JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Winslow, R. H.
Right arrow Articles by Christie, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Winslow, R. H.
Right arrow Articles by Christie, G. E.

Journal of Bacteriology, November 1998, p. 6064-6067, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

An Upstream Sequence Element Required for NucC-Dependent Expression of the Serratia marcescens Extracellular Nuclease

Robert H. Winslow,1 Bryan Julien,2,dagger Richard Calendar,2 and Gail E. Christie1,*

Department of Microbiology and Immunology, Virginia Commonwealth University, Richmond, Virginia 23298-0678,1 and Department of Molecular and Cell Biology, University of California, Berkeley, California 94720-32042

Received 22 June 1998/Accepted 5 September 1998

    ABSTRACT
Top
Abstract
Text
References

The Serratia marcescens extracellular nuclease gene, nucA, is positively regulated by the product of the nucC gene. In this study, the upstream region required for NucC-dependent nuclease expression was defined by using fusions to the gene encoding chloramphenicol acetyltransferase (cat). This sequence includes an element of hyphenated dyad symmetry identified previously as the binding site for the P2 Ogr family of activators. Footprint analysis confirmed that members of this family of activator proteins bind to this site, protecting a region between -76 and -59 relative to the start of transcription. The activator binding site in the nucA promoter lies one turn of the helix upstream from the corresponding sites in the P2 and P4 late promoters. The effects of deletions between the downstream end of the activator binding site and the putative -35 region are consistent with a strict helical phasing requirement for activation.

    TEXT
Top
Abstract
Text
References

Expression of the Serratia marcescens extracellular nuclease, NucA, exhibits both growth phase dependence and an SOS-mediated response (3, 4). Previous studies have demonstrated that maximal expression of nucA also requires the product of the nucC gene (15). NucC is homologous to a family of small zinc-binding transcription factors encoded by the P2-related phages and their satellites. The nucC gene, although chromosomally located, lies in a transcription unit that appears to be part of a cryptic prophage found in S. marcescens (10, 15).

All members of the P2 Ogr family of proteins tested to date can substitute for each other to activate transcription at the same positively regulated promoters; this includes not only Ogr but 186 B, PSP3 Pag, P4 Delta, and phi R73 Delta as well as NucC (13, 15, 17). The P2 and P4 late promoters share a conserved sequence element of interrupted dyad symmetry, TGT-N12-ACA, centered at -57 upstream of the transcription start (6, 8, 9). Deletion and mutational analyses of the P2 PF and P4 Psid promoters (1, 7, 12, 22) indicated a key role for this sequence element in positive control of transcription. Activator binding to a region spanning these nucleotides was confirmed by DNase I footprinting analysis (16, 17). Inspection of sequences upstream of the nucA gene revealed several potential upstream binding sites that resembled this conserved sequence element, all of which were located farther upstream than the sites in the P2 and P4 late promoters. In order to localize the site of NucC action, we constructed a series of promoter derivatives fused to the cat gene and assayed them for NucC-dependent transcription in Escherichia coli.

Previous studies had identified the nucA transcription start site, as well as the presence of a LexA binding site overlapping +1 (5). Inclusion of 120 bp of sequence upstream of the transcription start site was sufficient to confer enhanced levels of nuclease expression, indicating that the NucC binding site was within this region (15). A 140-bp nucA promoter fragment, from -125 to +16, was obtained by PCR from plasmid pNuc2-LacZ (3), using the synthetic oligonucleotides Pnuc5 (5'ATCGATGTCTGTTGGACCCGT3') and Pnuc3 (5'GTCGACATTTACAGTGAATTAAACT3'). This introduced the underlined ClaI and SalI sites at the 5' and 3' ends, respectively, and destroyed the LexA-binding site. This fragment was ligated into the TA vector pCR2.1 (Invitrogen) to create pTG198, and the sequence was verified. The fragment was then excised by digestion with ClaI and SalI and ligated with pSL100 (19), a derivative of the promoterless chloramphenicol acetyltransferase (CAT) vector pKK232-8 (4), which had been cleaved with the same two enzymes. The resulting plasmid, pJC1, exhibited activator-dependent expression from the nucA promoter (Fig. 1). Basal (activator-independent) promoter activity from this construct was below the limits of detection (<0.005 U/mg) of the CAT assay conditions used. Deletion constructs were created by taking advantage of conveniently located restriction sites to generate new 5' ends at -87 (AflIII) and -72 (RsaI). In the case of AflIII, the DNA was treated with Klenow fragment after restriction to generate a blunt end. The truncated promoter fragments were then excised by digestion with ClaI and ligated with pKK232-8 that had been digested with SmaI and ClaI. As shown in Fig. 1, constructs pJC1 and pJC3 retain full activity, while removal of sequences upstream from the RsaI site abolishes all activation by NucC, P2 Ogr, and P4 delta . This endpoint corresponds directly to the upstream arm of a sequence element resembling those in the P2 and P4 late promoters.


