Previous Article | Next Article 
Journal of Bacteriology, December 1998, p. 6276-6282, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Bacillus subtilis
Nucleotidyltransferase Is a tRNA CCA-Adding Enzyme
Lelia C.
Raynal,
Henry M.
Krisch, and
Agamemnon J.
Carpousis*
Laboratoire de Microbiologie et
Génétique Moléculaire, Centre National de la
Recherche Scientifique (CNRS), Toulouse, France
Received 8 June 1998/Accepted 11 September 1998
 |
ABSTRACT |
There has been increased interest in bacterial polyadenylation with
the recent demonstration that 3' poly(A) tails are involved in RNA
degradation. Poly(A) polymerase I (PAP I) of Escherichia coli is a member of the nucleotidyltransferase (Ntr) family that includes the functionally related tRNA CCA-adding enzymes. Thirty members of the Ntr family were detected in a search of the current database of eubacterial genomic sequences. Gram-negative organisms from
the 
and 
subdivisions of the purple bacteria have two genes
encoding putative Ntr proteins, and it was possible to predict their
activities as either PAP or CCA adding by sequence comparisons with the
E. coli homologues. Prediction of the functions of proteins encoded by the genes from more distantly related bacteria was not
reliable. The Bacillus subtilis papS gene encodes a protein that was predicted to have PAP activity. We have overexpressed and
characterized this protein, demonstrating that it is a tRNA nucleotidyltransferase. We suggest that the papS gene
should be renamed cca, following the notation for its
E. coli counterpart. The available evidence indicates that
cca is the only gene encoding an Ntr protein, despite
previous suggestions that B. subtilis has a PAP similar to
E. coli PAP I. Thus, the activity involved in RNA 3'
polyadenylation in the gram-positive bacteria apparently resides in an
enzyme distinct from its counterpart in gram-negative bacteria.
| |
INTRODUCTION |
mRNA polyadenylation now appears to
be a common property of all living cells, but until recently it had
been extensively studied only in eukaryotes (reviewed in references
9, 41, and 49). In the
eubacteria, polyadenylated mRNAs have been detected in both
gram-positive and gram-negative organisms (reviewed in references 43 and 44). Although an
Escherichia coli poly(A) polymerase (PAP) activity was first
described over 30 years ago (4), a convincing demonstration
that polyadenylation is a general feature of prokaryotic messages was
difficult because the poly(A) tails are short, mRNA turnover is very
rapid, and only a fraction of the mRNAs are polyadenylated. The recent
purification of E. coli PAP I and the identification of its
gene (7) has led to increased interest in bacterial
polyadenylation. PAP I is a 50-kDa protein encoded by the
pcnB gene, which has been implicated in the control of
plasmid copy number (30, 31, 33). The polyadenylation of RNA
I, a plasmid-encoded antisense RNA that regulates ColE1 plasmid
replication, mediates its degradation via a 3' exonucleolytic pathway
(23, 50, 51). Poly(A)-mediated exonucleolytic degradation has also been described for the antisense RNAs that regulate R1 plasmid
replication and partition (36, 45), and it is believed to be
involved in the degradation of mRNA (8, 21, 22, 37).
A second putative PAP of 35 kDa (PAP II), encoded by the open reading
frame f310, has been identified in E. coli
(6, 27). Strains with a disruption of the gene encoding
either PAP I or PAP II are viable, suggesting a possible functional
redundancy. However, there is no obvious sequence homology between the
two E. coli polymerases, and PAP II is not related to any
other known protein sequence. We previously detected proteins related
to PAP I in a variety of bacteria, including Bacillus
subtilis, Desulfovibrio gigas, and Proteus
mirabilis, using an antibody raised against the purified
E. coli PAP I (39). PAP I is a member of the
X polymerase family, which includes the eukaryotic PAPs as well as all
of the known nucleotidyltransferases (34, 52). The PAP I and
tRNA nucleotidyltransferase of E. coli have extensive homology in their N-terminal halves (35). Their similarity
to the eukaryotic PAPs is limited to a small number of conserved residues that are critical for activity (34, 39a). The tRNA 3' CCA-adding activity is specific to the tRNA nucleotidyltransferases (reviewed in reference 14). In eukaryotes, where the
CCA is rarely encoded by the tRNA gene, the tRNA nucleotidyltransferase is essential (1). In bacteria, the 3' CCA is generally
encoded by the tRNA gene. Nevertheless, the E. coli
CCA-adding enzyme has an important role in the repair of tRNA 3' ends,
and its inactivation significantly slows growth (11, 16,
53).
Although the E. coli tRNA nucleotidyltransferase can add CCA
or repair ends (CA or A addition), we know of no evidence that it can
add longer 3'-terminal extensions (Fig.
1A). In contrast, PAP I in vitro can add
poly(A) tails several hundred nucleotides long to tRNA or other RNA
substrates (Fig. 1B) (39). Although the principal role of
PAP I is believed to be 3' polyadenylation, PAP I and polynucleotide
phosphorylase can repair partially damaged tRNA CCA ends in E. coli mutants that are deficient for CCA-adding activity
(40). In this paper, we show that, like E. coli,
other organisms from the and subdivisions of the purple
bacteria have two genes encoding proteins that can be classified as
either a tRNA nucleotidyltransferase or PAP by protein sequence
comparisons. However, prediction of the activity of Ntr proteins
encoded by genes from more distantly related bacteria is not reliable.
