Previous Article | Next Article 
Journal of Bacteriology, November 1998, p. 6043-6047, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Transport of Intact Porphyrin by HpuAB, the
Hemoglobin-Haptoglobin Utilization System of Neisseria
meningitidis
L. A.
Lewis,*
M.-H.
Sung,
M.
Gipson,
K.
Hartman, and
D. W.
Dyer
Department of Microbiology and Immunology,
University of Oklahoma Health Sciences Center, Oklahoma City,
Oklahoma 73103
Received 26 May 1998/Accepted 9 September 1998
 |
ABSTRACT |
The meningococcal hemA gene was cloned and used to
construct a porphyrin biosynthesis mutant. An analysis of the
hemA mutant indicated that meningococci can transport
intact porphyrin from heme (Hm), hemoglobin (Hb), and Hb-haptoglobin
(Hp). By constructing a HemA
HpuAB
double
mutant, we demonstrated that HpuAB is required for the transport of
porphyrin from Hb and Hb-Hp.
 |
TEXT |
The acquisition of Fe is a
well-defined determinant of bacterial pathogenesis. In response to Fe
starvation, the exclusively human pathogen Neisseria
meningitidis produces ligand-specific Fe transport proteins
involved in the acquisition of Fe from the host Fe binding compounds
transferrin, lactoferrin, heme (Hm), hemoglobin (Hb), and Hb complexed
to the serum glycoprotein haptoglobin (Hb-Hp) (13, 15-18, 21, 22,
24-26). Meningococcal iron-acquisition processes, with the
exception of Hm transport (2, 31), are functionally
dependent on the TonB protein for transmitting energy from the
cytoplasmic membrane to the outer membrane. Both single and
two-component TonB-dependent transport systems for neisseriae have been
described. The single-component systems each consist of a
TonB-dependent outer membrane transporter and are analogous to the
well-characterized siderophore receptors in many gram-negative bacteria
(14, 23). The two-component systems consist of a TonB-dependent outer membrane receptor and an accessory lipoprotein. The meningococcal transferrin utilization system, which has been described in detail in a recent review, is a typical two-component transport system (7).
Two distinct systems involved in the acquisition of Fe from Hb by
N. meningitidis have been described. We previously
described HpuAB, a two-component receptor composed of a
lipoprotein, HpuA, and a TonB-dependent transport
protein, HpuB (16, 17). The HpuAB receptor mediates
binding to Hb, Hb-Hp, and apo-Hp and is involved in the acquisition
of Fe from both Hb and Hb-Hp. The HpuAB transporter is not involved in
the acquisition of Fe from Hm. Stojiljkovic et al. described HmbR, a
single-component TonB-dependent outer membrane receptor involved in
both the binding to and Fe acquisition from Hb (29). HmbR is
not involved in the acquisition of Fe from Hb-Hp or Hm. Some
meningococcal strains appear to express either HpuAB or HmbR, while
other strains express both HpuAB and HmbR (30).
N. meningitidis DNM2, the strain used in this study, expresses HpuAB but not HmbR (16, 17).
How is Fe acquired from Hm-containing compounds such as Hb and Hb-Hp?
Two possibilities are readily apparent. Either Hm (protoporphyrin IX
plus Fe) is removed from Hb and Hb-Hp and transported into the cell or
Fe is removed from Hb and Hb-Hp at the cell surface and Fe is
transported into the cell. Removal and transport of intact Hm from Hb
have been documented for several organisms such as Haemophilus
influenzae and Yersinia enterocolitica (8, 27, 28). The N. meningitidis hmbR locus was cloned by
complementation of an Escherichia coli porphyrin synthesis
mutant suggesting that, in E. coli, HmbR transports Hm from
Hb to supply both Fe and porphyrin to the cell (29).
Conversely, Desai et al. detected the transport of 59Fe
from [59Fe]Hm into gonococci but did not detect the
transport of 14C from [14C]Hm
(10). This suggests that Neisseria gonorrhoeae
removes Fe from the Hm ring and transports only Fe into the periplasm (10), and by inference suggests that the related pathogen
N. meningitidis may also extract Fe from Hm prior to
transport. The goal of this study was first to determine if
meningococci transport protoporphyrin IX and Fe or only transport Fe
from Hm, Hb, and Hb-Hp. Second, we wished to determine the role of
HpuAB in the transport of porphyrin from Hb and Hb-Hp. We constructed a
porphyrin biosynthesis mutant of N. meningitidis DNM2 and
determined that Hm, Hb, and Hb-Hp could supply porphyrin to support
growth. Furthermore, our studies demonstrate that the HpuAB
receptor complex is responsible for porphyrin transport from Hb
and Hb-Hp.