View larger version (9K):
[in this window]
[in a new window]
 
FIG. 1.   Mapping the activator binding site on PnucA. Each of the fragments tested is indicated schematically below a map of the promoter region. These fragments were used to create derivatives of the cat expression vector pKK232-8 (4). Compatible plasmids encoding P2 Ogr (pGC57) and P4 Delta (pGVB1) under lambda  pL control have been described previously (12, 22). An equivalent plasmid encoding NucC was constructed by amplifying a 310-bp fragment containing the nucC gene from pSE380TacNucC (15) by using Vent DNA polymerase (New England Biolabs) with primers SM1 (5'-CGGAATTCTATGATGCACTGTCCACT-3') (the translation initiation codon for NucC is underlined) and SM2 (5'-CACGTTGCATTTGCGAG-3'). Following digestion with EcoRI, this fragment was ligated with pBB105 (2) to yield pTG136. Cultures of E. coli C-1a carrying each activator plasmid and promoter construct were assayed 30 min after synthesis of the activator was induced by a shift to 42°C, as described by Grambow et al. (12). CAT activity is expressed as micromoles of chloramphenicol acetylated per minute at 37°C per milligram of protein in the cell extract. Each value represents the average of two determinations from each of at least two independent cultures.

A DNase I footprint extending from -70 to -43 on the late promoters of bacteriophage P2 and P4 had previously been demonstrated using P4 Delta protein that was copurified with a maltose-binding protein-Delta fusion protein (16). DNase I protection analysis was carried out on the NucA promoter in the same manner. The region of protection, extending from -81 to -51, also corresponds to the dyad element implicated by the deletion analysis (Fig. 2). As has been seen for the P2 and P4 late promoters (17), two other activators from the Ogr-like family, the Delta protein of retronphage phi R73 and the Pag protein from phage PSP3, protected the same upstream region of PnucA (data not shown). This strongly suggests that binding to the dyad element is similar among the entire family of activators, including NucC.


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 2.   DNase I footprint analysis of the nucA promoter. A promoter fragment generated by cleavage of pTG198 was labeled at a SalI or XhoI site to generate probes for the top strand and bottom strand, respectively. Footprinting with a mixture of P4 Delta and maltose-binding protein-Delta was carried out as described by Julien and Calendar (16). The G and G+A lanes indicate the Maxam-Gilbert sequencing reactions, and a minus sign indicates reaction mixtures to which no protein was added. The numbers beside the connected arrows give the location of the protected region relative to the transcription start site. The region of protection for each strand is also indicated by connected arrows on the sequence shown below the footprints. The partial dyad sequences are indicated by inverted arrows, and the transcription start site is shown by the bent arrow above the sequence.