The gram-positive bacterium B. subtilis, whose genome has
now been completely sequenced, contains a single gene encoding an Ntr
protein that we show is a tRNA nucleotidyltransferase. The apparent
lack of an Ntr protein with PAP activity is surprising because previous evidence suggested that B. subtilis has an activity similar
to that of E. coli PAP I.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Repair of tRNA CCA ends by nucleotidyltransferase;
(B) 3' poly(A) addition to tRNA or other RNA substrates by PAP; (C)
phylogenetic tree showing the relationship of the major families of
eubacteria (38). Thermus thermophilus and
Aquifex are single organisms.
|
|
| |
MATERIALS AND METHODS |
The construction of pET11a-derived vectors for protein
expression and the preparation of protein extracts was done as
described previously (39). Briefly, the DNAs encoding the
E. coli cca and B. subtilis papS open reading
frames were PCR amplified with the oligonucleotide pairs
5'ATATGAAGATTTATCTGGTCGGTGGTGC3' and 5'TCATTCAGGCTTTGGGCAAGCTTGTTCC3' (E. coli) or
5'ATATGGAAAAAGTTTTTATCAAAGCACTTCC3' and
5'TTAATGTTAGACCGCATGTCTTCAGCC3' (B. subtilis)
with genomic DNA from E. coli D10 (20) or
B. subtilis QB936 (13). In the construction
expressing the E. coli CCA-adding enzyme, we changed the GTG
initiation codon to ATG. Protein expression was done in the BL21(DE3)
strain with 1 mM IPTG
(isopropyl--D-thiogalactopyranoside) induction for
2 h. Cultures, concentrated fivefold, were suspended in a lysis
buffer and sonicated. The extracts were treated with 10 µg of DNase
I/ml and then adjusted to 0.8 M NH4Cl. The cell debris and
the ribosomes were removed by centrifugation. The purities of the
overexpressed proteins were estimated with a Coomassie blue-stained
sodium dodecyl sulfate (SDS)-polyacrylamide gel as follows: E. coli PAP I, 10%; E. coli tRNA CCA-adding enzyme, 2%; and B. subtilis PapS, 30%. The low level of the CCA-adding
enzyme was due to its inefficient expression. In the assays described below, 250 (PAP I), 1,250 (CCA-adding enzyme), or 80 ng (PapS) of total
protein was used to give equivalent amounts of each overexpressed protein (25 ng). For ease of comparison, the values for normalized specific activities (see Table 2) are based on the estimated amounts of
the overexpressed proteins.
The following conditions were used to measure the specific activities
(see Table 2). The tRNA nucleotidyltransferase assay was done as
described previously (15). The protein extracts were diluted
in 10 mM glycine (pH 9.4)-1 mg of Saccharomyces cerevisiae tRNA/ml. Reaction mixtures (200 µl) containing 50 mM glycine (pH 9.4), 5 mM MgCl2, 500 µM ATP, 10 µCi of
[
-32P]ATP (or [-32P]CTP), 150 µg of
yeast tRNA or poly(A), and 25 ng of overexpressed protein were
incubated for 10 min at 37°C. In the gel analysis of the tRNA
addition products (see Fig. 4), the reaction mixtures were the same
except that the volume was reduced to 20 µl. The PAP assay was done
as described previously (39). The protein extracts were
diluted in a solution containing 10 mM Tris-HCl (pH 7.5), 500 mM NaCl,
5% glycerol, 0.5% Triton X-100, 1 mM EDTA, and 1 mM dithiothreitol.
Reaction mixtures (200 µl) containing 10 mM Tris-HCl (pH 7.5), 100 mM
NaCl, 1% glycerol, 0.1% Triton X-100, 4 mM MgCl2, 200 µM ATP, 20 µCi of [-32P]ATP, 4 µg of yeast tRNA,
and 25 ng of the overexpressed protein were incubated for 15 min at
37°C.
PCR amplifications of genomic DNA with inosine-containing
oligonucleotides were done with 100 ng of B. subtilis DNA
with the oligonucleotide pair
5'GTIGGIGGI(C/G)I(A/G)TI(C/A)GIGA(T/C)3' and
5'(G/A)TTIAIIGTIA(A/G)ITCIC(G/T)IT3'. Control amplifications were done with the pET11a-pcnB plasmid and the same
oligonucleotides. The reactions (50 µl) with Tub DNA
polymerase (Amersham) were performed under the following conditions:
95°C, 30 s; 46°C, 3 min; 66°C, 40 s; 50 cycles.
| |
RESULTS |
Nucleotidyltransferase proteins in the eubacteria.