Construction of a porphyrin biosynthesis (hemA)
mutant.
To determine if N. meningitidis DNM2
(HpuAB+ HmbR
) was able to transport
porphyrin, we sought to construct a hemA (glutamyl tRNA
reductase gene) mutant which would not be able to synthesize
-aminolevulinic acid (ALA), a required precursor for
tetrapyrrole synthesis (1). HemA mutants of E. coli are dependent on exogenous ALA to support growth
(1).
A putative neisserial hemA gene was identified in the
Gonococcal Genome Sequence database (http://www.genome.ou.edu)
by using the tblastn algorithm and the E. coli HemA
sequence (accession no., M30785) as a query (12). The
hemA gene was amplified from both N. meningitidis DNM2 and N. gonorrhoeae FA1090
by PCR (30 cycles of denaturation at 94°C, annealing at 58°C, and
extension at 72°C with the PCR Core Kit from Boehringer Mannheim)
with primers designed to the putative gonococcal hemA
(primer hemA449, CGGTCTATATCCATCTTCACC; primer hemA1717,
CGGCGCACCGTTATTTGTCCA). A 1.3-kb DNA fragment was amplified
from chromosomal DNA isolated from each of these organisms, and the
amplified DNA was cloned into pCR-TOPO (Invitrogen, Carlsbad, Calif.)
to create pDMHS2 (meningococcal hemA) and pDMHS1 (gonococcal hemA) (Table 1).
The DNA sequence of each gene was determined by primer walking with an
Applied Biosystems model 377XL automated DNA sequencer as previously
described (6). At least two independent clones were
sequenced in each case to ensure that PCR-induced mutations were not
present. The meningococcal and gonococcal hemA clones
contained open reading frames of 415 amino acids which were 98%
identical to each other and 64% similar (54% identical) to HemA of
Pseudomonas aeruginosa.
To confirm that the cloned gene was the meningococcal
hemA
locus, we constructed a knockout mutation of the putative
hemA gene in
N. meningitidis DNM2. The
aphA3 kanamycin resistance cassette
from pMGC20
(
20) was ligated into
HincII-digested pDMHS3
(Table
1). This resulted in the deletion of an internal 234-bp
HincII
fragment of
hemA and the insertion of the
1.8-kb
aphA3 cassette.
Kanamycin-resistant (40 µg/ml)
E. coli transformants were screened
by restriction enzyme
digestion and PCR amplification with primers
hemA449 and hemA1717. A
2.8-kb fragment, consistent with the deletion
of 234 bp of
hemA and the insertion of 1.8-kb of
aphA3 into
the
hemA locus, was amplified from pDMHS5 (Table
1),
indicating that
this plasmid contained
aphA3 properly
inserted in the
hemA gene
(data not shown). The mutated
hemA was amplified (as described
above) from pDMHS5
with primers which contained the neisserial
uptake sequence
(primer hemA449up, GCCGTCTGAACGGTCTATATCCATCTTCACC;
primer hemA1717up, GCCGTCTGAACGGCGCACCGTTATTTGTCCA).
One microgram
of the purified PCR product was used to transform
N. meningitidis DNM2 as previously described (
3).
Transformants were selected
on GC agar containing IsoVitaleX
(1%), ALA (30 µg/ml), and kanamycin
(100 µg/ml). Several
kanamycin-resistant transformants were isolated
and analyzed by PCR
with primers hemA449 and hemA1717. A 2.8-kb
DNA fragment was amplified
from a transformant designated DNM502.
As above, this result is
consistent with the proper insertion
of AphA3 in the
hemA
locus (data not shown). As expected, a 1.3-kb
fragment was amplified
from DNM2 (data not
shown).
To determine if the phenotype of strain DNM502 was consistent with that
produced by a
hemA mutation, we examined the dependence
of
DNM502 on ALA. DNM2 and DNM502 were inoculated onto GC agar
plates
supplemented with IsoVitaleX (1%) (Fig.
