Journal of Bacteriology, December 1998, p. 6316-6324, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
andDepartment of Genetics, University of Georgia, Athens, Georgia 30602,1 and Millennium Pharmaceuticals Inc., Cambridge, Massachusetts 02139-48152
Received 17 July 1998/Accepted 2 September 1998
| |
ABSTRACT |
|---|
|
|
|---|
Readily utilizable sugars down-regulate virulence gene expression
in Listeria monocytogenes, which has led to the proposal that this regulation may be an aspect of global catabolite regulation (CR). We recently demonstrated that the metabolic enzyme
-glucosidase is under CR in L. monocytogenes. Here, we
report the cloning and characterization from L. monocytogenes of an apparent ortholog of ccpA, which
encodes an important mediator of CR in several low-G+C-content
gram-positive bacteria. L. monocytogenes ccpA (ccpALm) is predicted to encode a
335-amino-acid protein with nearly 65% identity to the gene product of
Bacillus subtilis ccpA (ccpABs).
Southern blot analysis with a probe derived from
ccpALm revealed a single strongly hybridizing
band and also a second band of much lower intensity, suggesting that
there may be other closely related sequences in the L. monocytogenes chromosome, as is the case in B. subtilis. Disruption of ccpALm resulted
in the inability of the mutant to grow on glucose-containing minimal medium or increase its growth rate in the presence of preferred sugars,
and it completely eliminated CR of
-glucosidase activity in liquid
medium. However,
-glucosidase activity was only partially relieved
from CR on solid medium. These results suggest that ccpA is
an important element of carbon source regulation in L. monocytogenes. Nevertheless, utilizable sugars still
down-regulate the expression of hly, which encodes the
virulence factor hemolysin, in a ccpALm mutant,
indicating that CcpA is not involved in carbon source regulation of
virulence genes.
| |
INTRODUCTION |
|---|
|
|
|---|
When the gram-positive, facultative intracellular human pathogen Listeria monocytogenes is grown in the presence of utilizable sugars, expression of its virulence genes is down-regulated (37, 44). However, sugars do not affect the level of the PrfA protein, the positive regulator of virulence determinants in L. monocytogenes. Based on these results, Milenbachs et al. proposed that regulation of virulence genes by sugars may represent an aspect of global catabolite control and could occur by modifying the activity of PrfA (37). This is consistent with the observation that a mutation in PrfA results in the deregulated expression of hly in the presence of utilizable sugars and other environmental factors (3, 5, 46). There is some evidence that PrfA requires an additional factor(s) (called PrfA-associated factor or Paf) for full activity in vivo (12, 46). Paf activity is present not only in pathogenic Listeria species, but also in the nonpathogenic soil organism Bacillus subtilis (4). Ripio et al. proposed a model in which environmental signals regulate PrfA-dependent virulence gene expression by altering the level or activity of Paf, thereby controlling the activation state of PrfA (46). The presence of Paf activity in both Bacillus and Listeria species implies that Paf has cellular roles other than regulation of virulence gene expression and could be subject to more general global regulatory controls, like catabolite regulation (CR), in response to environmental signals that modulate the activity of genes not necessarily involved in virulence.
In addition to its important role in the utilization of carbon sources, CR is known to influence diverse aspects of cell physiology in both gram-positive and gram-negative bacteria (15, 48, 49). Expression of virulence factors in several pathogenic bacteria (7, 35, 57) and important developmental processes like the initiation of sporulation in B. subtilis (15, 52) are under CR. However, the primary mechanisms that mediate CR in gram-negative and gram-positive bacteria are quite different. In gram-negative bacteria two global mechanisms of CR are known. The best-characterized mechanism involves the positive regulator cyclic AMP receptor protein (CRP) and its regulatory ligand cyclic AMP (10). The other mechanism is mediated by the catabolite repressor/activator (Cra) protein, which was initially characterized as the fructose repressor, FruR, in gram-negative enteric bacteria (43). In the low-G+C-content gram-positive bacteria, the predominant mechanism of CR involves transcriptional repression mediated by the catabolite control protein A (CcpA), a DNA-binding protein that belongs to the LacI-GalR family of transcription regulators (18, 22). A cis-acting element, called catabolite responsive element or CRE, has been identified in genes under CcpA regulation. CRE is a 14-bp region of dyad symmetry with the consensus sequence TG(A/T)NANCGNTN(A/T)CA, where N is A, G, C, or T (59). Specific binding of CcpA to CRE has been demonstrated by gel mobility shift assays and DNase footprinting analysis, strongly suggesting that CcpA exerts its effect on gene expression by its binding to CRE (16, 27-29). A key role in CR is also played by HPr, one of the components of the phosphoenolpyruvate:sugar phosphotransferase (PTS) sugar uptake system. HPr can be phosphorylated at the Ser-46 residue by an ATP-dependent HPr kinase. HPr(ser-P), but not free HPr, can bind to CcpA in vitro, and this interaction is dependent on high concentrations of fructose-1,6-bisphosphate (FBP), one of the intermediates of the glycolytic pathway (11, 27). Thus, the following model for CR in low-G+C-content gram-positive bacteria has been proposed: glucose or other rapidly metabolized sugars generate metabolic intermediates like FBP via the glycolytic pathway, metabolic intermediates activate the ATP-dependent HPr kinase that phosphorylates HPr at Ser-46, HPr(Ser-46) forms a complex with FBP and CcpA, and the complex binds to CRE in catabolite-repressed genes and blocks transcription initiation by RNA polymerase (22).
Since ccpA homologs have also been identified and characterized in Bacillus megaterium (24), Staphylococcus xylosus (13), Lactobacillus pentosus (34), and Lactobacillus casei (39), it appears that CcpA-mediated CR is a common theme in many low-G+C-content gram-positive bacteria. Disruption of the ccpA gene has pleiotropic effects on cell growth and enzyme regulation, as evidenced by the relief of sugar repression of several enzymes, slow growth rates on preferred carbon sources, and poor growth on minimal medium (MM) (18, 22). Nevertheless, considerable evidence points towards the existence of other mechanisms of CR in low-G+C-content gram-positive bacteria. In S. xylosus, CR of the activities of several enzymes mediated by glucose kinase has been demonstrated (58). In B. subtilis, a homolog of CcpA called CcpB can mediate CR when cells are grown on solid medium or in liquid medium without vigorous agitation (10). In B. subtilis, the regulation of the levanase operon is mediated both by CcpA-HPr and by a second independent pathway (36). In Streptococcus mutans, disruption of regM, a gene with homology to ccpA of other bacteria, paradoxically increases repression of several catabolite-controlled enzyme activities instead of relieving it (55). Thus, important differences in mechanisms of CR exist among low-G+C-content gram-positive bacteria, underscoring the importance of studying this phenomenon in bacteria other than B. subtilis.
To address the hypothesis that central pathways of CR might
mediate carbon source regulation of virulence genes in
L. monocytogenes, we sought first to establish whether
a homolog of ccpA exists and is responsible for
regulating glucose repression of catabolic enzymes. We show here that a
ccpA homolog is present in L. monocytogenes. Moreover, we demonstrate that a ccpALm mutant
recapitulates the same range of phenotypes observed in a
ccpABs mutant, including growth impairment on
glucose-containing MM and abrogation of CR for the glucose-repressed
enzyme
-glucosidase. Nevertheless, we observed no detectable effect
on glucose repression of hly expression in the
ccpALm mutant. Thus, if global pathways of CR influence the regulation of virulence genes in L. monocytogenes, they must do so through a mechanism that does not
involve ccpA.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and growth conditions.
Escherichia
coli DH5
mcr[
80dlacZ
M15
recA1 endA1 gyrA96 thi-1 hsdR17
(rK
mK+) supE44
relA1 deoR
(lacZYA-argF)U169
mcr] (Gibco BRL) was used for all cloning. L. monocytogenes strains were grown on brain heart infusion (BHI)
(Difco Laboratories, Detroit, Mich.) or Luria-Bertani (LB) medium.
Cultures grown in LB medium were buffered with 100 mM
3-(N-morpholino)propane-sulfonic acid (MOPS) (pH 7.0 or
7.4). Ampicillin was used at a concentration of 100 µg/ml, and
chloramphenicol and neomycin were each used at 5 µg/ml. The MM used
was a modification of the Listeria minimal medium
described previously (42) and contained 100 mM MOPS (pH
7.4), 4.82 mM KH2PO4, 11.55 mM
Na2HPO4, 1.7 mM MgSO4, 1% (55 mM)
glucose, 1 µg of thiamine/ml, 0.5 µg of riboflavin/ml, 0.5 µg of
biotin/ml, 0.005 µg of thioctic acid/ml, and 0.1 mg each of leucine,
isoleucine, valine, methionine, arginine, cysteine, and glutamine per
ml. Sugar supplements were added to cultures or plates at a final
concentration of 25 mM.
Amplification of the ccpALm gene by PCR. The degenerate primers CcpA-01R (5' GARGCNAAYGTNWSIATGGC 3'; based on the amino acid sequence EANVSMA from the B. subtilis CcpA protein, GenBank accession no. 143024) and CcpA-04L (5' CKCATNGCIACNGCNCC 3'; based on the amino acid sequence GAVAMR) were used to amplify the putative ccpALm homolog. Ambiguity codes are as follows: R represents A or G, Y represents T or C, N represents G, A, T, or C, W represents A or T, S represents C or G, and K represents G or T. PCR amplification was carried out as described previously (25).
Construction of pCON1-CCPA and disruption of the ccpALm gene. A 615-bp internal ccpALm fragment was PCR amplified from chromosomal DNA with the primers CcpA-05R (5' GTACGGATCCAAGATATTGCGA 3') and CcpA-06L (5' GCATGAATTCTGTATTGTTGCTTGT 3'). Incorporation of two mismatched bases in the primers (CC in GGATCC and the G and C in GAATTC) resulted in BamHI and EcoRI recognition sites (underlined) in CcpA-05R and CcpA-06L, respectively. The purified PCR product was digested with the two enzymes, ligated to similarly digested and purified pCON1 plasmid DNA (3), and transformed into E. coli with selection for ampicillin resistance. The resultant plasmid, pCON1-CCPA, was then transformed into the E. coli conjugation donor strain S17-1 and conjugated into L. monocytogenes 10403S as previously described (1). pCON1-CCPA, which has the temperature-sensitive origin of replication from plasmid pE194ts, was integrated into the L. monocytogenes chromosome by shifting an early-log-phase culture growing at the permissive temperature (30°C) to the nonpermissive temperature (41°C) for 3 h. The culture was diluted appropriately and plated onto BHI plates containing 5 µg of chloramphenicol/ml at 41°C. Integration of the vector at the ccpALm locus in this strain was confirmed by PCR amplification with primers flanking the cloned region followed by sequencing of the amplified product. The ccpALm mutant was named JB15 (10403S ccpA::pCON1).
To rescue sequences upstream of the insertion of pCON1-CCPA, chromosomal DNA was prepared from JB15 and digested to completion with XbaI, an enzyme that recognizes a sequence within the polylinker of pCON1-CCPA. After heat inactivation of the enzyme, the digested DNA was diluted, added to a ligation reaction mixture to favor self-ligation of DNA molecules, and transformed into E. coli. Plasmid DNA isolated from transformants was screened by restriction analysis, and the sequence of the rescued region was determined. Sequence from downstream of the pCON1-CCPA insertion was determined by sequencing of PCR products amplified by nested PCR with specific upstream primers based on the ccpALm sequence and random downstream primers. The sequence of the entire ccpALm coding region was then determined by directly sequencing the PCR products on both strands.Transduction of hly-gus-neo cassette into JB15.
The hly-gus-neo cassette was introduced into JB15 by
transduction from AML73 (3) by using the L. monocytogenes bacteriophage LMUP35 (20). One hundred
microliters of phage dilution in TM buffer (10 mM Tris-HCl [pH 7.5],
10 mM MgSO4) was mixed with an equal volume of
mid-logarithmic-phase culture of AML73 and incubated at room
temperature for 40 min. Molten LB soft agar (3 ml) containing 10 mM
MgSO4 and 10 mM CaCl2 was then added to each
tube, and the mixture was poured over a plate of LB agar (containing 10 mM MgSO4 and 10 mM CaCl2) and incubated
overnight at room temperature. Phages were recovered the next day by
adding 5 ml of sterile TM buffer to the plates and leaving them
overnight at room temperature. Phage stocks were sterilized by passing
them through a 0.2-µm-pore-size filter, and their titers were
determined. For transduction into JB15, 1 ml of culture (at a
concentration of 108 CFU/ml) was centrifuged and the cell
pellet was resuspended in 100 µl of BHI broth. The suspension was
mixed with 107 PFU of phage and incubated at room
temperature for 40 min. Molten BHI soft agar (3 ml) containing 10 mM
sodium citrate, pH 7.5, was added to the cell-phage mix and poured onto
BHI plates containing 10 mM sodium citrate, pH 7.5, and 5 µg each of
neomycin and chloramphenicol per ml. Plates were incubated at 37°C
for 2 days, and colonies were picked onto fresh BHI-citrate plates
containing neomycin and chloramphenicol. Colonies that had acquired the
hly-gus-neo cassette were nonhemolytic on blood-agar plates,
blue on 5-bromo-4-chloro-3-indolyl-
-D-glucuronide (X-gluc) (United States Biological, Swampscott, Mass.) plates, neomycin
resistant, and chloramphenicol resistant due to the cat gene
carried on pCON1 inserted at the ccpALm locus.
DNA sequencing and analysis.
DNA sequencing was carried out
by the method of Sanger et al. (51) by using the
fmol thermal cycling sequencing system (Promega Corporation, Madison,
Wis.). Custom-synthesized oligonucleotides were purchased either
from DNAgency, Aston, Pa., or the University of Georgia Molecular
Genetics Instrumentation Facility and end labeled with
[
-32P]ATP (Amersham, Arlington Heights,
Ill.). Sequencing reactions were carried out on both strands of PCR
products amplified from the L. monocytogenes
chromosomal DNA. Protein and DNA sequences were analyzed with the
MacVector software program (Kodak Scientific Imaging Systems, New
Haven, Conn.) and the GCG software package (Genetics Computer Group,
Madison, Wis.).
DNA preparation and Southern blot analysis. Isolation of chromosomal DNA and Southern blot analysis were performed by standard techniques (50). A 615-bp internal ccpALm fragment to be used as the probe was amplified by PCR from chromosomal DNA, labeled with [32P]dCTP with a Prime-a-Gene labeling kit (Promega), and purified with a Sephadex G-50 quick spin column (Boehringer Mannheim, Indianapolis, Ind.). Hybridization was carried out overnight at 55°C, after which the membrane was washed three times with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 0.1% sodium dodecyl sulfate (SDS) at room temperature and three times with 1× SSC and 0.1% SDS at 37°C and placed against a PhosphorImager screen.
-Glucosidase and
-glucuronidase assays.
-Glucosidase activity was assayed as described previously
(8).
-Glucuronidase activity was assayed in samples
collected from cultures that were 1 h into stationary phase as
described previously (26). The specific activities of both
enzymes are expressed as nanomoles of p-nitrophenol formed
per minute per milligram of total protein. Protein concentration was
measured by the modified method of Bradford (6), using the
Bio-Rad protein assay reagent with bovine serum albumin as the standard.
Nucleotide sequence accession number. The ccpA sequence from L. monocytogenes 10403S has been deposited in the GenBank database and assigned the accession no. AF076520.
| |
RESULTS |
|---|
|
|
|---|
Identification and cloning of ccpA from L. monocytogenes. Based on sequences of CcpA homologs available in the GenBank database, degenerate PCR primers were designed to amplify possible homologs of ccpA from L. monocytogenes chromosomal DNA. Several primer pairs were tested. A band approximately 0.9 kb in size was obtained with the primer pair CcpA-01R and CcpA-04L (see Materials and Methods). The PCR product was purified and sequenced. An incomplete open reading frame (ORF) with base composition including 37.7% G+C content was identified. This value is consistent with the overall G+C content of 37 to 39% reported earlier for L. monocytogenes chromosomal DNA (47). A search of the GenBank database revealed over 60% identity of the translated sequence of the ORF with the CcpA proteins from B. subtilis and B. megaterium, suggesting that the product was derived from a true homolog of the ccpABs gene.
