Journal of Bacteriology, December 1998, p. 6077-6081, Vol. 180, No. 23
Laboratory of Microbiology, The Rockefeller
University, New York, New York 10021,1 and
Molecular Genetics Unit,
Received 14 August 1998/Accepted 24 September 1998
Sequencing of the vicinity of the staphylococcal pbp2
gene and transcriptional analysis by primer extension and promoter
fusions were used to show that pbp2 is part of an operon
that also includes a gene with high homology to prfA of
Bacillus subtilis. Two distinct promoters were identified
directing transcription of pbp2 either alone or together
with prfA. It was recently reported that transposon inactivation of pbp2 causes a reduction in methicillin
resistance, but complementation experiments were not fully successful.
We now show that introduction of the intact pbp2 gene with
its two newly identified promoters into the chromosome of the
transposon mutant resulted in the full recovery of high-level
methicillin resistance.
All strains of Staphylococcus
aureus have four penicillin-binding proteins (PBPs) which are
assumed to participate in the assembly of cell wall peptidoglycan. Of
this native set of PBPs, PBP2 was reported to be a major
peptidoglycan transpeptidase (5), since selective
inhibition of this protein by ceftizoxime or cefotaxime led to the
inhibition of peptidoglycan elongation (16) and to leakage
of cytoplasmic contents due to cell lysis (5). Homology between the N-terminal half of S. aureus PBP2 and
Escherichia coli PBP1A, a bifunctional protein, suggests
that PBP2 also has a transglycosylase domain (13, 15).
Surprisingly, PBP2 also appears to have an important role in the
expression of antibiotic resistance in methicillin-resistant S. aureus (MRSA) (18). MRSA has an additional
PBP In an attempt to clarify the reasons for the lack of success in
complementation, we proceeded to do more extensive sequencing in the
vicinity of the pbp2 gene and also performed transcription analysis. This study showed that the pbp2 gene is part of an
operon and can be transcribed alone or together with a newly identified PBP-related factor (PrfA), due to the presence of two distinct promoters. Introduction of a construct that contained the entire pbp2 operon into the chromosome of the pbp2
transposon mutant resulted in the full recovery of antibiotic resistance.
Bacterial strains, plasmids, and growth media.
The bacterial
strains and plasmids used in this study are described in Table
1. S. aureus strains were
grown on tryptic soy broth (TSB; Difco Laboratories) with aeration as
described previously (17). E. coli strains were
grown in Luria-Bertani broth (Difco) with aeration. Antibiotics were
used at the following concentrations: erythromycin, 10 µg/ml;
ampicillin, 100 µg/ml; chloramphenicol, 10 µg/ml.
DNA methods.
Routine DNA manipulations were performed by
using standard methods (2, 22). All of the enzymes were
purchased from either New England Biolabs or Boehringer Mannheim and
used as recommended by the manufacturers. DNA sequencing was done at
the Rockefeller University Protein/DNA Technology Center with the
Taq fluorescent dye terminator sequencing method by using a
PE/ABI 377 automated sequencer.
Inverted PCR.
COL chromosomal DNA was digested with
EcoRI, purified with the Wizard DNA Clean-Up System
(Promega), and ligated with T4 DNA ligase. The ligation mixture, after
purification, was used as a template for a PCR with the GeneAmp PCR
Reagent Kit with AmpliTaq DNA polymerase (Perkin Elmer) in accordance
with the manufacturers' instructions and by using 20 pmol each of
primers PBP2P8 (CTTAGGCTGAGAAGATCCTT) and PBP2P9
(AGCTTGGCAATCAGTTAAGC). The following conditions were used:
94°C for 2 min; 35 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 2.5 min; and one final extension step of 72°C for 5 min. The 2,862-bp fragment was sequenced by primer walking, starting
with the same primers used for the PCR.
Isolation of RNA and Northern blot hybridization.
Overnight
cultures of S. aureus were diluted 1:50 in TSB and grown to
mid-log phase (optical density at 620 nm [OD620], 0.7). The cells were pelleted and processed with an RNeasy Mini Kit (Qiagen)
or with a FastRNA Blue isolation kit (Bio 101, Inc.) in combination
with FastPrep FP120 (Bio 101 Savant) in accordance with the
manufacturer's recommendations. RNA (5 µg) was electrophoresed through a 1.2% agarose-0.66 M formaldehyde gel in
morpholinepropanesulfonic acid running buffer (Sigma). Blotting of RNA
onto Hybond N+ membranes (Amersham) was performed with the
Turboblotter alkaline transfer system (Schleicher & Schuell). For the
detection of specific transcripts, DNA probes were labelled by using
the Gene Images random prime labelling module (Amersham Life Science)
and hybridized under high-stringency conditions. The blots were
subsequently washed and autoradiographed.