With many
genomic sequencing projects finished or in progress, extensive
comparisons among the eubacteria are now possible (Fig. 1C). Putative
Ntr proteins have already been detected in bacteria such as
Haemophilus influenzae, Acidaminococcus
fermentans, Aeromonas hydrophyla, and B. subtilis (34, 52). We found 25 more proteins in a
recent search (May 1998), and their number will surely increase as more
genomes are completed. Table 1 summarizes the protein sequences detected in this search. All of these homologues share a conserved amino-terminal domain containing motifs that are
characteristic of the Ntr protein family (34, 52). For the
gram-negative organisms in the and subdivisions of the purple
bacteria, which include E. coli, two Ntr proteins were predicted. As indicated in Table 1, it was possible to classify the
predicted proteins as either a PAP or tRNA nucleotidyltransferase (noted as CCA in Table 2) by comparison with the E. coli
homologues. The alignment of these two groups of proteins is shown in
Fig. 2. The remainder of the proteins
identified in Table 1 cannot be reliably classified by sequence
alignment. This is illustrated in Fig. 2, where the B. subtilis Ntr protein sequence is aligned with the tRNA
nucleotidyltransferase and PAP homologues. The colored boxes indicate
the conserved amino acids. There are 28 residues conserved between the
B. subtilis homologue and the tRNA nucleotidyltransferases, 37 residues in common with the PAPs, and 55 residues in common with
both groups of proteins. The somewhat-better alignment with the PAPs
led to the prediction that this protein is a PAP, and its gene was
named papS (29).
View larger version (133K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence alignment of the tRNA nucleotidyltransferase
(CCA) and PAP I (PAP) homologues from members of the and subdivisions of the purple bacteria (E. col, E. coli; A. hyd, A. hydrophila; A. act, Actinobacillus actinomycetemcomitans; H. inf, H. influenzae; P. aer,
Pseudomonas aeruginosa; N. gon, Neisseria
gonorrhoeae; N. nem, Neisseria meningitidis)
with the related protein from B. subtilis (B. sub). The initial alignment was made with CLUSTAL (24,
25), and small realignments were made manually. The colored boxes
indicate the positions of conserved amino acids of the CCA-adding
family (blue), the PAP I family (pink), and both families (yellow). The
asterisks show the conserved G-D-D-D residues that are the signature of
the X polymerase family. The protein motifs used to design the
degenerate inosine-containing oligonucleotides are underlined. The
numbers in parentheses represent amino acids not shown in the
alignment, and dashes represent gaps in the alignment.
|
|
Characterization of the B. subtilis papS gene.
B.
subtilis, a distant relative of E. coli, is a
gram-positive organism that has been extensively studied. Because we
were interested in characterizing PAP I-like enzymes, the
papS gene was amplified by PCR and cloned, and the protein
was expressed in E. coli. Using the genomic sequence, we
chose the longest open reading frame, which begins with a methionine
and encodes a protein of 403 amino acids. In the same manner, we cloned
and expressed the E. coli CCA-adding enzyme, which, together
with E. coli PAP I, served as a control for the following
experiments. The overexpressed B. subtilis PapS protein
migrated on SDS-polyacrylamide gels at the expected molecular mass of
45 kDa (Fig. 3A, lane 5). It was somewhat
smaller than the E. coli PAP I, which migrates as a 50-kDa protein (Fig. 3A, lane 3). Figure 3B, a Western blot with an antibody against E. coli PAP I, shows the expected reaction with
overexpressed PAP I (lane 3). In Fig. 3B, lanes 1 and 4, the protein
that is somewhat smaller than the overexpressed PAP I is the endogenous E. coli PAP I that is processed by removing 17 amino acids
from its amino terminus (7, 39). The faintly detected
protein in Fig. 3B, lane 2, which is slightly larger than the
overexpressed PAP I, is the B. subtilis protein that
cross-reacts with the PAP I antibody (39). Note that PapS
(Fig. 3B, lane 5), like the E. coli CCAase (Fig. 3B, lane
4), does not cross-react with the PAP I antibody, and it is smaller
than the B. subtilis protein (Fig. 3B, lane 2). Thus, the
papS gene product characterized here does not appear to be
related to the B. subtilis protein that cross-reacts with
the antibody against E. coli PAP I.
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Expression and Western blot analysis of the B. subtilis PapS protein. Proteins were separated by
SDS-polyacrylamide gel electrophoresis, and the gel was stained with
Coomassie blue (A) or analyzed by Western blotting with the E. coli PAP I antibody (B). Lanes 1 and 2, E. coli and
B. subtilis total proteins. Lanes 3 to 5, extracts of PAP I,
E. coli tRNA nucleotidyltransferase, and B. subtilis PapS, respectively, were loaded to give similar amounts
of each of the overexpressed proteins (see Materials and Methods). The
dots in lanes 3 to 5 indicate the positions of the overexpressed
proteins. The arrows in lanes 2 show the positions of a B. subtilis protein that cross-reacts with the PAP I antibody.
|
|
The activity of overexpressed PapS was measured under different assay
conditions to discriminate between tRNA CCA addition
and PAP activity.
E. coli PAP I has detectable activity under
both neutral and
basic conditions (pHs 9 to 10), whereas the tRNA
CCA-adding enzyme is
only active under basic conditions (our data
and reference
15). In these assays, either crude yeast tRNA,
which
contains molecules missing part or all of the CCA terminus,
or poly(A)
was used as the acceptor. The results shown in Table
2 indicate that the
B. subtilis
papS gene product has the same
properties as the
E. coli tRNA nucleotidyltransferase, with a
comparable specific
activity (published values for the
E. coli enzyme range from
1,000 to 8,000 U/mg, depending on the preparation
[
14]). Like the
E. coli CCA-adding enzyme,
PapS adds AMP or
CMP specifically to the tRNA acceptor, and it has no
detectable
activity under the polyadenylation assay conditions. As
expected,
PAP I, which is active under both assay conditions, only adds
AMP and can use tRNA or poly(A) as an acceptor.