To confirm that the PCR-amplified fragment was from the chromosome of L. monocytogenes, we amplified a 615-bp fragment with the L. monocytogenes-specific primers CcpA-05R and CcpA-06L, labeled the fragment with [32P]dCTP, and used it as a probe in Southern blot analysis of chromosomal digests prepared with six different restriction enzymes. The probe consistently hybridized strongly with a single DNA band in each lane, indicating that a putative ccpALm homolog had been amplified and was not a contaminant. Interestingly, a low-stringency Southern blotting revealed a second band, of much lower intensity, in each lane, indicating the presence of another sequence closely related to the ccpALm sequence (Fig. 1). These data are consistent with results reported for B. subtilis, in which additional ccpA-like genes are known to exist (9).
|
|
Sequence analysis of the ccpALm gene.
Nucleotide sequence analysis of the ccpALm locus
revealed a 1,005-bp ORF, with a putative start codon (ATG) at
position 178 (Fig. 3A) and stop codon
at position 1179. A putative ribosome binding site, GGAGAG, is located
9 bp upstream of the apparent initiation codon. A putative
10
sequence, TAAAAT, with one difference from the canonical
10 sequence, is centered 27 nucleotides upstream of the putative
start codon. The cognate
35 sequence, TTTACA, containing one mismatch with the consensus
35 sequence, is 17 bp upstream of the
10 sequence. Interestingly, a sequence resembling that of CRE is located 47 bp upstream of the putative start codon, partially overlapping the putative
35 sequence. The CRE-like sequence
matches the consensus CRE sequence proposed by Weickert and Chambliss
(59) at 13 of 14 positions (Fig. 3B). A potential rho-independent transcription terminator was identified 247 bp downstream from the ccpALm stop codon.
|
|
Growth characteristics of the ccpALm mutant. The effect of ccpA disruption on growth characteristics was studied by comparing the growth of the ccpALm mutant JB15 with that of the parental wild-type strain 10403S on glucose-containing MM plates. The plates were incubated at 30°C, since even the wild-type strain was found to grow poorly at 37°C on solid medium and not at all in liquid MM (20). After 4 days of growth at 30°C, JB15 grew very poorly on MM plates compared to 10403S (Fig. 5A). On the other hand, JB15 grew well on the rich medium, BHI agar (Fig. 5B).
|
CR of
-glucosidase in the ccpALm
mutant.
We showed recently that activity of the metabolic
enzyme
-glucosidase in L. monocytogenes is inducible
by maltose and subject to catabolite control in the presence of the
repressing sugars glucose, fructose, and cellobiose (3).
Egeter et al. have demonstrated that
-glucosidase activity is
relieved from CR in an S. xylosus ccpA mutant
(13). To test if the regulation of this enzyme in L. monocytogenes was also mediated by ccpA,
we assayed
-glucosidase activity in JB15 and 10403S. For 10403S,
the addition of either glucose, fructose, or cellobiose at a
concentration of 25 mM to LB medium containing 25 mM maltose resulted
in more than a fourfold decrease in
-glucosidase activity (Fig.
6). For JB15, while
-glucosidase activity was slightly lower than that of 10403S in LB medium containing maltose, almost complete derepression was observed in the presence of
repressing sugars. Thus, these results strongly suggest that ccpALm mediates CR of
-glucosidase in liquid
medium. We also constructed a strain, JB178, in which pCON1 was
integrated into the L. monocytogenes 10403S chromosome
immediately downstream of the ccpA coding region. Growth
characteristics and
-glucosidase regulation of JB178 were found to
be similar to those of the wild-type strain (data not shown). We
conclude from these results that the phenotype of JB15 is manifested
due to disruption of ccpA and not because of a polar effect
on downstream genes.
|
-D-glucoside
(5-bromo-4-chloro-3-indolyl-
-D-glucopyranoside) to assay
-glucosidase activity on plates. Both the 10403S and the
JB15 spots were blue on LB agar containing 25 mM maltose and 100 µg
of X-
-D-glucoside/ml, indicating full expression of
-glucosidase (data not shown). When 25 mM glucose was incorporated
in the medium, the 10403S spot was white; this result was expected due
to the repression of
-glucosidase activity by glucose.
Interestingly, JB15 was neither completely white (like the wild-type
strain) nor as blue as in the absence of glucose, suggesting that
-glucosidase was only partially relieved from CR on solid medium in
this strain (data not shown).
Disruption of ccpALm does not affect carbon
source regulation of hly-gus.
Several laboratories have
shown that the presence of utilizable sugars in the medium results in
downregulation of virulence genes in L. monocytogenes
(37, 41, 44). We carefully examined the quantitative effects
of various sugars on hly expression using AML73. This strain
has the hly promoter fused to the gusA gene from
E. coli, allowing colorimetric measurement of
hly promoter activity (3). As shown in Fig.
