter PparCBA and the parD gene was isolated and ligated to BamHI-digested pUCGMA7. The resulting plasmid, containing the BamHI fragment from pGMA41 in the correct orientation, was designated pCESH201. In order to delete the parD gene, pCESH201 was digested with AflIII and filled in, and then HindIII linkers were added. The resulting plasmid, pCE91, was digested with HindIII, and the HindIII fragment carrying parA plus the deletions in parB and parC (bp 1023 to 1701) (15) was ligated to HindIII-digested pCE61. The resulting plasmid was designated pCE61-91.
Construction of a plasmid carrying parCBA with a deletion in the parB gene (bp 1018 to 1380) (15) was carried out by first isolating a BamHI-SphI fragment containing parA and part of the parB gene from pGMA45 (15) and ligating that fragment to pUC18 digested with BamHI and SphI to produce plasmid pUCGMA45. pUCGMA45 was digested with BamHI and ligated with the BamHI fragment from pGMA45 (15) which contained the parC and parD genes. The orientation of the BamHI fragment was checked by clonal analysis, and the clone with the correct orientation was designated pCESH202. pCESH202 was digested with AflII, filled in, and linked to HindIII to remove parD. The resulting plasmid, designated pCE92, was used for the cloning of pCE61-92. pCE61-92 was produced by insertion of the HindIII fragment from pCE92 carrying the parCBA region with a deletion in parB into HindIII-digested pCE61. Construction of the parC deletion derivative (bp 1549 to 1701) (15) was carried out in the following manner. First, a plasmid carrying a truncated parC was constructed by insertion of a SalI-RsaI fragment from pGMA30 (15) containing portions of parB and parC into SalI-EcoRV-digested pBSkII (cloning vector from Stratagene). The resulting plasmid, pBS-Sal/Rsa, was digested with EcoRI, and the unique site was filled in to produce plasmid pBS-Sal/RsaE*. Plasmid pUCGMA16 was constructed by insertion of an SphI-BamHI fragment from pGMA16 (15) containing the parCBA operon into pUC18 digested with SphI and BamHI. The SalI-BamHI fragment from pBS-Sal/RsaE* was ligated with SalI-BamHI-digested pUCGMA16. The resulting plasmid was designated pUCGMA16R. The BamHI fragment from pGMA41 was isolated and ligated to BamHI-digested pUCGMA16R. The resulting plasmid, pCESH204, was digested with AflII, filled in, and linked with HindIII to remove parD and to add a HindIII site. The resulting HindIII-linked plasmid was designated pCE94 and was used for the subsequent insertion of the parCBA operon with a parC deletion into the intact RK2 plasmid pCE61. The HindIII fragment from pCE94 was isolated and inserted into HindIII-digested pCE61. The resulting plasmid was named pCE61-94. In order to construct a parCBA operon with deletions of segments of the parA gene (bp 692 to 940) (15), several intermediate plasmids were constructed. An SphI-BamHI fragment from plasmid pGMA49 (15) carrying parB and a portion of parA was isolated and inserted into pUC18 digested with SphI and BamHI. The resulting plasmid was designated pUCGMA49. Plasmid pGEM5-parB* was used for the next step. To construct pGEM5-parB,* pGEM5-parB, which carries the parB gene (36a), was digested with SacII and AvaI, and oligonucleotides containing a BamHI site and SacII and AvaI ends (GGATCCCGACTTCACCAGGTTGCAGGTCGGCGGGATCGCGC) (GCGATCCCGCCGACCTGCAACCTGGTGAAGTCGGGATCCGGCC) were inserted into the compatible ends. The resulting plasmid, pGEM5-parB*, was digested with BamHI and SacI and inserted into the BamHI-SacI sites of pUCGMA49 to produce plasmid pUCGMA49A
. A
SalI-EcoRI fragment from plasmid pGMA27SB (this
work), which is a pUC18 derivative carrying the parB,
parC, and parD genes on the
SalI-BamHI fragment from pGMA27 (15),
was isolated and inserted into
SalI-EcoRI-digested
pUCGMA49A
. We designated the resulting plasmid
pCESH205. pCESH205 was digested with AflIII, filled in, and
linked with HindIII to remove parD and to add
a HindIII site (pCE95). The HindIII
fragment carrying the par region with the deletion in
parA was isolated and inserted into pCE61 digested with
HindIII. The resulting construct was designated
pCE61-95. The pCESH series of pUC18 derivatives was checked for the
integrity of the downstream genes by an in vitro assay for ParB
nuclease activity (17a). The integrity of the deletion
derivatives of the RK2 plasmid was examined by an in vivo assay for
ParA resolvase activity (33).