In Fig.
4, the products of the reaction
under the CCA assay conditions with yeast tRNA and either
[
-
32P]ATP (Fig.
4A) or [
-
32P]CTP
(Fig.
4B) were characterized by electrophoresis on a denaturing
polyacrylamide gel.
E. coli PAP I (Fig.
4, lanes 1)
elongated
the tRNA, adding at least 400 AMP residues (Fig.
4A), but it
is
unable to incorporate CMP (Fig.
4B). Figure
4, lanes 2, contains
a
control mock preparation from cells without protein overexpression.
Figure
4, lanes 3 and 4, shows the CCA-adding activity of the
E. coli and
B. subtilis enzymes, respectively. The
molecules in
the yeast tRNA population are extended to CCA (Fig.
4A) or
to
C and CC (Fig.
4B). The background in the high-molecular-weight
regions of all the lanes in Fig.
4B is specific to the
[
-
32P]CTP label. The radiolabeled tRNA population in
Fig.
4, lanes
3 and 4, is heterogeneous due to the size distribution of
the
yeast tRNAs (72 to 95 nucleotides [
46]).
Comparable profiles
were observed when crude wheat germ tRNA was
employed to characterize
the CCA-adding enzyme from
Sulfolobus
shibatae (
52). In all
the data shown in Table
2 and
Fig.
4, the activity of the
B. subtilis PapS protein is
indistinguishable from that of the
E. coli tRNA
nucleotidyltransferase. Thus, we conclude that PapS
is a tRNA
CCA-adding enzyme.
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
Polyacrylamide gel analysis of products under CCA assay
conditions with yeast tRNA as the acceptor and
[-32P]ATP (A) or [-32P]CTP (B) as the
substrate. Lanes: 1, E. coli PAP I; 2, protein extract from
BL21(DE3) with the pET11a expression vector; 3, E. coli tRNA
nucleotidyltransferase; 4, B. subtilis PapS.
|
|
Is there another gene encoding an Ntr protein in B. subtilis?
The B. subtilis genome apparently
contains only one gene encoding an Ntr protein, which we have now
identified as a CCA-adding enzyme. However, a second gene may have been
missed because of an error in the genomic sequence. About 4,200 genes
have been identified in B. subtilis, and it has been
estimated that another 100 to 200 genes will be identified as the
genomic sequence is corrected (29). We tried two approaches
to identify a second gene. First, we screened a 
GT11 expression
library, derived from B. subtilis (47), using our
antibody against E. coli PAP I. Over 80,000 plaques were
examined, but we failed to detect a protein clearly related to E. coli PAP I. In a second approach, we used a pair of
inosine-containing oligonucleotides designed to hybridize to the
regions encoding two highly conserved protein motifs in the eubacterial
Ntr proteins (Fig. 2). Pilot experiments demonstrated that these
primers could amplify DNA fragments of the correct size with templates
containing the cloned E. coli pcnB or cca genes.
In Fig. 5, a 260-bp DNA fragment
amplified from the B. subtilis genomic DNA (lane 1), which
was slightly smaller than the 290-bp DNA fragment from the cloned
E. coli pcnB gene (lane 2), was detected. The genomic PCR
product had the size predicted for the known B. subtilis
papS gene, and restriction digestion confirmed this identification
(data not shown). Under the PCR conditions employed here, several
products of 450 bp or larger were detected due to the hybridization of
the degenerate oligonucleotides to nonspecific sites. These products
are too large to correspond to an Ntr coding sequence. Thus, we could
not detect another gene by this method.
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
PCR amplification of the papS gene from
B. subtilis genomic DNA with degenerate inosine-containing
oligonucleotides designed to bind to DNA encoding two of the most
highly conserved motifs in the eubacterial Ntr protein family (Fig. 2).
Lane 1, B. subtilis genomic DNA; lane 2, cloned E. coli pcnB gene (in pET11a).
|
|
| |
DISCUSSION |
Our antiserum against E. coli PAP I was previously
shown to detect proteins in several other gram-negative bacteria:
Yersinia pseudotuberculosis, Erwinia carotovora,
P. mirabilis, and D. gigas (39). We
also detected a related protein in B. subtilis, a member of
the low-G+C gram-positive family of bacteria (Fig. 1C). By Western
blotting, the B. subtilis protein, with a mass of 55 kDa, reacted weakly with the antibody against E. coli PAP I,
requiring a 10-fold-longer exposure for detection by chemiluminescence
(39). The 45-kDa protein characterized here, which is the
B. subtilis tRNA nucleotidyltransferase, does not react with
the antibody against E. coli PAP I. The apparent lack of a
PAP I homologue in B. subtilis suggests that the weak signal
detected with the antibody against E. coli PAP I is due to a
cross-reaction with an unrelated protein.