7A, a correlation exists between how well
a sugar stimulates growth and its extent of negative regulation of
hly-gus expression. Sugars such as glucose, fructose, and
cellobiose, which result in significant decreases in doubling times
when added to LB medium at a concentration of 25 mM, also result in the
most severe repression of hly-gus expression. Other sugars
decrease doubling times only slightly (maltose) or not at all
(trehalose). However, maltose and trehalose are clearly utilized
by L. monocytogenes, as evidenced by the
increase in final cell densities reached after 10 h of growth
(Fig. 7A). Maltose and trehalose affect hly-gus expression
significantly less (3- to 5-fold decrease in doubling times) than
glucose, fructose, or cellobiose (10- to 25-fold decrease in doubling
times). Sucrose and galactose are not utilized by L. monocytogenes and do not regulate hly-gus
expression. Similar results were also obtained on plate
assays with X-gluc
(5-bromo-4-chloro-3-indolyl-
-D-glucuronide) used
as a chromogenic substrate (data not shown).
|
-glucosidase, we wondered whether the mutation
would also relieve the carbon source regulation of hly-gus.
We used the L. monocytogenes phage LMUP35 to transduce
the hly-gus-neo cassette from AML73 to JB15 (resulting in
the strain JB153). We then assayed
-glucuronidase activity in
JB153. While there was a 35% decrease in the level of expression of
hly-gus in strain JB153 compared to that in AML73, the
relative extent of down-regulation by sugars was not affected in this
strain (Fig. 7B). Therefore, we conclude from these data that CcpA does
not mediate carbon source regulation of virulence genes in
L. monocytogenes.
| |
DISCUSSION |
|---|
|
|
|---|
In this communication, we report the identification, cloning, and characterization of a ccpA homolog from L. monocytogenes. The deduced amino acid sequence encoded by the gene was found to have a high degree of similarity to that of B. subtilis CcpA, with perfect conservation of the residues constituting the helix-turn-helix domain. Disruption of ccpALm resulted in pleiotropic effects on cell growth and regulation, which is indicative of the important role CcpA plays in CR in this organism. However, ccpALm does not appear to mediate carbon source regulation of hly-gus, suggesting that other, as yet unidentified, factors are involved in down-regulating virulence genes in L. monocytogenes in the presence of utilizable sugars.
Sequence analysis of the region upstream of ccpALm revealed an ORF encoding a putative protein with approximately 68% identity with the B. subtilis aroA gene product (GenBank accession no. X65945) (2). The aroA gene encodes 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase and is located upstream of ccpA in both B. subtilis and S. xylosus (accession no. X95439) (13). Immediately downstream from ccpA in B. subtilis and B. megaterium are two ORFs which show significant homology to the flagellar motor proteins from E. coli, motA and motB. Although the functions of these genes are not known, mutations disrupting them do not affect either motility or CR (18, 24). The genetic arrangement in S. xylosus, Streptococcus mutans, and L. casei appears to be different, since these organisms do not contain the two downstream ORFs (13, 39, 55). Our results indicate that L. monocytogenes also lacks these sequences, since we did not find any ORF in the sequenced region extending 300 bp downstream of ccpALm. Northern hybridization analysis did not reveal any ccpALm transcript longer than 1.4 kb. Furthermore, JB178, in which pCON1 is integrated into the chromosome immediately downstream of ccpA, had the wild-type phenotype. Therefore, ccpALm appears to be monocistronic, and the phenotype of JB15 is due to the disruption of ccpA and not a gene downstream of it.
Regulation of ccpA expression has been studied in several organisms. Its expression appears to be constitutive in B. subtilis (18), B. megaterium (24), and L. casei (39). However, in S. xylosus, there are two promoters upstream of ccpA (13). Transcription from one of these promoters is repressed when cultures are grown in the presence of glucose. This regulation is dependent on CcpA itself, since it is abolished in a ccpA mutant. Interestingly, there is a CRE-like sequence found just upstream of the ribosome-binding site of the S. xylosus ccpA gene, indicating that this autogenous regulatory loop may be affected by CcpA binding to its own promoter. We have identified a CRE-like sequence that has a single mismatch with the CRE consensus sequence proposed by Hueck et al. (23) located 47 bp upstream of the putative ccpALm start codon. Therefore, the interesting possibility exists that ccpALm expression may also be autoregulated.
Studies with B. subtilis have indicated that the intracellular signal linking carbon source availability and CcpA-mediated regulation may be HPr(Ser-P) (seryl-phosphorylated form of HPr) and that this interaction may be stimulated by one of the intermediates of the glycolytic pathway, fructose 1,6-bisphosphate (11). In L. monocytogenes, a fructose-specific PTS uptake system (of which HPr is one of the components) has been demonstrated biochemically (38). Recently, the sequence of L. monocytogenes ptsH (encoding HPr) and the partial sequence of ptsI (encoding enzyme I, another PTS component) have been deposited in the GenBank database (accession number AF030824). Therefore, our results demonstrating the role of CcpA in CR in L. monocytogenes raise the strong possibility that CcpA-HPr-dependent global CR may be operative in this organism.
While CcpA-HPr-mediated control is certainly an important global
regulatory pathway, mounting evidence suggests that it is not the only
mechanism responsible for CR in B. subtilis and other low-G+C-content gram-positive organisms (30, 31, 36, 53). Moreover, it was shown recently that disruption of regM, a
ccpA homolog in S. mutans, not only had no
effect on CR of several enzymes but also paradoxically increased their
repression by sugars (55). It is also becoming apparent that
other factors may interact with CcpA and/or HPr. Chauvaux et al.
recently demonstrated that on solid medium and in cultures
incubated with little agitation, a homolog of
ccpABs, ccpB, interacts with
HPr(Ser-P) and mediates CR of gnt and xyl
operons along with CcpA (9). However, when cultures were
incubated with vigorous agitation, CcpA alone seemed to be sufficient
for CR. When we tested the regulation of the ccpALm mutant on plates, we too found that
glucose repression of
-glucosidase was only partially relieved. This
observation makes it very likely that additional factors are involved
in
-glucosidase regulation in L. monocytogenes. The
result is also intriguing since low-stringency Southern blotting
demonstrated two bands that hybridized to a
ccpALm probe, suggesting that there is at least
one sequence closely related to ccpA in the L. monocytogenes chromosome. It is tempting to speculate that this
sequence might be a ccpB homolog, since CcpA and CcpB have
about 30% amino acid identity in B. subtilis
(9).
In several bacterial pathogens, including L. monocytogenes, virulence genes are clustered on discrete regions of the chromosome referred to as pathogenicity islands (33). This finding suggests that bacterial pathogens evolved from related nonpathogenic species by acquiring contiguous blocks of DNA containing virulence genes (14). When the expression of genes acquired by horizontal transfer is regulated in response to environmental factors for which a broader regulatory mechanism already exists, it is to be expected that regulation of the acquired genes will employ or adapt to existing mechanisms. For example, in Salmonella species, regulation of the virulence operon spv is controlled not only by the plasmid-encoded virulence factor, SpvR, but also by the CRP-cyclic AMP complex, the global catabolite regulator (40). Similarly, in Vibrio cholerae, the expression of cholera toxin and toxin-coregulated pilus is also regulated by CRP-cyclic AMP (56). It is not to be expected that an independent mechanism of catabolite control would be reinvented for the specific purpose of modulating the expression of the PrfA-controlled regulon in L. monocytogenes. Therefore, it was surprising that disruption of ccpALm had a significant effect on growth and catabolite control but not on sugar regulation of virulence genes. Since expression of hly is not controlled by CcpA, one possibility is that its expression is under regulation of another catabolite control pathway in L. monocytogenes that remains to be defined. Another possibility is that the regulator of virulence genes, PrfA, is itself involved in sensing the presence of carbon sources. PrfA has been shown to possess structural and functional homology with the E. coli catabolite regulator, CRP (32, 54). PrfA is involved in the regulation of uptake of at least one sugar, glucose-1-phosphate (45). Furthermore, a single amino acid substitution (Gly145Ser) in the PrfA sequence makes hly-gus expression insensitive to negative control by sugars (3). Future experiments designed to test these hypotheses should yield interesting insights into this regulation.
| |
ACKNOWLEDGMENTS |
|---|
We thank David Hodgson for the generous gift of phage LMUP35 and for advice on transduction and preparation of minimal medium. We are grateful to David Brown, Janet Hatt, Andrea Milenbachs, and Paul Fawcett for helpful discussions and technical advice throughout this study. We thank Sidney Kushner, Caroline Ingle, and Bijoy Mohanty for advice on RNA preparation and Northern blot analysis. Additionally, we thank Kathy Spindler and Tad Seyler for helpful comments on the manuscript.
This work was supported by Public Health Service grant GM35495 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Millennium Pharmaceuticals Inc., 640 Memorial Dr., Cambridge, MA 02139-4815. Phone: (617) 761-6816. Fax: (617) 374-9379. E-mail: Youngman{at}mpi.com.
Present address: Infectious Disease Division, Massachusetts General
Hospital, Boston, MA 02114.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Barak, I., J. Behari, G. Olmedo, P. Guzman, D. P. Brown, E. Castro, D. Walker, J. Westpheling, and P. Youngman. 1996. Structure and function of the Bacillus SpoIIE protein and its localization to sites of sporulation septum assembly. Mol. Microbiol. 19:1047-1060[Medline]. |
| 2. | Behari, J., and P. Youngman. Unpublished data. |
| 3. |
Behari, J., and P. Youngman.
1998.
Regulation of hly expression in Listeria monocytogenes by carbon sources and pH occurs through separate mechanisms mediated by PrfA.
Infect. Immun.
66:3635-3642 |
| 4. | Bockmann, R., C. Dickneite, B. Middendorf, W. Goebel, and Z. Sokolovic. 1996. Specific binding of the Listeria monocytogenes transcriptional regulator PrfA to target sequences requires additional factor(s) and is influenced by iron. Mol. Microbiol. 22:643-653[Medline]. |
| 5. | Bohne, J., H. Kestler, C. Uebele, Z. Sokolovic, and W. Goebel. 1996. Differential regulation of the virulence genes of Listeria monocytogenes by the transcriptional activator PrfA. Mol. Microbiol. 20:1189-1198[Medline]. |
| 6. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline]. |
| 7. | Busque, P., A. Letellier, J. Harel, and J. D. Dubreuil. 1995. Production of Escherichia coli STb enterotoxin is subject to catabolite repression. Microbiology 141:1621-1627[Abstract]. |
| 8. |
Chasin, L. A., and B. Magasanik.
1968.
Induction and repression of the histidine-degrading enzymes of Bacillus subtilis.
J. Biol. Chem.
243:5165-5178 |
| 9. |
Chauvaux, S.,
I. T. Paulsen, and M. Saier, Jr.
1998.
CcpB, a novel transcription factor implicated in catabolite repression in Bacillus subtilis.
J. Bacteriol.
180:491-497 |
| 10. | Crasnier, M. 1996. Cyclic AMP and catabolite repression. Res. Microbiol. 147:479-482[Medline]. |
| 11. | Deutscher, J., E. Kuster, U. Bergstedt, V. Charrier, and W. Hillen. 1995. Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in Gram-positive bacteria. Mol. Microbiol. 15:1049-1053[Medline]. |
| 12. | Dickneite, C., R. Bockmann, A. Spory, W. Goebel, and Z. Sokolovic. 1998. Differential interaction of the transcription factor PrfA and the PrfA-activating factor (Paf) of Listeria monocytogenes with target sequences. Mol. Microbiol. 27:915-928[Medline]. |
| 13. | Egeter, O., and R. Bruckner. 1996. Catabolite repression mediated by the catabolite control protein CcpA in Staphylococcus xylosus. Mol. Microbiol. 21:739-749[Medline]. |
| 14. | Finlay, B. B., and S. Falkow. 1997. Common themes in microbial pathogenicity revisited. Microbiol. Mol. Biol. Rev. 61:136-169[Abstract]. |
| 15. | Fisher, S. H., and A. Sonenshein. 1991. Control of carbon and nitrogen metabolism in Bacillus subtilis. Annu. Rev. Microbiol. 45:107-135[Medline]. |
| 16. | Fujita, Y., Y. Miwa, A. Galinier, and J. Deutscher. 1995. Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr. Mol. Microbiol. 17:953-960[Medline]. |
| 17. | Grundy, F. J., D. A. Waters, T. Y. Takova, and T. M. Henkin. 1993. Identification of genes involved in utilization of acetate and acetoin in Bacillus subtilis. Mol. Microbiol. 10:259-271[Medline]. |
| 18. | Henkin, T. M. 1996. The role of CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis. FEMS Microbiol. Lett. 135:9-15[Medline]. |
| 19. | Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Champliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli Lacl and GalR repressors. Mol. Microbiol. 5:575-584[Medline]. |
| 20. | Hodgson, D. A. Personal communication. |
| 21. | Hueck, C., A. Kraus, and W. Hillen. 1994. Sequences of ccpA and two downstream Bacillus megaterium genes with homology to the motAB operon from Bacillus subtilis. Gene 143:147-148[Medline]. |
| 22. | Hueck, C. J., and W. Hillen. 1995. Catabolite repression in Bacillus subtilis: a global regulatory mechanism for the Gram-positive bacteria? Mol. Microbiol. 15:395-401[Medline]. |
| 23. | Hueck, C. J., W. Hillen, and M. Saier, Jr. 1994. Analysis of a cis-acting sequence mediating catabolite repression in Gram-positive bacteria. Res. Microbiol. 145:503-518[Medline]. |
| 24. | Hueck, C. J., A. Kraus, D. Schmiedel, and W. Hillen. 1995. Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium. Mol. Microbiol. 16:855-864[Medline]. |
| 25. | Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. 1990. PCR protocols. A guide to methods and applications. Academic Press, Inc., San Diego, Calif. |
| 26. |
Jefferson, R. A.,
S. M. Burgess, and D. Hirsh.
1986.
-Glucuronidase from Escherichia coli as a gene-fusion marker.
Proc. Natl. Acad. Sci. USA
83:8447-8451 |
| 27. |
Jones, B. E.,
V. Dossonnet,
E. Kuster,
W. Hillen,
J. Deutscher, and R. E. Klevit.
1997.
Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr.
J. Biol. Chem.
272:26530-26535 |
| 28. |
Kim, J. H., and G. H. Chambliss.
1997.
Contacts between Bacillus subtilis catabolite regulatory protein CcpA and amyO target site.
Nucleic Acids Res.
25:3490-3496 |
| 29. |
Kim, J. H.,
Z. T. Guvener,
J. Y. Cho,
K. C. Chung, and G. H. Chambliss.
1995.
Specificity of DNA binding activity of the Bacillus subtilis catabolite control protein CcpA.
J. Bacteriol.
177:5129-5134 |
| 30. |
Kraus, A.,
C. Hueck,
D. Gartner, and W. Hillen.
1994.
Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts additional xylR-dependent repression.
J. Bacteriol.
176:1738-1745 |
| 31. |
Kruger, S.,
S. Gertz, and M. Hecker.
1996.
Transcriptional analysis of bglPH expression in Bacillus subtilis: evidence for two distinct pathways mediating carbon catabolite repression.
J. Bacteriol.
178:2637-2644 |
| 32. | Lampidis, R., R. Gross, Z. Sokolovic, W. Goebel, and J. Kreft. 1994. The virulence regulator protein of Listeria ivanovii is highly homologous to PrfA from Listeria monocytogenes and both belong to the Crp-Fnr family of transcription regulators. Mol. Microbiol. 13:141-151[Medline]. |
| 33. | Lee, C. A. 1996. Pathogenicity islands and the evolution of bacterial pathogens. Infect. Agents Dis. 5:1-7[Medline]. |
| 34. |
Likman, B. C.,
M. Heerikhuisen,
R. J. Leer,
A van den Broek,
Y. Borsboom,
S. Chaillou,
P. W. Postma, and P. H. Pauwels.
1997.
Regulation of expression of the Lactobacillus pentosus xylAB operon.
J. Bacteriol.
179:5391-5397 |
| 35. |
Martinez-Cadena, M. G.,
L. M. Guzman-Verduzco,
H. Stieglitz, and Y. M. Kupersztoch-Portnoy.
1981.
Catabolite repression of Escherichia coli heat-stable enterotoxin activity.
J. Bacteriol.
145:722-728 |
| 36. |
Martin-Verstraete, I.,
J. Stulke,
A. Klier, and G. Rapoport.
1995.
Two different mechanisms mediate catabolite repression of the Bacillus subtilis levanase operon.
J. Bacteriol.
177:6919-6927 |
| 37. | Milenbachs, A. A., D. P. Brown, M. Moors, and P. Youngman. 1997. Carbon-source regulation of virulence gene expression in Listeria monocytogenes. Mol. Microbiol. 23:1075-1085[Medline]. |
| 38. |
Mitchell, W. J.,
J. Reizer,
C. Herring,
C. Hoischen, and M. Saier, Jr.
1993.
Identification of a phosphoenolpyruvate:fructose phosphotransferase system (fructose-1-phosphate forming) in Listeria monocytogenes.
J. Bacteriol.
175:2758-2761 |
| 39. |
Monedero, V.,
M. J. Gosalbes, and G. Perez-Martinez.
1997.
Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA.
J. Bacteriol.
179:6657-6664 |
| 40. |
O'Byrne, C. P., and C. J. Dorman.
1994.
The spv virulence operon of Salmonella typhimurium LT2 is regulated negatively by the cyclic AMP (cAMP)-cAMP receptor protein system.
J. Bacteriol.
176:905-912 |
| 41. | Park, S. F., and R. G. Kroll. 1993. Expression of listeriolysin and phosphatidylinositol-specific phospholipase C is repressed by the plant-derived molecule cellobiose in Listeria monocytogenes. Mol. Microbiol. 8:653-661[Medline]. |
| 42. |
Premaratne, R. J.,
W. J. Lin, and E. A. Johnson.
1991.
Development of an improved chemically defined minimal medium for Listeria monocytogenes.
Appl. Environ. Microbiol.
57:3046-3048 |
| 43. | Ramseier, T. M. 1996. Cra and the control of carbon flux via metabolic pathways. Res. Microbiol. 147:489-493[Medline]. |
| 44. | Renzoni, A., A. Klarsfeld, S. Dramsi, and P. Cossart. 1997. Evidence that PrfA, the pleiotropic activator of virulence genes in Listeria monocytogenes, can be present but inactive. Infect. Immun. 65:1515-1518[Abstract]. |
| 45. |
Ripio, M. T.,
K. Brehm,
M. Lara,
M. Suarez, and J. A. Vazquez-Boland.
1997.
Glucose-1-phosphate utilization by Listeria monocytogenes is PrfA dependent and coordinately expressed with virulence factors.
J. Bacteriol.
179:7174-7180 |
| 46. |
Ripio, M. T.,
G. Dominguez-Bernal,
M. Lara,
M. Suarez, and J. A. Vazquez-Boland.
1997.
A Gly145Ser substitution in the transcriptional activator PrfA causes constitutive overexpression of virulence factors in Listeria monocytogenes.
J. Bacteriol.
179:1533-1540 |
| 47. | Rocourt, J., and P. A. D. Grimont. 1983. Listeria welshimeri sp. nov. and Listeria seeligeri sp. nov. Int. J. Sys. Bacteriol. 33:866-869. |
| 48. | Saier, M., Jr. 1996. Cyclic AMP-independent catabolite repression in bacteria. FEMS Microbiol. Lett. 138:97-103[Medline]. |
| 49. | Saier, M., Jr., S. Chauvaus, G. M. Cook, J. Deutscher, I. T. Paulsen, J. Reizer, and J. J. Ye. 1996. Catabolite repression and inducer control in Gram-positive bacteria. Microbiology 142:217-230[Abstract]. |
| 50. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 51. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 52. |
Schaeffer, P.,
J. Millet, and J.-P. Aubert.
1965.
Catabolite repression of bacterial sporulation.
Proc. Natl. Acad. Sci. USA
54:704-711 |
| 53. |
Schonert, S.,
T. Buder, and M. K. Dahl.
1998.
Identification and enzymatic characterization of the maltose-inducible -glucosidase MalL (sucrase-isomaltase-maltase) of Bacillus subtilis.
J. Bacteriol.
180:2574-2578 |
| 54. | Sheehan, B., A. Klarsfeld, R. Ebright, and P. Cossart. 1996. A single substitution in the putative helix-turn-helix motif of the pleiotropic activator PrfA attenuates Listeria monocytogenes virulence. Mol. Microbiol. 20:785-797[Medline]. |
| 55. |
Simpson, C. L., and R. R. Russell.
1998.
Identification of a homolog of CcpA catabolic repressor protein in Streptococcus mutans.
Infect. Immun.
66:2085-2092 |
| 56. |
Skorupski, K., and R. K. Taylor.
1997.
Cyclic AMP and its receptor protein negatively regulate the coordinate expression of cholera toxin and toxin-coregulated pilus in Vibrio cholerae.
Proc. Natl. Acad. Sci. USA
94:265-270 |
| 57. | Smith, J. L., M. M. Bencivengo, and C. A. Kunsch. 1986. Enterotoxin A synthesis in Staphylococcus aureus: inhibition by glycerol and maltose. J. Gen. Microbiol. 132:3375-3380[Medline]. |
| 58. |
Wagner, E.,
S. Marcandier,
O. Egeter,
J. Deutscher,
F. Gotz, and R. Bruckner.
1995.
Glucose kinase-dependent catabolite repression in Staphylococcus xylosus.
J. Bacteriol.
177:6144-6152 |
| 59. |
Weickert, M. J., and G. H. Chambliss.
1990.
Site-directed mutagenesis of a catabolite repression operator sequence in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
87:6238-6242 |
This article has been cited by other articles:
| ||||||||||||||||