1A) and onto GC
agar plates supplemented
with ALA (30 µg/ml) and IsoVitaleX (Fig.
1B). While DNM2 grew in the
absence of exogenous ALA, DNM502 was
not able to grow in the absence of
exogenous ALA, consistent with
the predicted phenotype produced by the
putative
hemA mutation.

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 1.
ALA dependence of hemA mutants of N. meningitidis DNM2. Meningococci were inoculated onto GC agar
plates containing IsoVitaleX (A) or IsoVitaleX and ALA (B).
|
|
Transport of porphyrin by N. meningitidis DNM2.
In
E. coli, ALA is able to support the growth of a
hemA mutant because ALA is transported into the cell via the
dipeptide permease system (1). In laboratory strains of
E. coli, Hm and Hm compounds do not support the growth of a
hemA mutant because the enterobacterial outer membrane is
impermeable to Hm and laboratory strains of E. coli do not
possess specific transport systems for Hm or Hm compounds. In fact,
E. coli hemA mutants have been used as a tool to clone Hm
transport systems from several pathogenic microorganisms (9,
29).
To determine if DNM2 contains specific transport systems which allow
intact porphyrin to enter the cell, we examined the ability
of DNM502
to grow by using Hm, Hb, and Hb-Hp in place of ALA.
Hm, serum albumin
(SA), Hm-SA, Hb, Hb-SA, and Hb-Hp were prepared
as previously described
(
11,
16). SA forms a complex with
Hm, and the meningococcus
is not able to acquire Fe from an Hm-SA
complex (
11). SA was
added to Hb (Hb-SA) to ensure that free
Hm released from Hb was not
available to the meningococcus. Hm-SA
was used as a control to confirm
that Hm-SA was not able to support
growth. DNM2 and DNM502 were spread
onto CDM-0 agar plates (
4)
either directly or in GC top agar
(0.7% GC base agar; Difco).
Sterile 6-mm-diameter filter paper discs
(Whatman no. 3) were
saturated with 10 µl of Hm-containing compound
and applied to
the surfaces of the CDM-0 plates. Whatman discs
saturated with
ALA or buffer were used as positive and negative
controls, respectively.
DNM502 grew around discs containing
ALA (3 nmol) (Fig.
2), Hm
(5 nmol)
(data not shown), Hb + SA (1 nmol of Hb plus 15 nmol
of SA)
(Fig.
2), and Hb-Hp (0.5 nmol of Hb in an Hb-Hp complex)
(Fig.
2).
Growth was not observed around discs containing SA (20
nmol) or Hm-SA (5 nmol of Hm-20 nmol of SA) (data not
shown) or
around the negative-control disc (Fig.
2). The growth of
wild-type
DNM2 was not dependent on exogenous Hm or ALA, and thus DNM2
grew
to confluence on the CDM-0 agar plates and around all discs
(data
not shown). The ability of DNM502 to grow in the absence of
ALA
when supplied with Hm, Hb + SA, or Hb-Hp suggests that
DNM502
is able to transport intact porphyrin from each of these sources
to overcome the
hemA mutation.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
HpuAB-dependent transport of porphyrin from Hb and
Hb-Hp. Meningococci were inoculated onto CDM-0 agar plates. Sterile
Whatman discs saturated with 10 µl of ALA, 10 mM HEPES (Neg), Hb-SA,
or Hb-Hp were placed on the agar. Plates were incubated at 37°C and
5% CO2 for 24 h.
|
|
Transport of porphyrin by N. gonorrhoeae FA1090.
The observation that exogenous Hm can suppress the hemA
growth defect in DNM502 indicates that N. meningitidis can
transport intact porphyrin from Hm. This is in contrast to the
observation of Desai et al., who suggested that gonococci separate Hm
into Fe and porphyrin and only internalize the Fe from Hm. To
determine if meningococci and gonococci differ in their
abilities to transport porphyrin, we constructed a gonococcal
HemA mutant and assessed the ability of this mutant to transport
porphyrin from Hm. The mutated hemA gene from
pDMHS5 was transferred into piliated N. gonorrhoeae
FA1090 as described above, and transformants were selected on
GC base agar supplemented with IsoVitaleX (1%), ALA (30 µg/ml), and kanamycin (50 µg/ml). PCR analysis with
primers hemA449 and hemA1717, as described above, confirmed the
proper insertion of aphA3 in the hemA locus of
one kanamycin-resistant transformant, designated DNG7. The growth of
DNG7 was dependent on exogenous ALA, consistent with the expected
phenotype produced by a hemA mutation (Fig.