The genome of Mycobacterium tuberculosis, another
gram-positive bacterium, has recently been completely sequenced, and
like that of B. subtilis, it contains a single gene encoding
a putative Ntr protein (Table 1). We have expressed and characterized
the closely related protein from Mycobacterium leprae and
found that it is also a tRNA nucleotidyltransferase (unpublished
results). The finding that B. subtilis and M. tuberculosis each contain a single gene encoding a CCA-adding
enzyme suggests that PAP I is either an ancient enzyme which has been
lost in certain bacteria or that it a new enzyme in the purple bacteria
arising from a recent duplication of the tRNA nucleotidyltransferase
gene. It should be feasible to distinguish between these two
possibilities when there is more information about the distribution of
the CCA-adding and PAP I-like enzymes among the eubacteria.
Most of our understanding of RNA processing and degradation in the
eubacteria comes from the study of E. coli. Of the proteins predicted by genomic sequencing, B. subtilis lacks RNase E,
an endonuclease known to be important in E. coli rRNA
processing and mRNA decay. Nevertheless, an RNase E-like activity has
been suggested based on the study of the endonucleolytic processing of
a tRNA synthetase message (10). When the tRNA synthetase gene from B. subtilis was transferred and expressed in
E. coli, the message was processed at the same sites as in
B. subtilis in an RNase E-dependent reaction. It was also
correctly processed in vitro with purified RNase E. A related
observation is that two PAP activities, suggested to be similar to
E. coli PAP I and PAP II, have been described in B. subtilis (42). Thus, the failure to detect clearly
discernible RNase E and PAP homologues in B. subtilis is
unexpected, raising the possibility that these activities reside in
proteins distinct from their counterparts in gram-negative bacteria.
| |
ACKNOWLEDGMENTS |
This research was supported by the Centre National de la
Recherche Scientifique (CNRS), with additional funding from the
Association pour la Recherche sur le Cancer (ARC). L.C.R. is a
predoctoral fellow of the ARC.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Microbiologie et Génétique Moléculaire, CNRS, UPR
9007, 118, route de Narbonne, 31062 Toulouse Cedex, France. Phone:
(33.5) 61.33.58.94. Fax: (33.5) 61.33.58.86. E-mail:
Carpousi{at}ibcg.biotoul.fr.
| |
REFERENCES |
| 1.
|
Aebi, M.,
G. Kirchner,
J.-Y. Chen,
U. Vijayraghavan,
A. Jacobson,
N. C. Martin, and J. Abelson.
1990.
Isolation of a temperature-sensitive mutant with altered tRNA nucleotidyltransferase and cloning of the gene encoding tRNA nucleotidyltransferase in the yeast Saccharomyces cerevisiae.
J. Biol. Chem.
265:16216-16220[Abstract/Free Full Text].
|
| 2.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 3.
|
Ashby, M. K., and P. L. Bergquist.
1990.
Cloning and sequence of IS1000 from Thermus thermophilus HB8.
Plasmid
24:1-11[Medline].
|
| 4.
|
August, J. T.,
J. Ortiz, and J. Hurwitz.
1962.
Ribonucleic acid-dependent ribonucleotide incorporation.
J. Biol. Chem.
237:3786-3793[Free Full Text].
|
| 5.
|
Blattner, F. R., et al.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 6.
|
Cao, G.-J.,
J. Pogliano, and N. Sarkar.
1996.
Identification of the coding region for a second poly(A) polymerase in Escherichia coli.
Proc. Natl. Acad. Sci. USA
93:11580-11585[Abstract/Free Full Text].
|
| 7.
|
Cao, G.-J., and N. Sarkar.
1992.
Identification of the gene for an Escherichia coli poly(A) polymerase.
Proc. Natl. Acad. Sci. USA
89:10380-10384[Abstract/Free Full Text].
|
| 8.
|
Coburn, G. A., and G. A. Mackie.
1996.
Differential sensitivities of portions of the mRNA for ribosomal protein S20 to 3'-exonucleases dependent on oligoadenylation and RNA secondary structure.
J. Biol. Chem.
271:15776-15781[Abstract/Free Full Text].
|
| 9.
|
Colgan, D. F., and J. L. Manley.
1997.
Mechanism and regulation of mRNA polyadenylation.
Genes Dev.
11:2755-2766[Free Full Text].
|
| 10.
|
Condon, C.,
H. Putzer,
D. Luo, and M. Grunberg-Manago.
1997.
Processing of the Bacillus subtilis thrS leader mRNA is RNase E-dependent in Escherichia coli.
J. Mol. Biol.
268:235-242[Medline].
|
| 11.
|
Cudny, H.,
J. R. Lupski,
G. N. Godson, and M. P. Deutscher.
1986.
Cloning, sequencing, and species relatedness of the Escherichia coli cca gene encoding the enzyme tRNA nucleotidyltransferase.
J. Biol. Chem.
261:6444-6449[Abstract/Free Full Text].
|
| 12.
|
Deckert, G., et al.
1998.
The complete genome of the hyperthermophilic bacterium Aquifex aeolicus.
Nature
392:353-358[Medline].
|
| 13.
|
Dedonder, R. A.,
J. Lepesant,
J. Lepesant-Kejzlarova,
A. Billault,
M. Steinmetz, and F. Kunst.
1977.