Plasmid pEKA28 (36c) is a tetracycline-resistant derivative
of plasmid pMHL3 (a derivative of plasmid RSF1010) and was constructed by inserting the tetracycline resistance gene into the unique HindIII site of pMHL3. pEKA30 (5) is a
derivative of pEKA28 which contains the cre gene of P1
inserted into the unique EcoRI site of pEKA28. pEKA28 and
pEKA30 were kindly provided by E. Sia and D. Figurski.
Gentamicin-resistant plasmids were constructed by insertion of the
gentamicin resistance gene carried on a HindIII fragment
from plasmid pUC19-G/S (41). Plasmid pUC19-G/S is a derivative of pUC19 which contains the gentamicin resistance gene (36) cloned into the multiple cloning region of pUC19.
Plasmids pEKA28G and pEKA30G, gentamicin-resistant derivatives of
plasmids pEKA28 and pEKA30, respectively (5), were
constructed by digestion with HindIII and insertion of
the gentamicin resistance gene carried on a HindIII
fragment from pUC19-G/S.
Conjugal plasmid transfer.
Plasmid pCE61 and its derivatives
were established in P. aeruginosa PAC452Rifr and
PAO1161Rifr by conjugal mating with E. coli
DH5
carrying both the specific pCE61 derivative and pVW8703 (pUC8-Cm
derivative and source of the TraG protein) (42). pCE61 and
its derivatives carry a mutation in traG and are therefore
unable to transfer unless TraG is provided in trans.
Exconjugants were selected with NB agar containing rifampin, spectinomycin, and carbenicillin.
Plasmid stabilization assays. Stabilization assays were previously described (34). Overnight liquid cultures of E. coli or P. aeruginosa containing the various RK2 derivatives were grown under antibiotic selection at 30 or 37°C. A portion of each culture was diluted 104- to 106-fold in prewarmed LB broth for E. coli or NB for P. aeruginosa and grown under antibiotic selection to the mid-log phase at 30 or 37°C. The remaining portion of each overnight culture was used to isolate plasmid DNA to confirm the presence and integrity of the particular plasmid. At time zero, cells were diluted into antibiotic-free LB broth or NB and maintained without selection for 50 to 200 generations of log-phase growth. Portions of the cell cultures were plated onto antibiotic-free LB agar for E. coli strains or antibiotic-free NB agar for P. aeruginosa strains and then replica picked onto LB or NB agar with and without the appropriate antibiotic(s) to determine the percentage of cells maintaining the plasmid. The percent plasmid loss per generation was calculated as described previously (12c).
Luciferase assay.
E. coli MV10 (the
tetracycline-sensitive parent of MV10
lac) and RR1 carrying the
various RK2 plasmids were transformed with plasmids pAL4000 and pTD10
(12, 16). Strains were grown to the mid-log phase at 30°C,
and luciferase assays were carried out with a luciferase assay system
from Promega (product no. E1500) and following manufacturer
recommendations. Activity was measured with a Monolight 2001 luminometer (Analytical Luminescence Laboratories, San Diego, Calif.).
Analysis of plasmids carrying the loxP/Cre system of
P1.
The ability of the P1 multimer resolution system
loxP/Cre to stabilize pCE61 and its derivatives was tested
as follows. Plasmid pCE61 contains the loxP site of P1
(5, 37). pCE61 was established in E. coli RR1
along with the RSF1010 plasmids pEKA28 (vector) and pEKA30 (vector with
Cre protein expressed from its native promoter). pEKA28G and pEKA30G
(constructed as described above) were established in E. coli
MV10
lac and MC1061K along with pCE61. E. coli MV10
lac
and MC1061K containing plasmids pCE61-2.3 and pCE61-91, carrying the
parCBA and parA genes, respectively, along with
either pEKA28 or pEKA28G were also constructed. Stability assays were
carried out as described above with LB medium at 30°C, except that
selection was maintained on the pEKA28 and pEKA30 plasmids or their
gentamicin-resistant derivatives. The stability of the pCE61 plasmid
and its derivatives in the presence of the pEKA28 and pEKA30 plasmids
or their gentamicin-resistant derivatives was assessed by replica
plating onto LB agar plates containing spectinomycin and calculating
the percentage of cells retaining the various pCE61 plasmids.
| |
RESULTS |
|---|
|
|
|---|
Effects of deletions within the three structural genes of the
parCBA operon on RK2 maintenance in three E. coli strains.