3). Surprisingly, DNG7 was able to grow in the absence of ALA, when Hm (8 nmol) was supplied as a source of
porphyrin (Fig. 3). The growth of wild-type FA1090 was not dependent on
exogenous ALA or Hm, and thus FA1090 grew to confluence on the CDM-0
agar plates and around all discs (data not shown). These studies
indicate that FA1090, like DNM2, is able to transport porphyrin from Hm
to overcome a hemA mutation.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Porphyrin transport by Neisseria gonorrhoeae
FA1090. DNG7 was inoculated onto a CDM-0 agar plate, and sterile
Whatman discs saturated with 10 µl of ALA, 10 mM HEPES (Neg), or Hm
were placed on the agar. Plates were incubated at 37°C and 5%
CO2 for 24 h.
|
|
Transport of intact porphyrin by HpuAB.
We have demonstrated
that DNM2 transports intact porphyrin from Hm, Hb, and Hb-Hp. The only
functional receptor for Hb and Hb-Hp expressed in strain DNM2 is HpuAB.
Thus, we suspected that HpuAB was involved in the acquisition of
porphyrin from Hb and Hb-Hp and constructed a double mutant that lacks
HemA and HpuAB to test this hypothesis. Genomic DNA isolated from
strain DNM502 was transformed into DNM2E4
(hpuB::mTn3erm)
(16). Transformants were selected as described above
(with ALA [30 µg/ml] and kanamycin [100 µg/ml]), and PCR with
primers hemA449 and hemA1717 was used to confirm the proper location of
the hemA mutation in the hpuB knockout strain,
DNM2E4; the double mutant was designated DNM504. DNM504, like DNM502,
was not able to grow in the absence of exogenous ALA (Fig. 1). Next, we
assessed the ability of DNM504 to grow in the absence of ALA with
Hm, Hm-SA, Hb, Hb + SA, and Hb-Hp as described above. Growth of
DNM504 was observed around Whatman filter discs containing ALA or Hm
(data not shown), indicating that expression of HpuAB is not required
for ALA or Hm transport. Growth was not observed around discs
containing SA, Hm-SA, Hb + SA, or Hb-Hp or around the
negative-control disc (Fig. 2). Thisindicates that the ability to
acquire porphyrin from Hb and Hb-Hp is dependent on the HpuAB transporter.
These studies demonstrate that the
N. meningitidis HpuAB
receptor complex transports intact porphyrin from Hb and Hb-Hp.
Furthermore,
our studies demonstrate that both
N. meningitidis DNM2 and
N. gonorrhoeae FA1090 can
transport intact porphyrin from Hm. This
finding directly contrasts
with the observations of Desai et al.,
who examined Hm uptake in
gonococcal strain F62 (
10). Desai
et al. failed to detect
porphyrin transport in strain F62 with
a [
14C]Hm
uptake assay (
10). It is not possible to determine whether
the [
14C]Hm uptake assay used was sensitive enough to
detect porphyrin
transport because a positive control consisting of an
organism
known to transport porphyrin was not included in their
experiments.
In the absence of this control it is not possible to
distinguish
between a failure to detect the transport of porphyrin
and a lack
of porphyrin transport. We have not studied a HemA mutant
of strain
F62, and it is possible that this difference is due to
strain
variation between strains FA1090 and F62. The Hm
transport system
has not been well defined in
Neisseria,
although the process has
been shown to be TonB independent (
2,
31). Gonococcal strain
F62 most likely expresses HpuAB, as this
strain is able to acquire
Fe from Hb-Hp (a phenotype uniquely
correlated with HpuAB expression
in pathogenic neisseriae) and probably
contains an intact
hpuAB locus (
5,
11). Thus, we
would expect strain F62 to transport
porphyrin from Hb and Hb-Hp. To
our knowledge, the present paper
is the first report of the transport
of intact porphyrin in the
neisseriae. Stojiljkovic et al. demonstrated
that the meningococcal
HmbR receptor could transport porphyrin in an
E. coli background;
however, the transport of porphyrin by
HmbR in
Neisseria has not
been demonstrated directly
(
29).