Construction of a kit of reference strains for rapid genetic mapping in Bacillus subtilis.
Appl. Env. Microbiol.
33:989-993[Abstract/Free Full Text].
|
| 14.
|
Deutscher, M. P.
1982.
tRNA nucleotidyltransferase, p. 183-215.
In
P. D. Boyer (ed.), The enzymes, 3rd ed., vol. 15. Academic Press, New York, N.Y.
|
| 15.
|
Deutscher, M. P.
1990.
Transfer RNA nucleotidyltransferase.
Methods Enzymol.
181:434-439[Medline].
|
| 16.
|
Deutscher, M. P.,
J. Foulds, and W. H. McClain.
1974.
Transfer ribonucleic acid nucleotidyl-transferase plays an essential role in the normal growth of Escherichia coli and in the biosynthesis of some bacteriophage T4 transfer ribonucleic acids.
J. Biol. Chem.
249:6696-6699[Abstract/Free Full Text].
|
| 17.
|
Fleischmann, R. D., et al.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae.
Science
269:496-512[Abstract/Free Full Text].
|
| 18.
|
Fraser, C. M., et al.
1997.
Genomic sequence of a lyme disease spirochaete, Borrelia burgdorferi.
Nature
390:539-586[Medline].
|
| 19.
|
Fsihi, H.,
E. De Rossi,
L. Salazar,
R. Cantoni,
M. Labo,
G. Riccardi,
H. E. Akiff,
K. Eiglmeier,
S. Bergh, and S. T. Cole.
1996.
Gene arrangement and organization in an approximately 76 kb fragment encompassing the oriC region of the chromosome of Mycobacterium leprae.
Microbiology
142:3147-3161[Abstract/Free Full Text].
|
| 20.
|
Gesteland, R. F.
1966.
Isolation and characterization of ribonuclease I mutants of Escherichia coli.
J. Mol. Biol.
16:67-84[Medline].
|
| 21.
|
Hajnsdorf, E.,
F. Braun,
J. Haugel-Nielsen, and P. Regnier.
1995.
Polyadenylation destabilizes the rpsO mRNA of Escherichia coli.
Proc. Natl. Acad. Sci. USA
92:3973-3977[Abstract/Free Full Text].
|
| 22.
|
Haugel-Nielsen, J.,
E. Hajnsdorf, and P. Regnier.
1996.
The rpsO mRNA of Escherichia coli is polyadenylated at multiple sites resulting from endonucleolytic processing and exonucleolytic degradation.
EMBO J.
15:3144-3152[Medline].
|
| 23.
|
He, L.,
F. Söderbom,
E. Gerhart,
H. Wagner,
U. Binnie,
N. Binns, and M. Masters.
1993.
PcnB is required for the rapid degradation of RNAI, the antisense RNA that controls the copy number of ColE1 related plasmids.
Mol. Microbiol.
9:1131-1142[Medline].
|
| 24.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.
Gene
73:237-244[Medline].
|
| 25.
|
Higgins, D. G., and P. M. Sharp.
1989.
Fast and sensitive multiple sequence alignment on a microcomputer.
Comput. Appl. Biosci.
5:151-153[Abstract/Free Full Text].
|
| 26.
|
Jahagirdar, R., and S. P. Howard.
1994.
Isolation and characterization of a second exe operon required for extracellular protein secretion in Aeromonas hydrophila.
J. Bacteriol.
176:6819-6826[Abstract/Free Full Text].
|
| 27.
|
Kalapos, M. P.,
G.-J. Cao,
S. R. Kushner, and N. Sarkar.
1994.
Identification of a second poly(A) polymerase in Escherichia coli.
Biochem. Biophys. Res. Commun.
198:459-465[Medline].
|
| 28.
| Kaneko, T., et al. 1996. Sequence analysis of the
genome of the unicellular cyanobacterium Synechocystis sp.
strain PCC6803. II. Sequence determination of the entire genome and
assignment of potential protein-coding regions. DNA Res.
3(Suppl.):109-136.
|
| 29.
|
Kunst, F., et al.
1997.
The complete genome sequence of the Gram-positive bacterium B. subtilis.
Nature
390:249-256[Medline].
|
| 30.
|
Liu, J. D., and J. S. Parkinson.
1989.
Genetics and sequence analysis of the pcnB locus, an Escherichia coli gene involved in plasmid copy number control.
J. Bacteriol.
171:1254-1261[Abstract/Free Full Text].
|
| 31.
|
Lopilato, J.,
S. Bortner, and J. Beckwith.
1986.
Mutations in a new chromosomal gene of Escherichia coli K-12, pcnB, reduce plasmid copy number of pBR322 and its derivatives.
Mol. Gen. Genet.
205:285-290[Medline].
|
| 32.
|
Mack, M.,
K. Bendrat,
O. Zelder,
E. Eckel,
D. Linder, and W. Buckel.
1994.
Location of the two genes encoding glutaconate coenzyme A-transferase at the beginning of the hydroxyglutarate operon in Acidaminococcus fermentans.
Eur. J. Biochem.