RT-PCR.
Reverse transcription (RT)-PCR was performed by
using the GeneAmp RNA PCR kit (Perkin Elmer). COL RNA treated with
DNase was used as the template. Random hexamers were used for the
reverse transcriptase reaction, and a primer internal to
prfA Constructions of promoter fusions.
Three fragments
encompassing the region upstream of pbp2 were amplified by
high-fidelity PCR with the GeneAmp XL PCR kit (Perkin Elmer), which
includes rTth DNA polymerase XL. To further decrease the
probability of errors during the PCR, a hot start and the following
conditions were used: 94°C for 2 min, 20 cycles of 94°C for 30 s, and 55°C for 1.75 min; and one final extension step of 55°C for
5 min. Primer pairs pro4-pro9, pro5-pro8, and pro9-pro10 (Fig.
1) were used to amplify the three
fragments that were subsequently cloned into pLC4.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Transcriptional Analysis of the
Staphylococcus aureus Penicillin Binding Protein 2 Gene
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
PBP2A
which has a very low affinity for
-lactam
antibiotics (8, 21) and has homology to monofunctional
transpeptidase PBP3 of E. coli (6, 9, 13). In
current models, PBP2A is assumed to take over the biosynthetic
functions of normal PBPs in the presence of inhibitory concentrations
of
-lactams. According to this model, normal PBPs no longer take
part in the catalysis of cell wall synthesis in the presence of the
antibiotic. It was therefore surprising to find that a mutant with a
transposon insertion in pbp2 (RUSA 130) showed a massive
reduction in methicillin resistance, despite its normal production of
PBP2A, indicating that intact PBP2 is essential for the optimal
expression of methicillin resistance in MRSA (18). As a
possible explanation, we proposed that survival and growth in the
presence of the antibiotic may require functional cooperation between
the penicillin-insensitive transglycosylase domain of PBP2 and the
transpeptidase domain of PBP2A or that effective functioning of PBP2A
may require the presence of inactivated (acylated) PBP2, which serves
as structural scaffolding (18). An additional possibility
that could not be excluded was that a truncated PBP2 produced by the
transposon-inactivated pbp2 gene may interfere with the
function of PBP2A. This hypothesis was also suggested by the fact that
attempts to recover the normal
high
level of antibiotic resistance by
complementation with a plasmid-born pbp2 gene were only
partially successful (18).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used in
this study
PrfA1 (ATGTCAACTATCCTAAGCGG)
and a primer
internal to pbp2
IP6
(TCTTAGCATCTTCCCACTGT)
were used in the PCR. The
following conditions were used: 94°C for 2 min; 30 cycles of 94°C
for 30 s, 53°C for 30 s, and 72°C for 2 min; and one
final extension step of 72°C for 5 min.

View larger version (43K):
[in a new window]
FIG. 1.
Nucleotide sequence of the region upstream of
pbp2. Putative promoter regions are highlighted by boxed
sequences and labelled
10 and
35. The promoters are designated P1
and P2. P1' corresponds to a weaker signal in the primer extension
analysis. Putative ribosome-binding sites are underlined and labelled
SD. The 5' end of the RNA determined by primer extension is labelled
+1. Start codons are in boldface and double underlined. The
prfA stop codon is indicated by an asterisk. Primers are
indicated by arrows. The deduced amino acid sequence of prfA
is aligned under the DNA sequence.
Enzyme assays. Catechol 2,3-dioxygenase assays were performed essentially as previously described (23), except for the lysis of bacteria, which was done by using glass beads and FastPrep 120 (Bio 101 Savant) in 100 mM phosphate buffer (pH 7.5) containing 10% acetone. Volumes of 20 to 3 ml corresponding to different OD620 values were serially removed from cultures growing in TSB. Assays contained 100 µl of extract, and the reactions were conducted at room temperature for 5 min with OD375 readings taken at 30-s intervals. One milliunit corresponds to the formation at room temperature of 1 nmol of 2-hydroxymuconic semialdehyde per min. Specific activity is reported in milliunits per milligram of total protein. Protein concentrations were measured by using the bicinchoninic acid protein assay reagent kit (Pierce).
Primer extension analysis.
Primer extension analysis was
performed by using primers PE2 and PE3 (Fig. 1), which were end
labelled with [
-32P]ATP and purified with Sephadex
G-25 spin columns (Boehringer Mannheim). RNA from COL (50 µg) or
RN4220pro9/10 (10 µg) was hybridized with the appropriate primer at
65°C for 90 min and slowly cooled to room temperature. RT was carried
out by using SuperScript RT (Gibco BRL) at 42°C for 90 min, and the
reaction mixture was heated at 65°C for 10 min to inactivate the
enzyme. The reaction product was incubated with RNase H (3 U) at 37°C
for 30 min, ethanol precipitated, resuspended in 10 µl of Sequenase
stop solution, denatured, and applied to a 6% sequencing gel.
Sequencing reaction mixtures prepared by using the T7 Sequenase Kit
vs2.0 (Amersham Life Sciences) primed by an oligonucleotide identical
to that used for primer extension were also applied to the gel.
Complementation of mutant RUSA130. A 3.2-kb fragment was amplified from the COL chromosome by using primers PBP2B (CGGGATCCCACATACTTGTACTTGCCTC) and PBP2P7P (AACTGCAGTCCCACCATAAAAGATGAAG) by high-fidelity PCR under the same conditions as for the construction of promoter fusions, except for an extension time of 5 min. This fragment was cloned into shuttle vector pSPT181 digested with BamHI and PstI. A chloramphenicol resistance marker amplified by high-fidelity PCR from pGC2 with primers cat1 (TTCCCCGGGACCAGTCATACCAATAAC) and cat2 (TTCCCCGGGCTCAACGTCAATAAAGCA) was cloned into the AvaI site of the polylinker.
S. aureus RN4220 was used as the recipient for electroporation of the shuttle plasmid, which was performed as previously described (25). The plasmids were subsequently introduced into RUSA130 by transduction using phage 80
(17).
Population analysis profiles were performed by plating 10-µl samples
of 100, 10
1, 10
2,
10
4, 10
5, and 10
6 dilutions
of an overnight culture on plates containing methicillin (0, 0.75, 1.5, 3, 6, 12, 25, 50, 100, 200, 400, and 800 µg/ml). The plates were then
tipped onto their sides (90° angle), and the spots were allowed to
migrate in parallel tracks across the agar surface to the opposite side
of each plate, and the plates were incubated at 30°C for 48 h
(11).
Nucleotide sequence accession number. The complete nucleotide sequence determined in this study is available in the EMBL and GenBank databases under accession no. Y17795.
| |
RESULTS |
|---|
|
|
|---|
Sequencing of the region upstream of the pbp2 gene. A fragment of 2,862 bp, which included the region upstream of the pbp2 gene of strain COL, was obtained by inverted PCR and sequenced by primer walking. The sequence of the pbp2 gene from COL was obtained by using primers based on the published sequence of S. aureus SRM705 (15) (accession no. X62288). The fragment upstream of pbp2 is presented in Fig. 1.
Computer analysis identified an open reading frame (ORF) of 627 bp upstream of pbp2. In fact, the last four nucleotides of this ORF overlap the pbp2 coding sequence. The deduced amino acid sequence of this ORF was compared to sequences of known polypeptides in the EMBL and GenBank databases by using the Gapped Blast algorithm (1). Significant homology (52% identity) was found with the protein encoded by gene prfA (PBP-related factor A) from Bacillus subtilis (19), which is located upstream of the gene that encodes PBP1 (the B. subtilis homologue of S. aureus PBP2). This protein has also been identified in Streptococcus oralis and Streptococcus pneumoniae (12).Analysis of the transcription of pbp2. To determine if the prfA and pbp2 genes were transcribed together, a Northern blot of total RNA of COL was hybridized with a probe internal to pbp2 (nucleotides 330 to 716 of the pbp2 sequence). The appearance of two bands (data not shown), one with a molecular size of 2.1 kb, corresponding to the size expected for the pbp2 transcript, and another with a molecular size of 2.9 kb, corresponding to the size of a transcript with the two ORFs, suggests that the pbp2 gene can be transcribed either alone or together with prfA.
A third band, corresponding to a molecular size of 1.6 kb and located just above the rRNA band, was occasionally observed in some of the Northern blot hybridizations. The size of this band is smaller than that of the pbp2 gene, and it probably corresponds to degradation products retained in this region. RT-PCR was performed by using one primer internal to prfA and another internal to pbp2. The successful amplification of a 1.2-kb fragment clearly indicates that the two ORFs can be transcribed together. These results suggested the existence of two promoters, one upstream of prfA (promoter 1) that would direct the transcription of the 2.9-kb transcript and another upstream of pbp2 (promoter 2) that would direct the transcription of the 2.1-kb transcript. We amplified, by high-fidelity PCR, three fragments: one containing 678 bp (from nucleotide 133 to nucleotide 802 in Fig. 1) and including the region where we expected promoter 1 to be; a second, 311-bp fragment (from nucleotide 777 to nucleotide 1088 in Fig. 1) including the region of promoter 2; and a third, 967-bp fragment (from nucleotide 133 to nucleotide 1088 in Fig. 1) including both promoter regions. The fragments were cloned into pLC4, and the inserts were sequenced. This plasmid has a promoterless xylE gene, and production of catechol 2,3-dioxygenase in S. aureus is dependent on the introduction of a promoter, upstream of xylE, that is functional in the gram-positive host (26). Determination of the specific activity of catechol 2,3-deoxygenase (Fig. 2) indicated that promoter 1 generates higher levels of catechol 2,3-dioxygenase activity than promoter 2 and that the activity of both promoters was found to decrease with the end of the exponential growth phase.
|
Determination of transcription initiation sites. Primer extension analysis was performed to determine the transcription start site corresponding to each promoter by using primers specific for the prfA and pbp2 transcripts. RNAs prepared from both COL (data not shown) and RN4220pro9/10 (Fig. 3) (i.e., the strain containing a plasmid with an insert encompassing both promoter regions) were used as templates for the RT reaction.
|
Recovery of methicillin resistance in mutant RUSA130.
A 3.2-kb
fragment containing the complete sequences of prfA and
pbp2, as well as the promoter regions, was amplified by
high-fidelity PCR and cloned into pSPT181. Plasmid pMGP19 was first
introduced into RN4220 by electroporation and afterwards into RUSA130
by transduction. This plasmid is incompatible with the tetracycline resistance-encoding plasmid present in COL and in the RUSA130 mutant.
Therefore, strain RUSA130 with pMGP19 had the plasmid integrated into
the chromosome by a Campbell-type mechanism and also retained the
transposon-inactivated copy of pbp2
as confirmed by
Southern blotting, followed by hybridization with a probe specific for
pbp2 (data not shown). Figure
4 shows that RUSA130/pMGP19 fully
recovered the high-level methicillin resistance of parental strain COL.
|
| |
DISCUSSION |
|---|
|
|
|---|
In previous studies of pbp2, it was suggested that the
10 region of the pbp2 promoter (annotated in the GenBank
database, accession no. L25426 [7]) was located in the
region corresponding to nucleotides 1027 to 1032 of Fig. 1. Our data
shows that this is unlikely and that, in fact, not one but two
promoters direct the transcription of pbp2 (promoters 1 and
2 in Fig. 1), neither one of which coincides with the previously
suggested promoter.
The lack of success in recovering high-level antibiotic resistance in the complementation experiments described before (18) may have been caused by the use of pbp2 without a correct promoter. By using the pbp2 operon as defined by the results described here, it was possible to recover the high, parental level of methicillin resistance in pbp2 transposon mutant RUSA130. Construct RUSA130/pMGP19 contained single copies of both the truncated and normal forms of the pbp2 gene on the chromosome, each preceded by native promoters. The possibility could not be previously excluded that the truncated allele of PBP2 present in RUSA130 might interfere with the function of PBP2A and thus cause the reduction of methicillin resistance in strain RUSA130 (18). However, the recovery of high methicillin resistance in RUSA130/pMGP19 makes it unlikely that the truncated allele could have a dominant negative effect on the activity of PBP2A. The reappearance of parental-level methicillin resistance in this construct also provides final proof of the importance of functional PBP2 in the expression of resistance to methicillin.
The results described here indicate that transcription of pbp2 can occur together with that of prfA, a gene located immediately upstream of pbp2 with an overlap of four nucleotides, and the two genes therefore constitute an operon. However, pbp2 can also be transcribed alone. It is conceivable that changes in the preferential use of the two promoters may occur under specific physiological conditions, for instance, in the presence of antibiotics. However, analysis of the activities of the two promoters through the growth cycle did not show any striking change of promoter usage: promoter 1 activity was always higher, and the expression of pbp2 from both promoters declined as the bacteria entered stationary phase.
The function of the protein encoded by prfA is unknown. In B. subtilis, the combined effects of mutations in the PBP1 (ponA) and prfA genes on the bacterial growth rate were more dramatic than the effect of either one of the individual mutations, suggesting involvement of PrfA with the function of PBP1 (19), a homologue of S. aureus PBP2. The existence of two promoters in B. subtilis has also been suggested, although attempts to determine their positions by primer extension were inconclusive (19). The fact that the two genes are part of an operon in at least two different organisms reinforces the hypothesis that their functions may be related. PrfA may modulate the activity of the staphylococcal pbp2 promoter, although the presence of prfA in a multicopy plasmid (pro9/10) did not significantly affect the transcription directed by the pbp2 promoters in the catechol 2,3-deoxygenase assay. It is possible that this protein interacts with PBP2, as a part of a multienzyme complex responsible for the catalysis of cell wall synthesis in a manner similar to the one proposed for E. coli (3). Studies are in progress to test this possibility.
Overexpression of PBP2 was observed in vancomycin- and
teicoplanin-resistant S. aureus (14, 24). The
identification of pbp2 promoter regions, as well as the
characterization of the PrfA protein, may be relevant to the
understanding of the mechanisms of resistance to both
-lactams and glycopeptides.
| |
ACKNOWLEDGMENTS |
|---|
Partial support for this work was provided by contracts PRAXIS XXI 2/2.1/BIA/349/94 and PRAXIS XXI 2/2.1/BIO/1154/95 (Portugal) awarded to H. de Lencastre and by the Aaron Diamond Foundation and the Bodman Foundation to A. Tomasz. Mariana Pinho was supported by grant PRAXIS XXI/BD/9079/96.
We thank Ambrose Cheung, who kindly provided plasmids pSPT181 and pLC4, and Shangwei Wu for plasmid pSPT181cat and helpful discussions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Microbiology, The Rockefeller University, 1230 York Avenue, New York, NY 10021. Phone: (212) 327-8278. Fax: (212) 327-8688. E-mail: tomasz{at}rockvax.rockefeller.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1996. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 3. | Ayala, J. A., T. Garrido, M. A. de Pedro, and M. Vicente. 1994. Molecular biology of bacterial separation, p. 73-101. In J.-M. Ghuysen, and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier Science, Amsterdam, The Netherlands. |
| 4. |
de Lencastre, H., and A. Tomasz.
1994.
Reassessment of the number of auxiliary genes essential for expression of high-level methicillin resistance in Staphylococcus aureus.
Antimicrob. Agents Chemother.
38:2590-2598 |
| 5. |
Georgopapadakou, N. H.,
B. A. Dix, and Y. R. Mauriz.
1986.
Possible physiological functions of penicillin-binding proteins in Staphylococcus aureus.
Antimicrob. Agents Chemother.
29:333-336 |
| 6. |
Goffin, C.,
C. Fraipont,
J. Ayala,
M. Terrak,
M. Nguyen-Distèche, and J.-M. Ghuysen.
1996.
The non-penicillin-binding module of the tripartite penicillin-binding protein 3 of Escherichia coli is required for folding and/or stability of the penicillin-binding module and the membrane-anchoring module confers cell septation activity on the folded structure.
J. Bacteriol.
178:5402-5409 |
| 7. | Hackbarth, C. J., T. Kocagoz, S. Kocagoz, and H. F. Chambers. 1995. Point mutations in Staphylococcus aureus PBP 2 gene affect penicillin-binding kinetics and are associated with resistance. Antimicrob. Agents Chemother. 39:103-106[Abstract]. |
| 8. |
Hartman, B. J., and A. Tomasz.
1984.
Low-affinity penicillin-binding protein associated with -lactam resistance in Staphylococcus aureus.
J. Bacteriol.
158:513-516 |
| 9. |
Holtje, J. V.
1998.
Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli.
Microbiol. Mol. Biol. Rev.
62:181-203 |
| 10. | Janzon, L., and S. Arvidson. 1990. The role of the delta-lysin gene (hld) in the regulation of virulence genes by the accessory gene regulator (agr) in Staphylococcus aureus. EMBO J. 9:1391-1399[Medline]. |
| 11. | Jett, B. D., K. L. Hatter, M. M. Huycke, and M. S. Gilmore. 1997. Simplified agar plate method for quantifying viable bacteria. Biotechniques 23:648-650[Medline]. |
| 12. |
Martin, C.,
T. Briese, and R. Hakenbeck.
1992.
Nucleotide sequences of genes encoding penicillin-binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillin-binding proteins 1a and 1b.
J. Bacteriol.
174:4517-4523 |
| 13. |
Massova, I., and S. Mobashery.
1998.
Kinship and diversification of bacterial penicillin-binding proteins and -lactamases.
Antimicrob. Agents Chemother.
42:1-17 |
| 14. | Moreira, B., S. Boyle-Vavra, B. L. deJonge, and R. S. Daum. 1997. Increased production of penicillin-binding protein 2, increased detection of other penicillin-binding proteins, and decreased coagulase activity associated with glycopeptide resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 41:1788-1793[Abstract]. |
| 15. | Murakami, K., T. Fujimura, and M. Doi. 1994. Nucleotide sequence of the structural gene for the penicillin-binding protein 2 of Staphylococcus aureus and the presence of a homologous gene in other staphylococci. FEMS Microbiol. Lett. 117:131-136[Medline]. |
| 16. | Okonogi, K., Y. Noji, M. Nakao, and A. Imada. 1995. The possible physiological roles of penicillin-binding proteins of methicillin-susceptible and methicillin-resistant Staphylococcus aureus. J. Infect. Chemother. 1:50-58. |
| 17. |
Oshida, T., and A. Tomasz.
1992.
Isolation and characterization of a Tn551-autolysis mutant of Staphylococcus aureus.
J. Bacteriol.
174:4952-4959 |
| 18. | Pinho, M. G., A. M. Ludovice, S. Wu, and H. de Lencastre. 1997. Massive reduction in methicillin resistance by transposon inactivation of the normal PBP2 in a methicillin-resistant strain of Staphylococcus aureus. Microb. Drug Resist. 3:409-413. [Medline] |
| 19. |
Popham, D. L., and P. Setlow.
1995.
Cloning, nucleotide sequence, and mutagenesis of the Bacillus subtilis ponA operon, which codes for penicillin-binding protein (PBP) 1 and a PBP-related factor.
J. Bacteriol.
177:326-335 |
| 20. |
Ray, C.,
R. E. Hay,
H. L. Carter, and C. P. Moran, Jr.
1985.
Mutations that affect utilization of a promoter in stationary-phase Bacillus subtilis.
J. Bacteriol.
163:610-614 |
| 21. |
Reynolds, P. E., and D. F. Brown.
1985.
Penicillin-binding proteins of -lactam-resistant strains of Staphylococcus aureus. Effect of growth conditions.
FEBS Lett.
192:28-32[Medline].
|
| 22. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 23. | Sheehan, B. J., T. J. Foster, C. J. Dorman, S. Park, and G. S. Stewart. 1992. Osmotic and growth-phase dependent regulation of the eta gene of Staphylococcus aureus: a role for DNA supercoiling. Mol. Gen. Genet. 232:49-57[Medline]. |
| 24. |
Shlaes, D. M.,
J. H. Shlaes,
S. Vincent,
L. Etter,
P. D. Fey, and R. V. Goering.
1993.
Teicoplanin-resistant Staphylococcus aureus expresses a novel membrane protein and increases expression of penicillin-binding protein 2 complex.
Antimicrob. Agents Chemother.
37:2432-2437 |
| 25. | Wu, S., H. de Lencastre, A. Sali, and A. Tomasz. 1996. A phosphoglucomutase-like gene essential for the optimal expression of methicillin resistance in Staphylococcus aureus: molecular cloning and DNA sequencing. Microb. Drug Resist. 2:277-286. [Medline] |
| 26. |
Zukowski, M. M.,
D. F. Gaffney,
D. Speck,
M. Kauffmann,
A. Findeli,
A. Wisecup, and J. P. Lecocq.
1983.
Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene.
Proc. Natl. Acad. Sci. USA
80:1101-1105 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»