Previous studies that used the intact RK2
plasmid examined the contributions to stability of the intact
par region and the parCBA and parDE
operons separately (12c, 37). These earlier studies showed
that the intact par region provided a high level of
stability to RK2 under all growth conditions and in all strains tested.
The abilities of the two individual par operons to stabilize RK2 were dependent on the strain and growth conditions. To determine the requirement of each of the three genes within the parCBA
operon for the stabilization of RK2 maintenance by this operon,
deletion derivatives of the parCBA operon were constructed
and inserted into plasmid pCE61 (Fig. 1).
Since the three genes in the parCBA operon are
translationally coupled (15), the deletions were constructed
in a manner that maintained the translational reading frame of each
gene containing a deletion. Plasmid pCE61 itself is a derivative of RK2
with a deletion of the entire par region and containing
defective traG, so that it is incapable of conjugal transfer. The stability of pCE61 with the various inserts was tested in
three E. coli strains, MC1061K, RR1, and MV10
lac.
Previously, it was shown that the intact parCBA operon by
itself was very effective in stabilizing pCE61 in MC1061K but
relatively ineffective in MV10
lac. When various deletion derivatives
of the parCBA operon were tested in MC1061K, there was a
substantial reduction of stabilization as a result of a deletion in
parC or parB and a total loss of stabilization
with a parA deletion (Table
2). For E. coli RR1, the
intact parCBA operon by itself, as in the case of MC1061K, provided a high level of stable maintenance of plasmid pCE61. In this
strain, however, a deletion within the parC or
parB gene had relatively little effect on the stabilization
activity of the parCBA operon (Table 2). However, deletions
in both the parB and the parC genes significantly
reduced the effectiveness of the parCBA operon. Finally, the
stability of pCE61 carrying intact parCBA and deletion
derivatives of parCBA was tested with E. coli MV10
lac. As shown before (37), the parCBA
operon was found to be relatively ineffective in stabilizing pCE61 in
this E. coli strain. A deletion in parC,
parB, or both had no effect on the low level of
stabilization seen with the parCBA operon, and a deletion in
parA resulted in a complete loss of parCBA
stabilization activity. Thus, in two strains in which the
parCBA operon was effective, MC1061K and RR1, deletions in
parB, parC, or both somewhat reduced
(approximately twofold) the stabilization activity of the operon, while
a deletion in parA resulted in a much greater loss of
stabilization activity.
|
|
Contributions of the parCBA region to stability in two strains of P. aeruginosa. Since RK2 is a broad-host-range plasmid with the ability to be stably maintained in a wide range of gram-negative bacteria, we decided to test the effect of deletions in both the parB and the parC genes on parCBA activity in two strains of P. aeruginosa, PAC452Rifr and PAO1161Rifr. pCE61 and its derivatives were established in each strain, and the stability of the plasmid was assessed over 75 to 100 generations. For strain PAC452Rifr, the parCBA operon or a parC parB parA+ deletion derivative provided a significant level of stabilization (Fig. 2A). After 100 generations, greater than 75% of the cells retained the plasmid carrying parC+ parB+ parA+ (pCE61-2.3) or parC parB parA+ (pCE61-91). For strain PAO1161Rifr, neither parCBA nor parC parB parA+ was able to provide a substantial level of stabilization (Fig. 2B). Less than 25% of the cells contained the plasmid after approximately 75 generations of growth. It is of interest that in both of these strains, the intact par region (parCBA and parDE) functioned very well in stabilizing the pCE61 plasmid in that greater than 95% of the cells retained the plasmid after 100 generations of growth (data not shown).
|
Assessing ParA levels in vivo for the various deletion
constructs.
Various constructs that contained a deletion in either
parB or parC or both were designed to minimize
the effects of the deletions on the downstream expression of ParA
levels. This fact is of importance to ensure that any effect of a
deletion in the upstream parC and parB genes is
not the result of a change in the amount of ParA provided by the
translationally coupled operon. To test the activity and relative
amounts of ParA produced by the various deletion derivatives, we used a
luciferase assay. Plasmid pTD10 is an RSF1010 derivative that carries
the luciferase gene fused to the parCBA promoter (12,
16). It has been shown that the amount of luciferase activity
expressed from the promoter of this fusion construct is a function of
the level in vivo of the ParA protein. The ParA protein represses the
activity of this promoter by binding to the operator region
(12). pTD10 was established in E. coli MV10 and
RR1 along with various pCE61 plasmid derivatives (E. coli MV10
lac is tetracycline resistant; therefore, its
tetracycline-sensitive parent, MV10, was used). As shown in Table
3, the level of ParA produced by the
intact parCBA operon substantially reduced the level of
expression of luciferase in both E. coli RR1 and MV10 (compare pCE61 and pCE61-2.3). Constructs having a deletion in parC (pCE61-94), parB (pCE61-92), or both
parB and parC (pCE61-91) similarly resulted in a
substantial reduction of luciferase expression by plasmid pTD10,
indicating that these deletion constructs produced levels of ParA
comparable to that produced by the intact parCBA construct.
Not surprisingly, the construct with a deletion in parA
failed to repress luciferase expression. Based upon the results obtained with these two E. coli strains, it appears that the
functional parC and parB genes are directly
responsible for the loss of the stabilization activity of the
parCBA operon for plasmid RK2 in strain RR1, as deletions in
the upstream genes do not result in a reduction of ParA levels.
|
Stability of the plasmid RK2 in a topA E. coli strain. Previous studies with minireplicons of the pSC101, F, and P1 plasmids with deletions of a stabilization region revealed increased levels of plasmid stability when the plasmids were carried in an E. coli topA mutant (4, 6, 10, 11). It has been proposed that the increased negative superhelicity of plasmid DNA as a result of a deficiency in the type I topoisomerase (TopA) enzyme in a topA mutant results in improved distribution of the plasmid to daughter cells during cell division (4, 6, 10, 11). It was previously demonstrated that ParA binds to the res site at three distinguishable positions (13). To assess whether or not the increased stabilization of RK2 by the parCBA operon, including its res site, in E. coli is due to a superhelical change in the DNA as a result of binding of the ParA protein and/or the ParB and ParC proteins to the plasmid, the effect of a topA mutation on RK2 stabilization was tested. The par deletion plasmid pCE61 was established in the E. coli topA strain DPB636 and the isogenic topA+ parent DPB635, and the rates of plasmid loss were compared. There was no increase in the stability of the pCE61 plasmid in strain DPB636 (0.32% loss per generation in pDB635 versus 0.46% loss in DB636). Since, unlike the case with pSC101, F, and P1, the presumed increase in the negative superhelicity of RK2 in the topA mutant did not increase the stability of the plasmid, it is unlikely that the stabilization seen with parA and its res site is due to a change in RK2 superhelicity as a result of binding of the ParA protein and/or the other Par proteins.
Resolvase activity contributes to RK2 stabilization.
The
resolvase activity of ParA suggests that the stabilization of RK2
observed when ParA and its res site are inserted into pCE61
is due to the resolution of dimers and/or higher-multimer forms of the
plasmid. It was previously observed that the cer multimer
resolution system, when inserted into pCE61, did not increase the
stability of the plasmid in E. coli MC1061K
(12c). To explore further the role of resolvase activity in
plasmid stabilization, we took advantage of the fact that plasmid pCE61
was constructed with a vector excision system which necessitated
replacing the par region with a spectinomycin resistance
gene cassette and the loxP site of prophage P1
(5). Thus, by supplying the Cre recombinase protein in
trans from a compatible plasmid, it was possible to determine if multimer resolution via this system was able to stabilize pCE61. pCE61 was established in E. coli RR1, MC1061K, and
MV10
lac along with plasmid pEKA30G, which is a derivative of the
compatible plasmid RSF1010 containing the cre gene. In
addition, pCE61 and the RSF1010 vector without the cre gene
were established in all three strains as a control. In all three
strains, the rate of loss of pCE61 was higher than previously observed
for this plasmid in the absence of the RSF1010 vector (Tables 1 and
4). This finding may have been due to a
low level of incompatibility between the two plasmids. Nevertheless, it
is clear that the loxP/Cre system provided a high level of
stability for pCE61 in all three E. coli strains (Table 4).
Because of this surprising result with the loxP/Cre system
and in view of the earlier observation that the cer system
did not stabilize pCE61 in MC1061K, the effect of inserting the
cer system into RK2 was reinvestigated with MC1061K and
examined with E. coli MV10
lac and RR1. As shown in Table 4, the cer system once again failed to stabilize pCE61 in
MC1061K; however, this multimer resolution system was effective in
stabilizing the plasmid in RR1. As in the case of MC1061K, insertion of
the cer site into RK2 did not improve its stability in
MV10
lac. That the cer system was capable of resolving
multimers in all three strains was shown in an earlier study
(12c).
|
| |
DISCUSSION |
|---|
|
|
|---|
The par region of plasmid RK2, consisting of two divergently oriented operons, parCBA and parDE, clearly plays a major role in the stabilization of this broad-host-range plasmid in a growing population of bacteria. While the mechanism of stabilization by parDE is well documented, the role of the parCBA operon in stabilizing this plasmid is still not fully understood. In addition, although the stabilization seen with the complete par region can be accounted for largely by the summation of the activities of the parCBA and parDE operons acting individually, we cannot rule out the possibility that the two operons act synergistically in providing virtually complete stabilization when the par region is intact.