226:41-51[Medline].
|
| 33.
|
March, J. B.,
M. D. Collom,
D. Hart-Davis,
I. R. Oliver, and M. Master.
1989.
Cloning and characterization of an Escherichia coli gene, pcnB, affecting plasmid copy number.
Mol. Microbiol.
3:903-910[Medline].
|
| 34.
|
Martin, G., and W. Keller.
1996.
Mutational analysis of mammalian poly(A) polymerase identifies a region for primer binding and a catalytic domain, homologous to the family X polymerases, and to other nucleotidyltransferases.
EMBO J.
15:2593-2603[Medline].
|
| 35.
|
Masters, M.,
J. B. March,
I. R. Oliver, and J. F. Collins.
1990.
A possible role for the pcnB gene product of Escherichia coli in modulating RNA:RNA interactions.
Mol. Gen. Genet.
220:341-344[Medline].
|
| 36.
|
Mikkelsen, N. D., and K. Gerdes.
1997.
Sok antisense RNA from plasmid R1 is functionally inactivated by RNase E and polyadenylated by poly(A) polymerase I.
Mol. Microbiol.
26:311-320[Medline].
|
| 37.
|
O'Hara, E. B.,
J. A. Chekanova,
C. A. Ingle,
Z. R. Kushner,
E. Peters, and S. R. Kushner.
1995.
Polyadenylation helps regulate mRNA decay in Escherichia coli.
Proc. Natl. Acad. Sci. USA
92:1807-1811[Abstract/Free Full Text].
|
| 38.
|
Olsen, G. J.,
C. R. Woese, and R. Overbeek.
1994.
The wind of (evolutionary) change: breathing new life into microbiology.
J. Bacteriol.
176:1-3[Free Full Text].
|
| 39.
|
Raynal, L. C.,
H. M. Krisch, and A. J. Carpousis.
1996.
Bacterial poly(A) polymerase: an enzyme that modulates RNA stability.
Biochimie
78:390-398[Medline].
|
| 39a.
| Raynal, L. C., and A. J. Carpousis.
Unpublished data.
|
| 40.
|
Reuven, N. B.,
Z. Zhou, and M. P. Deutscher.
1997.
Functional overlap of tRNA nucleotidyltransferase, poly(A) polymerase I, and polynucleotide phosphorylase.
J. Biol. Chem.
272:33255-33259[Abstract/Free Full Text].
|
| 41.
|
Sachs, A. B.,
P. Sarnow, and M. W. Hentze.
1997.
Starting at the beginning, middle, and end: translation initiation in eukaryotes.
Cell
89:831-838[Medline].
|
| 42.
|
Sarkar, B.,
G. J. Cao, and N. Sarkar.
1997.
Identification of two poly(A) polymerases in B. subtilis.
Biochem. Mol. Biol. Int.
41:1045-1050[Medline].
|
| 43.
|
Sarkar, N.
1996.
Polyadenylation of mRNA in bacteria.
Microbiology
12:3125-3133.
|
| 44.
|
Sarkar, N.
1997.
Polyadenylation of mRNA in prokaryotes.
Annu. Rev. Biochem.
66:173-197[Medline].
|
| 45.
|
Söderbom, F.,
U. Binnie,
M. Masters, and E. G. H. Wagner.
1997.
Regulation of plasmid R1 replication: PcnB and RNase E expedite the decay of the antisense RNA, copA.
Mol. Microbiol.
26:493-504[Medline].
|
| 46.
|
Söll, D.
1993.
Transfer RNA: an RNA for all seasons, p. 157-184.
In
R. F. Gesteland, and J. F. Atkins (ed.), The RNA world. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 47.
|
Suh, J.-W.,
S. A. Boylan, and C. W. Price.
1986.
Gene for the alpha subunit of B. subtilis RNA polymerase maps in the ribosomal protein gene cluster.
J. Bacteriol.
168:65-71[Abstract/Free Full Text].
|
| 48.
|
Tomb, J. F., et al.
1997.
The complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature
388:539-547[Medline].
|
| 49.
|
Wickens, M.,
P. Anderson, and R. J. Jackson.
1997.
Life and death in the cytoplasm: messages from the 3' end.
Curr. Opin. Genet. Dev.
7:220-232[Medline].
|
| 50.
|
Xu, F., and S. N. Cohen.
1995.
RNA degradation in Escherichia coli regulated by 3' adenylation and 5' phosphorylation.
Nature
374:180-183[Medline].
|
| 51.
|
Xu, F.,
S. Lin-Chao, and S. N. Cohen.
1993.
The Escherichia coli pcnB gene promotes adenylation of antisense RNA I of ColE1-type plasmids in vivo and degradation of RNA I decay intermediates.
Proc. Natl. Acad. Sci. USA
90:6756-6760[Abstract/Free Full Text].
|
| 52.
|
Yue, D.,
N. Maizels, and A. M. Weiner.
1996.
CCA-adding enzymes and poly(A) polymerases are all members of the same nucleotidyltransferase superfamily: characterisation of the hyperthermophile Sulfolobus shibatae.
RNA
2:895-908[Abstract].
|
| 53.
|
Zhu, L., and P. M. Deutscher.
1987.
tRNA nucleotidyltransferase is not essential for Escherichia coli viability.
EMBO J.