Nucleotide sequence accession numbers.
The DNA sequences
for the hemA genes of N. meningitidis DNM2 and
N. gonorrhoeae FA1090 were assigned GenBank
accession numbers AF067427 and AF067426, respectively.
 |
ACKNOWLEDGMENTS |
This work was supported by U.S. Public Health Service grant AI38399
from the National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 1053 BMSB,
Department of Microbiology and Immunology, University of Oklahoma
Health Sciences Center, Oklahoma City, OK 73104. Phone: (405) 271-1201. Fax: (405) 271-3117. E-mail: llewis{at}rex.uokhsc.edu.
 |
REFERENCES |
| 1.
|
Beale, S. I.
1996.
Biosynthesis of hemes, p. 731-748.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C.
|
| 2.
|
Biswas, G. D.,
J. E. Anderson, and P. F. Sparling.
1997.
Cloning and functional characterization of Neisseria gonorrhoeae tonB, exbB and exbD genes.
Mol Microbiol.
24:169-179[Medline].
|
| 3.
|
Biswas, G. D.,
T. Sox,
E. Blackman, and P. F. Sparling.
1977.
Factors affecting genetic transformation of Neisseria gonorrhoeae.
J. Bacteriol.
129:983-992[Abstract/Free Full Text].
|
| 4.
|
Blanton, K. J.,
G. D. Biswas,
J. Tsai,
J. Adams,
D. W. Dyer,
S. M. Davis,
G. G. Koch,
P. K. Sen, and P. F. Sparling.
1990.
Genetic evidence that Neisseria gonorrhoeae produces specific receptors for transferrin and lactoferrin.
J. Bacteriol.
172:5225-5235[Abstract/Free Full Text].
|
| 5.
| Chen, C., and P. F. Sparling. 1998. Personal
communication.
|
| 6.
|
Chissoe, S. L.,
Y. F. Wang,
S. W. Clifton,
N. Ma,
H. J. Sun,
J. S. Lobsinger,
S. M. Kenton,
J. D. White, and B. A. Roe.
1991.
Strategies for rapid and accurate DNA sequencing.
Methods Companion Methods Enzymol.
3:55-65.
|
| 7.
|
Cornelissen, C. N., and P. F. Sparling.
1994.
Iron piracy: acquisition of transferrin-bound iron by bacterial pathogens.
Mol. Microbiol.
14:843-850[Medline].
|
| 8.
|
Coulton, J. W., and J. C. S. Pang.
1983.
Transport of hemin by Haemophilus influenzae type b.
Curr. Microbiol.
9:93-98.
|
| 9.
|
Daskaleros, P. A.,
J. A. Stoebner, and S. M. Payne.
1991.
Iron uptake in Plesiomonas shigelloides: cloning of the genes for the heme-iron uptake system.
Infect. Immun.
59:2706-2711[Abstract/Free Full Text].
|
| 10.
|
Desai, P. J.,
R. C. Nzeribe, and C. A. Genco.
1995.
Binding and accumulation of hemin in Neisseria gonorrhoeae.
Infect. Immun.
63:4634-4641[Abstract].
|
| 11.
|
Dyer, D. W.,
E. P. West, and P. F. Sparling.
1987.
Effects of serum carrier proteins on the growth of pathogenic neisseriae with heme-bound iron.
Infect. Immun.
55:2171-2175[Abstract/Free Full Text].
|
| 12.
|
Gish, W., and D. J. States.
1993.
Identification of protein coding regions by database similarity search.
Nat. New Genet.
3:266-272.
|
| 13.
|
Irwin, S. W.,
N. Averil,
C. Y. Cheng, and A. B. Schryvers.
1993.
Preparation and analysis of isogenic mutants in the transferrin receptor protein genes, tbpA and tbpB, from Neisseria meningitidis.
Mol. Microbiol.
8:1125-1133[Medline].
|
| 14.
|
Klebba, P. E.,
J. M. Rutz,
J. Liu, and C. K. Murphy.
1993.
Mechanisms of TonB-catalyzed iron transport through the enteric bacterial cell envelope.
J. Bioenerg. Biomembr.
25:603-611[Medline].
|
| 15.
|
Legrain, M.,
V. Mazarin,
S. W. Irwin,
B. Bouchon,
M. J. Quentin-Millet,
E. Jacobs, and A. B. Schryvers.
1993.
Cloning and characterization of Neisseria meningitidis genes encoding the transferrin-binding proteins Tbp1 and Tbp2.
Gene
130:73-80[Medline].
|
| 16.
|
Lewis, L. A., and D. W. Dyer.
1995.
Identification of an iron-regulated outer membrane protein of Neisseria meningitidis involved in the utilization of hemoglobin complexed to haptoglobin.
J. Bacteriol.
177:1299-1306[Abstract/Free Full Text].
|
| 17.
|
Lewis, L. A.,
L. Gray,
Y. P. Wang,
B. A. Roe, and D. W. Dyer.
1997.
Molecular characterization of hpuAB, the hemoglobin-haptoglobin utilization operon of Neisseria meningitidis.
Mol. Microbiol.
23:737-749[Medline].
|
| 18.
|
Lewis, L. A.,
K. Rohde,
M. Gipson,
B. Behrens,
E. Gray,
S. I. Toth,
B. A. Roe, and D. W. Dyer.
1998.
Identification and molecular analysis of lbpBA, which encodes the two-component meningococcal lactoferrin receptor.
Infect. Immun.
66:3017-3023[Abstract/Free Full Text].
|
| 19.
|
Nachamkin, I.,
J. G. Cannon, and R. S. Mittler.
1981.
Monoclonal antibodies against Neisseria gonorrhoeae: production of antibodies directed against a strain-specific cell surface antigen.
Infect. Immun.
32:641-648[Abstract/Free Full Text].
|
| 20.
|
Nassif, X.,
D. Puaoi, and M. So.
1991.
Transposition of Tn1545- 3 in the pathogenic neisseriae: a genetic tool for mutagenesis.
J. Bacteriol.
173:2147-2154[Abstract/Free Full Text].
|
| 21.
|
Pettersson, A.,
V. Klarenbeek,
J. van Deurzen,
J. T. Poolman, and J. Tommassen.
1994.
Molecular characterization of the structural gene for the lactoferrin receptor of the meningococcal strain H44/76.
Microb. Pathog.
17:395-408[Medline].
|
| 22.
|
Pettersson, A.,
A. Maas, and J. Tommassen.
1994.
Identification of the iroA gene product of Neisseria meningitidis as a lactoferrin receptor.
J. Bacteriol.
176:1764-1766[Abstract/Free Full Text].
|
| 23.
|
Postle, K.
1990.
TonB and the Gram-negative dilemma.
Mol. Microbiol.
4:2019-2025[Medline].
|
| 24.
|
Quinn, M. L.,
S. J. Weyer,
L. A. Lewis,
D. W. Dyer, and P. M. Wagner.
1994.
Insertional inactivation of the gene for the meningococcal lactoferrin binding protein.
Microb. Pathog.
17:227-237[Medline].
|
| 25.
|
Schryvers, A. B., and L. J. Morris.
1988.
Identification and characterization of the human lactoferrin-binding protein from Neisseria meningitidis.
Infect. Immun.
56:1144-1149[Abstract/Free Full Text].
|
| 26.
|
Schryvers, A. B., and L. J. Morris.
1988.
Identification and characterization of the transferrin receptor of Neisseria meningitidis.
Mol. Microbiol.
2:281-288[Medline].
|
| 27.
|
Stojiljkovic, I., and K. Hantke.
1992.
Haemin uptake systems of Yersinia enterocolitica: similarities with other TonB-dependent systems in Gram-negative bacteria.
EMBO J.
11:4359-4367[Medline].
|
| 28.
|
Stojiljkovic, I., and K. Hantke.
1994.
Transport of haemin across the cytoplasmic membrane through a haemin-specific periplasmic binding protein-dependent transport system in Yersinia enterocolitica.
Mol. Microbiol.
13:719-732[Medline].
|
| 29.
|
Stojiljkovic, I.,
V. Hwa,
L. de S. Martin,
P. O'Gaora,
X. Nassif,
F. Heffron, and M. So.
1995.
The Neisseria meningitidis haemoglobin receptor: its role in iron utilization and virulence.
Mol. Microbiol.
15:531-541[Medline].
|
| 30.
|
Stojiljkovic, I.,
J. Larson,
V. Hwa,
S. Anic, and M. So.
1996.
HmbR outer membrane receptors of pathogenic Neisseria spp.: iron-regulated, hemoglobin-binding proteins with a high level of primary structure conservation.
J. Bacteriol.
178:4670-4678[Abstract/Free Full Text].
|
| 31.
|
Stojiljkovic, I., and N. Srinivasan.
1997.
Neisseria meningitidis tonB, exbB, and exbD genes: Ton-dependent utilization of protein-bound iron in neisseriae.
J Bacteriol.
179:805-812[Abstract/Free Full Text].
|
Journal of Bacteriology, November 1998, p. 6043-6047, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Torres, V. J., Pishchany, G., Humayun, M., Schneewind, O., Skaar, E. P.
(2006). Staphylococcus aureus IsdB Is a Hemoglobin Receptor Required for Heme Iron Utilization. J. Bacteriol.
188: 8421-8429
[Abstract]
[Full Text]
-
Ridley, K. A., Rock, J. D., Li, Y., Ketley, J. M.
(2006). Heme Utilization in Campylobacter jejuni. J. Bacteriol.
188: 7862-7875
[Abstract]
[Full Text]
-
Furano, K., Luke, N. R., Howlett, A. J., Campagnari, A. A.
(2005). Identification of a conserved Moraxella catarrhalis haemoglobin-utilization protein, MhuA. Microbiology
151: 1151-1158
[Abstract]
[Full Text]
-
Rohde, K. H., Dyer, D. W.
(2004). Analysis of Haptoglobin and Hemoglobin-Haptoglobin Interactions with the Neisseria meningitidis TonB-Dependent Receptor HpuAB by Flow Cytometry. Infect. Immun.
72: 2494-2506
[Abstract]
[Full Text]
-
Chen, C.-j., Tobiason, D. M., Thomas, C. E., Shafer, W. M., Seifert, H. S., Sparling, P. F.
(2004). A Mutant Form of the Neisseria gonorrhoeae Pilus Secretin Protein PilQ Allows Increased Entry of Heme and Antimicrobial Compounds. J. Bacteriol.
186: 730-739
[Abstract]
[Full Text]
-
Skaar, E. P., Gaspar, A. H., Schneewind, O.
(2004). IsdG and IsdI, Heme-degrading Enzymes in the Cytoplasm of Staphylococcus aureus. J. Biol. Chem.
279: 436-443
[Abstract]
[Full Text]
-
Paramaesvaran, M., Nguyen, K.-A., Caldon, E., McDonald, J. A., Najdi, S., Gonzaga, G., Langley, D. B., DeCarlo, A., Crossley, M. J., Hunter, N., Collyer, C. A.
(2003). Porphyrin-Mediated Cell Surface Heme Capture from Hemoglobin by Porphyromonas gingivalis. J. Bacteriol.
185: 2528-2537
[Abstract]
[Full Text]
-
Murphy, E. R., Sacco, R. E., Dickenson, A., Metzger, D. J., Hu, Y., Orndorff, P. E., Connell, T. D.
(2002). BhuR, a Virulence-Associated Outer Membrane Protein of Bordetella avium, Is Required for the Acquisition of Iron from Heme and Hemoproteins. Infect. Immun.
70: 5390-5403
[Abstract]
[Full Text]
-
Larson, J. A., Higashi, D. L., Stojiljkovic, I., So, M.
(2002). Replication of Neisseria meningitidis within Epithelial Cells Requires TonB-Dependent Acquisition of Host Cell Iron. Infect. Immun.
70: 1461-1467
[Abstract]
[Full Text]
-
Chen, C.-J., Mclean, D., Thomas, C. E., Anderson, J. E., Sparling, P. F.
(2002). Point Mutations in HpuB Enable Gonococcal HpuA Deletion Mutants To Grow on Hemoglobin. J. Bacteriol.
184: 420-426
[Abstract]
[Full Text]
-
Zhu, W., Hunt, D. J., Richardson, A. R., Stojiljkovic, I.
(2000). Use of Heme Compounds as Iron Sources by Pathogenic Neisseriae Requires the Product of the hemO Gene. J. Bacteriol.
182: 439-447
[Abstract]
[Full Text]