In an attempt to obtain some insight into the mechanism by which parCBA stabilizes RK2, a series of precise deletions were constructed to specifically remove each of the three genes in the operon. Since the three genes are translationally coupled, care was exercised to maintain the reading frames in each of the various deletions. Results from the stability assays were somewhat equivocal with respect to the necessity of the parB and parC genes. In the two E. coli strains in which the parCBA operon is effective in stabilizing RK2, MC1061K and RR1, the inactivation of parB, parC, or both parB and parC caused an approximately twofold reduction in the activity of the operon. However, a deletion in the parA gene caused a much greater loss of parCBA activity. In P. aeruginosa strains, in which parCBA shows a high level of stabilization activity, the inactivation of parB and parC did not diminish the activity observed. These results indicate a key role for the ParA- and res site-specific recombination system in the stabilization activity that is observed for the parCBA operon. However, when the level of ParA produced by the deletion constructs was approximated in two of the E. coli strains by determining the level of repression of the par promoter by ParA, it appeared that the reduced stabilization activity seen when parB, parC, or both genes were inactivated was not due to an effect of the deletions on ParA production.
These various observations do not, of course, provide any insight into the role of parB and parC in the stabilization seen for the intact parCBA operon in E. coli strains. If the stabilization activity of the parCBA operon is due solely to site-specific recombination, ParB and ParC may be accessory proteins that enhance the activity of ParA acting on its res site in resolving dimers and/or higher-multimer forms. The biochemical product of ParA acting on res sites in a dimeric plasmid is a catenate of two monomers (1-3). Additional enzymatic steps are required to separate the monomers. ParB, a calcium-dependent nuclease (17a), and ParC conceivably could play a role in resolving these catenates. Furthermore, differences in the requirements for parB and parC for full activity of the parCBA operon in different hosts may reflect differences in the abilities of different strains to compensate for the loss of parB and/or parC by providing host proteins with comparable activities. Alternatively, ParB and ParC could play an adaptive role in directing the parA-res system to an appropriate site in the bacterium where the multimer resolution system can facilitate segregation of the plasmid to daughter cells. The translational coupling of the three genes in the parCBA operon argues, albeit weakly, for the formation of a specific complex by the three proteins. If this were the case, then, of course, other proteins and even other multimer resolution systems might supplant the components of the parCBA system in a host-dependent manner in facilitating partitioning of the plasmid during cell division.
The high level of effectiveness of the loxP/Cre system in stabilizing plasmid RK2 was surprising in view of the failure in earlier studies of the cer multimer resolution system to stabilize the plasmid in one E. coli strain tested (12c) . In addition, a significant level of RK2 dimers was not observed in the E. coli strains used in this study despite an effort to detect higher forms of RK2 with a procedure which involves direct lysis in agarose gels and which detects high-molecular-weight forms of supercoiled DNA (unpublished observations). Similar results have been reported for pBR322 derivatives containing intact or deletion RP4 par fragments (38). It has been argued, however, that even very low amounts of the dimeric form of a plasmid under certain circumstances can substantially increase the rate of loss of the plasmid (39). It is also worth pointing out that the plasmid RK2 derivative, pCE61, used in this study carries a functional Tn1 transposon that includes an active resolvase system (8, 12b, 17, 30). Grinter et al. (17) showed that deletion of the Tn1 transposon in RK2 had little effect on the stability of the plasmid in comparison with deletion of the par region. The Tn1 system obviously cannot compensate for the loss of the parA-res system in providing for stabilization of the RK2 plasmid. Again, this idea may not be surprising, since even the highly effective ColE1 plasmid cer system was found, unlike the loxP/Cre multimer resolution system, to be active in only one of three E. coli strains in substituting for the loss of the parCBA operon. This finding suggests that the actual level of resolvase activity in a particular strain, the nucleotide sequence context, or perhaps the topological position of the multimer resolution site within the supercoiled plasmid DNA influences the effectiveness of the system in functioning as a resolvase system for stabilizing the plasmid. Studies involving the dif locus of the E. coli chromosome, the site of multimer resolution of the chromosome within the terminus region, demonstrated a position requirement for the functionality of this sequence (26). In addition, the Dif phenotype of an E. coli strain caused by deletion of the dif locus could be suppressed only by replacement with a functional multimer resolution site such as psi (pSC101) or loxP (and Cre) in the same terminus region and not at another site on the chromosome (26). Finally, it is worth emphasizing that studies on the effectiveness of the various multimer resolution systems and the contribution of the parB and parC genes to the effectiveness of the parCBA operon in stabilizing the broad-host-range plasmid RK2 have been limited to relatively few bacterial hosts. A more substantial role for all three genes in stabilizing the RK2 plasmid may be revealed by extension of the analysis to a more diverse set of bacteria.
A much larger question is whether or not the juxtapositioning of the
parCBA and parDE operons in the RK2 plasmid is
fortuitous or whether it reflects an interaction between the five
proteins and their DNA in providing virtually complete stabilization of the plasmid in a wide range of bacterial hosts. One study carried out
with whole RK2 and E. coli MV10
lac failed to show
enhancement of parCBA stabilization activity on RK2 when the
parDE products were provided in trans from a
compatible plasmid (unpublished observations). Again, it will be of
interest to extend the analysis to other bacteria to determine if the
two operons act synergistically. Finally, all five proteins from these
two operons have been purified (13, 17a, 21a, 22, 35) and
are now available for determining if the proteins from the two operons
interact with each other at the biochemical level. These additional
approaches should provide some clarification of whether or not the
parCBA products or multimer resolution systems such as
cer and loxP/Cre stabilize RK2 only by increasing
monomer units (or decreasing the number of potentially destabilizing
dimeric forms of the plasmid) or if these systems play a role in a
complex plasmid stabilization mechanism that requires as one essential
step the resolution of dimeric forms of the plasmid. The view of a more
complex function of the RK2 par region is supported by the
recent finding that the resolution of dimer chromosomes at the
dif locus of E. coli is coupled to cell division
(38a). In this hypothetical stabilization system, parDE may work in concert with the parCBA
products in providing for the stable maintenance of RK2 in a wide range
of bacterial hosts.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant AI-07194 from the National Institutes of Health and by a minority predoctoral fellowship (5 F31 GM 17230-02) from the National Institute of General Medical Sciences to C.L.E. H.S. was supported by a Fulbright fellowship during the course of this study.
We thank Eva Garrett for providing technical assistance and Regina Neves for assistance in the preparation of the manuscript. We also thank Aresa Toukdarian and Rick Roberts for helpful suggestions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology and Center for Molecular Genetics, University of California, San Diego, La Jolla, CA 92093-0322. Phone: (619) 534-3638. Fax: (619) 534-0559. E-mail: helinski{at}biomail.ucsd.edu.
Present address: Department of Molecular Microbiology, School of
Medicine, Washington University, St. Louis, MO 63110-1093.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Abremski, K., and R. Hoess.
1984.
Bacteriophage P1 site-specific recombination. Purification and properties of the Cre recombinase protein.
J. Biol. Chem.
259:1509-1514 |
| 2. | Adams, D. E., J. B. Bliska, and N. R. Cozzarelli. 1992. Cre-lox recombination in Escherichia coli cells. Mechanistic differences from the in vitro reaction. J. Mol. Biol. 226:661-673[Medline]. |
| 3. | Adams, E. A., E. M. Shekhtman, E. L. Zechiedrich, M. B. Schmid, and N. R. Cozzarelli. 1992. The role of topoisomerase IV in partitioning bacterial replicons and the structure of catenated intermediates in DNA replication. Cell 71:277-288[Medline]. |
| 4. | Austin, S. J., M. Ziese, and N. Sternberg. 1981. A novel role for site-specific recombination in maintenance of bacterial replicons. Cell 25:729-736[Medline]. |
| 5. | Ayres, E. K., V. J. Thompson, G. Merino, D. Balders, and D. H. Figurski. 1993. Precise deletions in large bacterial genomes by vector-mediated excision (VEX). The trfA gene of promiscuous plasmid RK2 is essential for replication in several gram-negative hosts. J. Mol. Biol. 230:174-185[Medline]. |
| 5a. | Bagdasarian, M. Unpublished data. |
| 6. |
Biek, D. P., and S. N. Cohen.
1989.
Involvement of integration host factor (IHF) in maintenance of plasmid pSC101 replication in Escherichia coli: mutations in the topA gene allow pSC101 replication in the absence of IHF.
J. Bacteriol.
171:2066-2074 |
| 7. | Bravo, A., O. Sagrario, G. deTorrontegoi, and R. Diaz-Orejas. 1988. Killing of Escherichia coli cells modulated by components of the stability system of ParD of plasmid R1. Mol. Gen. Genet. 215:146-151[Medline]. |
| 8. |
Chen, S. T., and R. C. Clowes.
1987.
Variations between the nucleotide sequences of Tn1, Tn2, and Tn3 and expression of -lactamase in Pseudomonas aeruginosa and Escherichia coli.
J. Bacteriol.
169:913-916 |
| 9. | Close, S. M., and C. I. Kado. 1992. A gene near the plasmid pSa origin of replication encodes a nuclease. Mol. Microbiol. 6:521-527[Medline]. |
| 10. |
Conley, D., and S. N. Cohen.
1995.
Isolation and characterization of plasmid mutations that enable partitioning of pSC101 replicons lacking the partition (par) locus.
J. Bacteriol.
177:1086-1089 |
| 11. |
Conley, D. L., and S. N. Cohen.
1995.
Effects of the pSC101 partition (par) locus on in vivo DNA supercoiling near the plasmid replication origin.
Nucleic Acids Res.
23:701-707 |
| 12. | Davis, T. L., D. R. Helinski, and R. C. Roberts. 1992. Transcription and autoregulation of the stabilizing functions of broad-host-range plasmid RK2 in Escherichia coli, Agrobacterium tumefaciens, and Pseudomonas aeruginosa. Mol. Microbiol. 6:1981-1994[Medline]. |
| 12a. | Easter, C. 1997. Ph.D. thesis. University of California, San Diego. |
| 12b. | Easter, C. Unpublished observations. |
| 12c. |
Easter, C. L.,
P. A. Sobecky, and D. R. Helinski.
1997.
Contribution of different segments of the par region to stable maintenance of the broad-host-range plasmid RK2.
J. Bacteriol.
179:6472-6479 |
| 13. | Eberl, L., C. S. Kristensen, M. Givskov, E. Grohmann, M. Gerlitz, and H. Schwab. 1994. Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4. Mol. Microbiol. 12:131-141[Medline]. |
| 14. | Gerdes, K., L. K. Poulson, T. Thisted, A. K. Nielsen, J. Martinussen, and P. H. Andreasen. 1990. The hok killer gene family in Gram-negative bacteria. New Biol. 2:946-956[Medline]. |
| 15. |
Gerlitz, M.,
O. Hrabak, and H. Schwab.
1990.
Partitioning of broad-host-range plasmid RP4 is a complex system involving site-specific recombination.
J. Bacteriol.
172:6194-6203 |
| 16. | Greener, A., S. M. Lehman, and D. R. Helinski. 1992. Promoters of the broad host range plasmid RK2: analysis of transcription (initiation) in five species of Gram-negative bacteria. Genetics 130:27-36[Abstract]. |
| 17. | Grinter, N. J., G. Brewster, and P. T. Barth. 1989. Two mechanisms necessary for the stable inheritance of plasmid RP4. Plasmid 22:203-214[Medline]. |
| 17a. |
Grohmann, E.,
T. Stanzer, and H. Schwab.
1997.
The parB protein encoded by the RP4 par region is a Ca2+-dependent nuclease linearizing circular DNA substrates.
Microbiology
143:3889-3898 |
| 18. | Helinski, D. R., A. E. Toukdarian, and R. P. Novick. 1996. Replication control and other stable maintenance mechanisms of plasmids, p. 2295-2324. In F. C. Niedhardt, et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C. |
| 19. | Holmes, D. S., and M. Quigley. 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114:193-197[Medline]. |
| 20. |
Jaffe, A.,
T. Ogura, and S. Hiraga.
1985.
Effects of the ccd function of the F plasmid on bacterial growth.
J. Bacteriol.
163:841-849 |
| 21. | Jensen, R. B., E. Grohmann, H. Schwab, R. Diaz-Orejas, and K. Gerdes. 1995. Comparison of ccd of F, parDE of RP4, and parD of R1 using novel conditional replication control system of plasmid R1. Mol. Microbiol. 17:211-221[Medline]. |
| 21a. | Johnson, E. Unpublished data. |
| 22. |
Johnson, E. P.,
A. Strom, and D. R. Helinski.
1996.
Plasmid RK2 toxin protein ParE: purification and interaction with the ParD protein.
J. Bacteriol.
178:1420-1429 |
| 23. | Kahn, M., D. Ow, R. Sauer, A. Rabinowitz, and R. Calendar. 1980. Genetic analysis of bacteriophage P4 using P4-plasmid ColE1 hybrids. Mol. Gen. Genet. 177:399-412[Medline]. |
| 24. | Lehnerr, H., E. Maguin, S. Jafri, and M. B. Yarmolinsky. 1993. Plasmid addiction genes of bacteriophage P1: doc, which causes cell death on curing of prophage, and phd, which prevents host death when prophage is retained. J. Mol. Biol. 233:414-423[Medline]. |
| 25. |
Lehnerr, L., and M. Yarmolinsky.
1995.
Addiction protein Phd of plasmid prophage P1 is substrate of the ClpXP serine protease of Escherichia coli.
Proc. Natl. Acad. Sci. USA
92:3274-3277 |
| 26. | Leslie, N. R., and D. J. Sheratt. 1995. Site-specific recombination in the replication terminus region of Escherichia coli: functional replacement of dif. EMBO J. 14:1561-1570[Medline]. |
| 27. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 28. | Miki, T., J. A. Park, K. Nagao, N. Murayama, and T. Horiuchi. 1992. Control of segregation of chromosomal DNA by sex factor F in Escherichia coli. Mutants of DNA gyrase subunit A suppress letD(ccdB) product growth inhibition. J. Mol. Biol. 225:39-52[Medline]. |
| 29. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 30. | Pansegrau, W., E. Lanka, P. T. Barth, D. H. Figurski, D. G. Guiney, D. Haas, D. R. Helinski, H. Schwab, V. A. Stanisich, and C. M. Thomas. 1994. Complete nucleotide sequence of Birmingham IncPalpha plasmids. J. Mol. Biol. 239:623-663[Medline]. |
| 31. |
Prince, A. S., and T. Barlam.
1985.
Isolation of a DNA fragment containing replication functions from IncP2 megaplasmid pMG2.
J. Bacteriol.
161:792-794 |
| 32. | Raleigh, E. A., K. Lech, and R. Brent. 1989. In F. M. Ausubel, et al. (ed.), Current protocols in molecular biology, p. 1190-1219. Greene Publishing Associates and Wiley Interscience, New York, N.Y. |
| 33. |
Roberts, R. C.,
R. Burioni, and D. R. Helinski.
1990.
Genetic characterization of the stability functions of a region of broad-host-range plasmid RK2.
J. Bacteriol.
172:6204-6216 |
| 34. |
Roberts, R. C., and D. R. Helinski.
1992.
Definition of a minimal plasmid stabilization system from the broad-host-range plasmid RK2.
J. Bacteriol.
174:8119-8132 |
| 35. | Roberts, R. C., A. R. Strom, and D. R. Helinski. 1994. The parDE operon of the broad-host-range plasmid RK2 specifies growth inhibition associated with plasmid loss. J. Mol. Biol. 237:35-51[Medline]. |
| 36. | Rubin, R. A. 1987. Genetic analysis of the gentamicin resistance region of pPH1JI incorporation into a wide host range cloning vehicle. Plasmid 18:84-88[Medline]. |
| 36a. | Schwab, H. Unpublished data. |
| 36b. | Sia, E. Unpublished data. |
| 36c. | Sia, E., and D. Figurski. Unpublished data. |
| 37. |
Sia, E. A.,
R. C. Roberts,
C. E. Easter,
D. R. Helinski, and D. H. Figurski.
1995.
Different relative importances of the par operons and the effect of conjugal transfer on the maintenance of intact promiscuous plasmid RK2.
J. Bacteriol.
177:2789-2797 |
| 38. |
Sobecky, P. A.,
C. L. Easter,
P. D. Bear, and D. R. Helinski.
1996.
Characterization of the stable maintenance properties of the par region of broad-host-range plasmid RK2.
J. Bacteriol.
178:2086-2093 |
| 38a. | Steiner, W. W., and P. L. Kuempel. 1998. Cell division is required for resolution of dimer chromosomes at the dif locus of Escherichia coli. Mol. Microbiol. 27:257-268[Medline]. |
| 39. | Summers, D. K., C. W. H. Beton, and H. L. Withers. 1993. Multicopy plasmid instability: the dimer catastrophe hypothesis. Mol. Microbiol. 8:1031-1038[Medline]. |
| 40. | Thomas, C. M. 1988. Recent studies on control of plasmid replication. Biochim. Biophys. Acta 949:253-263[Medline]. |
| 41. | Toukdarian, A. Unpublished data. |
| 42. | Waters, G. Unpublished data. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»