6:2473-2477[Medline].
|
Journal of Bacteriology, December 1998, p. 6276-6282, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Just, A., Butter, F., Trenkmann, M., Heitkam, T., Morl, M., Betat, H.
(2008). A comparative analysis of two conserved motifs in bacterial poly(A) polymerase and CCA-adding enzyme. Nucleic Acids Res
36: 5212-5220
[Abstract]
[Full Text]
-
Neuenfeldt, A., Just, A., Betat, H., Morl, M.
(2008). Evolution of tRNA nucleotidyltransferases: A small deletion generated CC-adding enzymes. Proc. Natl. Acad. Sci. USA
105: 7953-7958
[Abstract]
[Full Text]
-
Joanny, G., Derout, J. L., Brechemier-Baey, D., Labas, V., Vinh, J., Regnier, P., Hajnsdorf, E.
(2007). Polyadenylation of a functional mRNA controls gene expression in Escherichia coli. Nucleic Acids Res
35: 2494-2502
[Abstract]
[Full Text]
-
Bralley, P., Gust, B., Chang, S., Chater, K. F., Jones, G. H.
(2006). RNA 3'-tail synthesis in Streptomyces: in vitro and in vivo activities of RNase PH, the SCO3896 gene product and polynucleotide phosphorylase.. Microbiology
152: 627-636
[Abstract]
[Full Text]
-
Bralley, P., Chang, S. A., Jones, G. H.
(2005). A Phylogeny of Bacterial RNA Nucleotidyltransferases: Bacillus halodurans Contains Two tRNA Nucleotidyltransferases. J. Bacteriol.
187: 5927-5936
[Abstract]
[Full Text]
-
Campos-Guillen, J., Bralley, P., Jones, G. H., Bechhofer, D. H., Olmedo-Alvarez, G.
(2005). Addition of Poly(A) and Heteropolymeric 3' Ends in Bacillus subtilis Wild-Type and Polynucleotide Phosphorylase-Deficient Strains. J. Bacteriol.
187: 4698-4706
[Abstract]
[Full Text]
-
Cho, H. D., Verlinde, C. L., Weiner, A. M.
(2005). Archaeal CCA-adding Enzymes: CENTRAL ROLE OF A HIGHLY CONSERVED {beta}-TURN MOTIF IN RNA POLYMERIZATION WITHOUT TRANSLOCATION. J. Biol. Chem.
280: 9555-9566
[Abstract]
[Full Text]
-
Levinger, L., Morl, M., Florentz, C.
(2004). Mitochondrial tRNA 3' end metabolism and human disease. Nucleic Acids Res
32: 5430-5441
[Abstract]
[Full Text]
-
MARTIN, G., KELLER, W.
(2004). Sequence motifs that distinguish ATP(CTP):tRNA nucleotidyl transferases from eubacterial poly(A) polymerases. RNA
10: 899-906
[Abstract]
[Full Text]
-
Sohlberg, B., Huang, J., Cohen, S. N.
(2003). The Streptomyces coelicolor Polynucleotide Phosphorylase Homologue, and Not the Putative Poly(A) Polymerase, Can Polyadenylate RNA. J. Bacteriol.
185: 7273-7278
[Abstract]
[Full Text]
-
Condon, C.
(2003). RNA Processing and Degradation in Bacillus subtilis. Microbiol. Mol. Biol. Rev.
67: 157-174
[Abstract]
[Full Text]
-
Rott, R., Zipor, G., Portnoy, V., Liveanu, V., Schuster, G.
(2003). RNA Polyadenylation and Degradation in Cyanobacteria Are Similar to the Chloroplast but Different from Escherichia coli. J. Biol. Chem.
278: 15771-15777
[Abstract]
[Full Text]
-
Tomita, K., Weiner, A. M.
(2002). Closely Related CC- and A-adding Enzymes Collaborate to Construct and Repair the 3'-Terminal CCA of tRNA in Synechocystis sp. and Deinococcus radiodurans. J. Biol. Chem.
277: 48192-48198
[Abstract]
[Full Text]
-
Bralley, P., Jones, G. H.
(2002). cDNA cloning confirms the polyadenylation of RNA decay intermediates in Streptomyces coelicolor. Microbiology
148: 1421-1425
[Abstract]
[Full Text]
-
Yehudai-Resheff, S., Hirsh, M., Schuster, G.
(2001). Polynucleotide Phosphorylase Functions as Both an Exonuclease and a Poly(A) Polymerase in Spinach Chloroplasts. Mol. Cell. Biol.
21: 5408-5416
[Abstract]
[Full Text]
-
Williams, M. A., Johzuka, Y., Mulligan, R. M.
(2000). Addition of non-genomically encoded nucleotides to the 3'-terminus of maize mitochondrial mRNAs: truncated rps12 mRNAs frequently terminate with CCA. Nucleic Acids Res
28: 4444-4451
[Abstract]
[Full Text]
-
Yehudai-Resheff, S., Schuster, G.
(2000). Characterization of the E.coli poly(A) polymerase: nucleotide specificity, RNA-binding affinities and RNA structure dependence. Nucleic Acids Res
28: 1139-1144
[Abstract]
[Full Text]
Top
Abstract
Introduction