The activator binding site identified in this study contains the consensus TGT-N12-ACA motif found in the P2 and P4 late promoters but is centered at -67, which corresponds to one full turn of the helix upstream from the binding sites in the P2 and P4 late promoters. This provided us with an opportunity to elucidate the spacing requirements involved in activation from these promoters. An NdeI restriction site located between the downstream half of the dyad and the -35 region (Fig. 1) facilitated the deletion of multiple bases in this region. PCR using the synthetic oligonucleotide Pnuc5 with either NdeDelta 4 (5'CATATGTTGTGAATGTGTCAGTCAT3') or NdeDelta 9 (5'CATATGAATGTGTCAGTCATGGTAC3') resulted in fragments that moved the NdeI site upstream either four or nine bases. These products were initially ligated into the TA vector pCR2.1 (Invitrogen), and their sequences were verified. Mutant fragments were then excised by digestion with ClaI and NdeI and ligated into pTG198, replacing the corresponding wild-type promoter fragment. Additional spacing variants of these mutant promoters were created by NdeI digestion followed by treatment with either mung bean nuclease or Klenow fragment. The resulting blunt-end plasmid DNAs were religated, and the sequences of the deletions were determined. Mutant promoter fragments were then subcloned into pSL100 as described above and assayed for NucC-dependent CAT activity. Only the deletion mutant pNucA-Delta 11 showed activity similar to wild-type levels (Fig. 3). This shift in position, in fact, appears to promote slightly higher levels of activation. This represents one complete rotation along the DNA helix, consistent with a requirement for these activators to bind to a specific face of the DNA relative to RNA polymerase. Genetic evidence supports a model for transcription activation by the Ogr-like proteins that involves a direct interaction between the activator and the alpha subunit(s) of RNA polymerase (2, 14, 18, 20, 23). The strict helical phasing requirement for activation of the nuclease promoter is consistent with such a model, in which NucC bound to the upstream sequence makes a specific contact with RNA polymerase. A similar phase dependence has been demonstrated for activation of certain promoters by the cyclic AMP receptor protein (11, 21), which also interacts directly with RNA polymerase via one of the alpha subunits.


View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3.   Deletion analysis of PnucA. The NdeI restriction site used to facilitate deletion of multiple bases in this region is underlined in the wild-type sequence. The highly conserved TGT and ACA sequences in the activator binding site are in boldface. Mutant promoter fragments were assayed for NucC-dependent CAT activity as described in the legend to Fig. 1 in E. coli C-4595 (12) carrying the NucC plasmid pTG136.

The S. marcescens bss gene, encoding bacteriocin 28b, has also been shown to be positively regulated by NucC (10). While the transcription start site for the bss gene has not been reported, Ferrer et al. (10) identified putative -10 and -35 regions in the sequence upstream of the bacteriocin 28b coding region. There is a consensus dyad element, TGT-N12-ACA, located upstream of this presumptive promoter between -47 and -64. This is the same location as the binding sites in the P2 and P4 late promoters, and we predict that this dyad element is the NucC binding site for the bss promoter. The aberrant location of the NucC binding site in PnucA may reflect the way in which the nuclease promoter evolved to allow regulation by a transcription factor that was originally phage encoded.

    ACKNOWLEDGMENTS

We thank Mike Benedik for the nucA promoter plasmid pNuc2-LacZ. Tina Goodwin provided technical support, and rotation student Joshua Chen constructed some of the plasmids used in these studies.

This work was supported by American Cancer Society grant RPG-92-008-NP (to G.E.C.) and NIH grant AI08722 (to R.C.).

    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology and Immunology, Virginia Commonwealth University, Richmond, VA 23298-0678. Phone: (804) 828-9093. Fax: (804) 828-9946. E-mail: christie{at}hsc.vcu.edu.

dagger Present address: Kosan Biosciences, Burlingame, CA 94010.

    REFERENCES
Top
Abstract
Text
References

1. Anders, D. L. 1993. Regulation of P2 late gene expression: mutational analysis of late promoters. Ph.D. thesis. Virginia Commonwealth University, Richmond, Va.
2. Ayers, D. J., M. J. Sunshine, E. W. Six, and G. E. Christie. 1994. Mutations affecting two adjacent amino acid residues in the alpha subunit of RNA polymerase block transcriptional activation by the P2 Ogr protein. J. Bacteriol. 176:7430-7438[Abstract/Free Full Text].
3. Ball, T. K., C. R. Wasmuth, S. C. Braunagel, and M. J. Benedik. 1990. Expression of Serratia marcescens extracellular proteins requires recA. J. Bacteriol. 172:342-349[Abstract/Free Full Text].
4. Brosius, J. 1984. Plasmid vectors for the selection of promoters. Gene 27:151-160[Medline].
5. Chen, Y.-C., G. L. Shipley, T. K. Ball, and M. J. Benedik. 1992. Regulatory mutants and transcriptional control of the Serratia marcescens extracellular nuclease gene. Mol. Microbiol. 6:643-651[Medline].
6. Christie, G. E., and R. Calendar. 1985. Bacteriophage P2 late promoters. II. Comparison of the four late promoter sequences. J. Mol. Biol. 181:373-382[Medline].
7. Christie, G. E., T. S. Goodwin, D. L. Anders, R. H. Winslow, B. Julien, and R. Calendar. Unpublished results.
8. Dale, E. C., G. E. Christie, and R. Calendar. 1986. Organization and expression of the satellite bacteriophage P4 late gene cluster. J. Mol. Biol. 192:793-803[Medline].
9. Dehò, G., S. Zangrossi, D. Ghisotti, and G. Sironi. 1988. Alternative promoters in the development of bacteriophage plasmid P4. J. Virol. 62:1697-1704[Abstract/Free Full Text].
10. Ferrer, S., M. B. Viejo, J. F. Guasch, J. Enfedaque, and M. Regué. 1996. Genetic evidence for an activator required for induction of colicin-like bacteriocin 28b production in Serratia marcescens by DNA-damaging agents. J. Bacteriol. 178:951-960[Abstract/Free Full Text].
11. Gaston, K., A. Bell, A. Kolb, H. Buc, and S. Busby. 1990. Stringent spacing requirement for transcription activation by CRP. Cell 62:733-743[Medline].
12. Grambow, N. J., N. K. Birkeland, D. L. Anders, and G. E. Christie. 1990. Deletion analysis of a bacteriophage P2 late promoter. Gene 95:9-15[Medline].
13. Halling, C., and R. Calendar. 1990. The bacteriophage P2 ogr and P4 delta  genes act independently and are essential for P4 multiplication. J. Bacteriol. 172:3549-3558[Abstract/Free Full Text].
14. Halling, C., M. G. Sunshine, K. B. Lane, E. W. Six, and R. Calendar. 1990. A mutation of the transactivation gene of satellite bacteriophage P4 that suppresses the rpoA109 mutation of Escherichia coli. J. Bacteriol. 172:3541-3548[Abstract/Free Full Text].
15. Jin, S., Y. Chen, G. E. Christie, and M. J. Benedik. 1996. Regulation of the Serratia marcescens extracellular nuclease: positive control by a homolog of P2 Ogr encoded by a cryptic prophage. J. Mol. Biol. 256:264-278[Medline].
16. Julien, B., and R. Calendar. 1995. Purification and characterization of the bacteriophage P4 delta  protein. J. Bacteriol. 177:3743-3751[Abstract/Free Full Text].
17. Julien, B., and R. Calendar. 1996. Bacteriophage PSP3 and phi R73 activator proteins: analysis of promoter specificities. J. Bacteriol. 178:5668-5675[Abstract/Free Full Text].
18. Julien, B., D. Pountney, G. E. Christie, and R. Calendar. Mutational analysis of a satellite phage activator. Gene, in press.
19. Li, S. C., C. L. Squires, and C. Squires. 1984. Antitermination of E. coli rRNA transcription is caused by a control region segment containing lambda nut-like sequences. Cell 38:851-860[Medline].
20. Sunshine, M., and B. Sauer. 1975. A bacterial mutation blocking P2 late gene expression. Proc. Natl. Acad. Sci. USA 72:2270-2774[Abstract/Free Full Text].
21. Ushida, C., and H. Aiba. 1990. Helical phase dependent action of CRP: effect of the distance between the CRP site and the -35 region on promoter activity. Nucleic Acids Res. 18:6325-6330[Abstract/Free Full Text].
22. Van Bokkelen, G. B., E. C. Dale, C. Halling, and R. Calendar. 1991. Mutational analysis of a bacteriophage P4 late promoter. J. Bacteriol. 173:37-45[Abstract/Free Full Text].
23. Wood, L. F., N. Y. Tszine, and G. E. Christie. 1997. Activation of P2 late transcription by P2 Ogr protein requires a discrete contact site on the C terminus of the alpha  subunit of Escherichia coli RNA polymerase. J. Mol. Biol. 274:1-7[Medline].


Journal of Bacteriology, November 1998, p. 6064-6067, Vol. 180, No. 22
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Winslow, R. H.
Right arrow Articles by Christie, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Winslow, R. H.
Right arrow Articles by Christie, G. E.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS