This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nichols, B. P.
Right arrow Articles by Meiners, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nichols, B. P.
Right arrow Articles by Meiners, V.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 1998, p. 6408-6411, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Sequence Analysis of Tn10 Insertion Sites in a Collection of Escherichia coli Strains Used for Genetic Mapping and Strain Construction

Brian P. Nichols,* Obaid Shafiq, and Victoria Meiners

Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, Chicago, Illinois 60607

Received 26 May 1998/Accepted 1 October 1998

    ABSTRACT
Top
Abstract
Text
References

The chromosomal insertion sites of Tn10-containing Escherichia coli strains were amplified by inverse PCR, and the nucleotide sequences of the junctions were determined. In 95 strains analyzed, 88 unique Tn10 positions were determined and matched to the E. coli chromosome sequence. Two gaps in insertion site positions were noted, one including the terminus of DNA replication and another bounded by recombination hot spots RhsA and RhsB.

    TEXT
Top
Abstract
Text
References

A collection of Escherichia coli strains with Tn10 insertions located at approximately 1-min intervals around the chromosome was reported in 1989 (12) and has been used in many laboratories for strain construction and genetic mapping. The versatility of this collection of strains is based on its regularity of map positions around the chromosome and its combination of Tn10 and positionally equivalent Tn10kan members. To clarify an occasional inconsistency in map position in certain members of the collection in our laboratory, we developed an inverse PCR scheme to allow determination of the precise positions of the Tn10 insertion sites by DNA sequence analysis. We have determined the nucleotide positions of nearly all of the Tn10 insertion sites in the collection of strains originally reported by Singer et al. (12) and subsequently catalogued by Berlyn et al. (2).

Strains used in this study were obtained either from the Carol Gross laboratory or from the E. coli Genetic Stock Center. DNA preparations were done by a modification of standard methods (10, 13). Cells from 5 ml of an overnight culture grown in Luria broth-tetracycline (10 µg/ml) were harvested by centrifugation and resuspended in 2.5 ml of lysis solution (25 mM Tris-HCl [pH 7.4], 50 mM glucose, 10 mM EDTA, 2-µg/ml lysozyme). Cells were lysed by the addition of 0.25 ml of 10% sodium dodecyl sulfate, and DNA was extracted once with an equal volume of phenol saturated with 0.3 M sodium acetate (NaOAc). The aqueous phase was retained and made 0.3 M in NaOAc by addition of 0.1 volume of 3 M NaOAc, and DNA was precipitated by addition of 2.5 volumes of ethanol. The precipitate was transferred to 0.5 ml of 70% ethanol by using a Pasteur pipette. Following a brief centrifugation (30 s at 13,000 × g), the supernatant was removed and the DNA was resuspended in 0.25 ml of 10 mM Tris-HCl (pH 7.4)-0.1 mM EDTA. Chromosomal DNA was digested with HpaII and circularized with DNA ligase preparatory to inverse PCR (8).

Inverse PCR was performed as described by Ochman et al. (8) by using Platinum Taq DNA Polymerase (Life Technologies). The PCR primers (Integrated DNA Technologies) were designed from the Tn10 sequence (5, 7, 9, 11) and are illustrated in Fig. 1. The product of the first PCR using primers 1 and 2 was diluted 1/10, and 1 µl was used as the template for a second round of PCR using primers 3 and 4. The sequences of the primers were as follows: primer 1, ACATGAAGGTCATCGATAGCAGGA; primer 2, GGCTGTTGAGTTGAGGTTGACGAA; primer 3, AACAGTAATGGGCCAATAACACCG; primer 4, CGAGTTCGCACATCTTGTTGTCTG.


View larger version (12K):
[in this window]
[in a new window]
  		FIG. 1.   Map of a portion of Tn10 including tetA and IS10R. Open reading frames (orfs) are indicated, as are the positions of the PCR primers (pris) used in this study. The single HpaII site in this region is also shown.

PCR products were sequenced by using a PCR sequencing kit (Amersham). The sequencing primer was a 19-mer situated at positions -62 to -53 relative to the end of IS10R. Twenty- to 40-nucleotide-long sequences at the junction of IS10R were determined, and the positions were identified by a BLAST search (1) of the E. coli genome sequence (3).

Of 95 strains analyzed, 88 yielded sufficient sequences for confident definition of positions on the E. coli chromosome (Table 1 and Fig. 2). Two strains (CAG18463 and CAG12099) yielded short sequences that occurred twice in the genome sequence, once within 0.5 min of the reported map position and once distant. The site near the reported map position was taken as the site of insertion for these strains. The sequence derived from the junction of CAG18491 was very short, but inspection of the sequence near metE showed only two identities, one in the metR-metE intergenic region and one downstream from the metE coding region. We presumed that the intergenic insertion was more likely to yield a metE phenotype and placed the insertion site at that position. One additional sequence (from CAG18429 zjh-6::Tn10) was too short for unambiguous assignment, and no phenotype was available to assist in placement. The remaining five strains yielded sequences identical to others in the collection. These duplicate strains were CAG12074 = CAG18465, CAG12159 = CAG18459 = CAG12151, CAG18483 = CAG12080, CAG18498 = CAG18499, and CAG18709 = CAG18456. Each duplicate sequence was confirmed by analysis of strains obtained from the E. coli Genetic Stock Center.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Locations of Tn10 insertion sites


View larger version (52K):
[in this window]
[in a new window]
  		FIG. 2.   Positions of Tn10 insertions on the E. coli map. Shown for each strain are its designation, the gene or open reading frame disrupted by the insertion, and the base pair position. Numbering on the inside of the circle is in minutes. ig, intergenic.

Eleven of the Tn10 insertion sites were in intergenic regions, 51 were in coding regions of known genes, and 26 were in potential open reading frames identified by sequence analysis (3). For the majority of strains, the nucleotide positions of the Tn10 insertion site fell within 1 min of the position determined by genetic mapping. Six of the sequences differed in map position by greater than 2 min. All strains whose Tn10 positions differed from the mapped position by greater than 1.5 min were obtained from the E. coli Genetic Stock Center and reanalyzed. In most cases, there was agreement between the strains in our laboratory collection and those obtained from the E. coli Genetic Stock Center. In several cases, cross-contamination of cultures was evident. In most cases, the mixture was resolved by isolation of single colonies from the cultures. It is not clear whether the positional differences we noted were caused by culture contamination that occurred prior to the distribution of strains to this laboratory and the E. coli Genetic Stock Center or some other artifact of the original genetic analysis.

There are two noticeable gaps in this particular collection of transposon-containing strains, each about 5 min long. The gap at 33 to 38 min contains the DNA replication terminus and recombination hot spot sites dif and RhsE. The gap at 77 to 82 min is bounded by recombination hot spot sites RhsB and RhsA. Three of the strains with transposons originally mapped to these two gaps (CAG18640, CAG12163, and CAG18462) now contain the transposon at a grossly different location on the chromosome. It seems likely that the failure of the transposons to be maintained at these locations is due to the same features that have led to the characterization of these regions as "recombinationally unstable" (4, 6).

    ACKNOWLEDGMENTS

We thank Jonathan Narita, Mitchell Singer, and Mary Berlyn for advice during the course of this work.

    FOOTNOTES

* Corresponding author. Mailing address: Laboratory for Molecular Biology, Department of Biological Sciences, Molecular Biology Research Bldg. m/c 567, University of Illinois at Chicago, 900 S. Ashland Ave., Chicago, IL 60607. Phone: (312) 996-5064. Fax: (312) 413-2691. E-mail: brian.p.nichols{at}uic.edu.

    REFERENCES
Top
Abstract
Text
References

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
2. Berlyn, M. K. B., K. B. Low, K. E. Rudd, and M. Singer. 1996. Linkage map of Escherichia coli K-12, edition 9, p. 1715-1902. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schoechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella, 2nd ed., vol. 2. ASM Press, Washington, D.C.
3. Blattner, F. R., G. Plunkett III, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453-1474[Abstract/Free Full Text].
4. Corre, J., F. Cornet, J. Patte, and J. M. Louarn. 1997. Unraveling a region-specific hyper-recombination phenomenon: genetic control and modalities of terminal recombination in Escherichia coli. Genetics 147:979-989[Abstract].
5. Halling, S. M., R. W. Simons, J. C. Way, R. B. Walsh, and N. Kleckner. 1982. DNA sequence organization of IS10-right of Tn10 and comparison with IS10-left. Proc. Natl. Acad. Sci. USA 79:2608-2612[Abstract/Free Full Text].
6. Lin, R. J., M. Capage, and C. W. Hill. 1984. A repetitive DNA sequence, rhs, responsible for duplications within the Escherichia coli K-12 chromosome. J. Mol. Biol. 177:1-18[Medline].
7. Nguyen, T. T., K. Postle, and K. P. Bertrand. 1983. Sequence homology between the tetracycline-resistance determinants of Tn10 and pBR322. Gene 25:83-92[Medline].
8. Ochman, H., M. M. Medhora, D. Garza, and D. L. Hartl. 1990. Amplification of flanking sequences by inverse PCR, p. 219-227. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
9. Postle, K., T. T. Nguyen, and K. P. Bertrand. 1984. Nucleotide sequence of the repressor gene of the Tn10 tetracycline resistance determinant. Nucleic Acids Res. 12:4849-4863[Abstract/Free Full Text].
10. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
11. Schollmeier, K., and W. Hillen. 1984. Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R. J. Bacteriol. 160:499-503[Abstract/Free Full Text].
12. Singer, M., T. A. Baker, G. Schnitzler, S. M. Deischel, M. Goel, W. Dove, K. J. Jaacks, A. D. Grossman, J. W. Erickson, and C. A. Gross. 1989. Collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53:1-24[Abstract/Free Full Text].
13. Wilson, K. 1987. Preparation of genomic DNA from bacteria, p. 2.4.1-2.4.5. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York, N.Y.

Journal of Bacteriology, December 1998, p. 6408-6411, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Lestini, R., Michel, B. (2008). UvrD and UvrD252 Counteract RecQ, RecJ, and RecFOR in a rep Mutant of Escherichia coli. J. Bacteriol. 190: 5995-6001 [Abstract] [Full Text]  
  • Aguilera, L., Campos, E., Gimenez, R., Badia, J., Aguilar, J., Baldoma, L. (2008). Dual Role of LldR in Regulation of the lldPRD Operon, Involved in L-Lactate Metabolism in Escherichia coli. J. Bacteriol. 190: 2997-3005 [Abstract] [Full Text]  
  • De Lay, N. R., Cronan, J. E. (2008). Genetic Interaction Between the Escherichia coli AcpT Phosphopantetheinyl Transferase and the YejM Inner Membrane Protein. Genetics 178: 1327-1337 [Abstract] [Full Text]  
  • Massengo-Tiasse, R. P., Cronan, J. E. (2008). Vibrio cholerae FabV Defines a New Class of Enoyl-Acyl Carrier Protein Reductase. J. Biol. Chem. 283: 1308-1316 [Abstract] [Full Text]  
  • Finn, J. A., Parks, A. R., Peters, J. E. (2007). Transposon Tn7 Directs Transposition into the Genome of Filamentous Bacteriophage M13 Using the Element-Encoded TnsE Protein. J. Bacteriol. 189: 9122-9125 [Abstract] [Full Text]  
  • Prunier, A.-L., Schuch, R., Fernandez, R. E., Maurelli, A. T. (2007). Genetic Structure of the nadA and nadB Antivirulence Loci in Shigella spp.. J. Bacteriol. 189: 6482-6486 [Abstract] [Full Text]  
  • De Lay, N. R., Cronan, J. E. (2007). In Vivo Functional Analyses of the Type II Acyl Carrier Proteins of Fatty Acid Biosynthesis. J. Biol. Chem. 282: 20319-20328 [Abstract] [Full Text]  
  • Bubunenko, M., Baker, T., Court, D. L. (2007). Essentiality of Ribosomal and Transcription Antitermination Proteins Analyzed by Systematic Gene Replacement in Escherichia coli. J. Bacteriol. 189: 2844-2853 [Abstract] [Full Text]  
  • Thacker, Z., Darmon, E., Keppel, F., Masters, M. (2006). The Escherichia coli rpoS-Dependent htrC Gene Is Not Involved in the Heat Shock Response. J. Bacteriol. 188: 8317-8320 [Abstract] [Full Text]  
  • Yim, G., de la Cruz, F., Spiegelman, G. B., Davies, J. (2006). Transcription Modulation of Salmonella enterica Serovar Typhimurium Promoters by Sub-MIC Levels of Rifampin. J. Bacteriol. 188: 7988-7991 [Abstract] [Full Text]  
  • Nicoloff, H., Perreten, V., McMurry, L. M., Levy, S. B. (2006). Role for Tandem Duplication and Lon Protease in AcrAB-TolC- Dependent Multiple Antibiotic Resistance (Mar) in an Escherichia coli Mutant without Mutations in marRAB or acrRAB.. J. Bacteriol. 188: 4413-4423 [Abstract] [Full Text]  
  • Chaperon, D.-N. (2006). Construction and Complementation of In-Frame Deletions of the Essential Escherichia coli Thymidylate Kinase Gene. Appl. Environ. Microbiol. 72: 1288-1294 [Abstract] [Full Text]  
  • Froelich, J. M., Tran, K., Wall, D. (2006). A pmrA Constitutive Mutant Sensitizes Escherichia coli to Deoxycholic Acid. J. Bacteriol. 188: 1180-1183 [Abstract] [Full Text]  
  • Coros, A. M., Twiss, E., Tavakoli, N. P., Derbyshire, K. M. (2005). Genetic Evidence that GTP Is Required for Transposition of IS903 and Tn552 in Escherichia coli. J. Bacteriol. 187: 4598-4606 [Abstract] [Full Text]  
  • Buurman, E. T., McLaggan, D., Naprstek, J., Epstein, W. (2004). Multiple Paths for Nonphysiological Transport of K+ in Escherichia coli. J. Bacteriol. 186: 4238-4245 [Abstract] [Full Text]  
  • Goh, E.-B., Siino, D. F., Igo, M. M. (2004). The Escherichia coli tppB (ydgR) Gene Represents a New Class of OmpR-Regulated Genes. J. Bacteriol. 186: 4019-4024 [Abstract] [Full Text]  
  • Strauss, B., Kelly, K., Dincman, T., Ekiert, D., Biesieda, T., Song, R. (2004). Cell Death in Escherichia coli dnaE(Ts) Mutants Incubated at a Nonpermissive Temperature Is Prevented by Mutation in the cydA Gene. J. Bacteriol. 186: 2147-2155 [Abstract] [Full Text]  
  • Harinarayanan, R., Gowrishankar, J. (2004). A dnaC Mutation in Escherichia coli That Affects Copy Number of ColE1-Like Plasmids and the PriA-PriB (but Not Rep-PriC) Pathway of Chromosomal Replication Restart. Genetics 166: 1165-1176 [Abstract] [Full Text]  
  • Grompone, G., Bidnenko, V., Ehrlich, S. D., Michel, B. (2004). PriA Is Essential for Viability of the Escherichia coli Topoisomerase IV parE10(Ts) Mutant. J. Bacteriol. 186: 1197-1199 [Abstract] [Full Text]  
  • Wolfe, M. D., Ahmed, F., Lacourciere, G. M., Lauhon, C. T., Stadtman, T. C., Larson, T. J. (2004). Functional Diversity of the Rhodanese Homology Domain: THE ESCHERICHIA COLI ybbB GENE ENCODES A SELENOPHOSPHATE-DEPENDENT tRNA 2-SELENOURIDINE SYNTHASE. J. Biol. Chem. 279: 1801-1809 [Abstract] [Full Text]  
  • Lai, C.-Y., Cronan, J. E. (2003). {beta}-Ketoacyl-Acyl Carrier Protein Synthase III (FabH) Is Essential for Bacterial Fatty Acid Synthesis. J. Biol. Chem. 278: 51494-51503 [Abstract] [Full Text]  
  • Gimenez, R., Nunez, M. F., Badia, J., Aguilar, J., Baldoma, L. (2003). The Gene yjcG, Cotranscribed with the Gene acs, Encodes an Acetate Permease in Escherichia coli. J. Bacteriol. 185: 6448-6455 [Abstract] [Full Text]  
  • Suiter, A. M., Banziger, O., Dean, A. M. (2003). Fitness consequences of a regulatory polymorphism in a seasonal environment. Proc. Natl. Acad. Sci. USA 100: 12782-12786 [Abstract] [Full Text]  
  • Soupene, E., van Heeswijk, W. C., Plumbridge, J., Stewart, V., Bertenthal, D., Lee, H., Prasad, G., Paliy, O., Charernnoppakul, P., Kustu, S. (2003). Physiological Studies of Escherichia coli Strain MG1655: Growth Defects and Apparent Cross-Regulation of Gene Expression. J. Bacteriol. 185: 5611-5626 [Abstract] [Full Text]  
  • Bosling, J., Poulsen, S. M., Vester, B., Long, K. S. (2003). Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3. Antimicrob. Agents Chemother. 47: 2892-2896 [Abstract] [Full Text]  
  • Burgis, N. E., Brucker, J. J., Cunningham, R. P. (2003). Repair System for Noncanonical Purines in Escherichia coli. J. Bacteriol. 185: 3101-3110 [Abstract] [Full Text]  
  • Mori, H., Akiyama, Y., Ito, K. (2003). A SecE Mutation That Modulates SecY-SecE Translocase Assembly, Identified as a Specific Suppressor of SecY Defects. J. Bacteriol. 185: 948-956 [Abstract] [Full Text]  
  • Laurie, A. D., Bernardo, L. M. D., Sze, C. C., Skarfstad, E., Szalewska-Palasz, A., Nystrom, T., Shingler, V. (2003). The Role of the Alarmone (p)ppGpp in sigma N Competition for Core RNA Polymerase. J. Biol. Chem. 278: 1494-1503 [Abstract] [Full Text]  
  • Merlin, C., Gardiner, G., Durand, S., Masters, M. (2002). The Escherichia coli metD Locus Encodes an ABC Transporter Which Includes Abc (MetN), YaeE (MetI), and YaeC (MetQ). J. Bacteriol. 184: 5513-5517 [Abstract] [Full Text]  
  • Suzuki, K., Wang, X., Weilbacher, T., Pernestig, A.-K., Melefors, O., Georgellis, D., Babitzke, P., Romeo, T. (2002). Regulatory Circuitry of the CsrA/CsrB and BarA/UvrY Systems of Escherichia coli. J. Bacteriol. 184: 5130-5140 [Abstract] [Full Text]  
  • Sproul, A. A., Lambourne, L. T. M., D, J. J.-J., Kornberg, H. L. (2001). Genetic control of manno(fructo)kinase activity in Escherichia coli. Proc. Natl. Acad. Sci. USA 10.1073/pnas.211569798v1 [Abstract] [Full Text]  
  • Campbell, J. W., Cronan, J. E. Jr. (2001). Escherichia coli FadR Positively Regulates Transcription of the fabB Fatty Acid Biosynthetic Gene. J. Bacteriol. 183: 5982-5990 [Abstract] [Full Text]  
  • Hoffer, S. M., Schoondermark, P., van Veen, H. W., Tommassen, J. (2001). Activation by Gene Amplification of pitB, Encoding a Third Phosphate Transporter of Escherichia coli K-12. J. Bacteriol. 183: 4659-4663 [Abstract] [Full Text]  
  • Bochner, B. R., Gadzinski, P., Panomitros, E. (2001). Phenotype MicroArrays for High-Throughput Phenotypic Testing and Assay of Gene Function. Genome Res 11: 1246-1255 [Abstract] [Full Text]  
  • Ellis, H. M., Yu, D., DiTizio, T., Court, D. L. (2001). High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA 10.1073/pnas.121164898v1 [Abstract] [Full Text]  
  • Sardesai, A. A., Gowrishankar, J. (2001). trans-Acting Mutations in Loci Other than kdpDE That Affect kdp Operon Regulation in Escherichia coli: Effects of Cytoplasmic Thiol Oxidation Status and Nucleoid Protein H-NS on kdp Expression. J. Bacteriol. 183: 86-93 [Abstract] [Full Text]  
  • Kozmin, S. G., Pavlov, Y. I., Dunn, R. L., Schaaper, R. M. (2000). Hypersensitivity of Escherichia coli Delta (uvrB-bio) Mutants to 6-Hydroxylaminopurine and Other Base Analogs Is Due to a Defect in Molybdenum Cofactor Biosynthesis. J. Bacteriol. 182: 3361-3367 [Abstract] [Full Text]  
  • Monterrubio, R., Baldoma, L., Obradors, N., Aguilar, J., Badia, J. (2000). A Common Regulator for the Operons Encoding the Enzymes Involved in D-Galactarate, D-Glucarate, and D-Glycerate Utilization in Escherichia coli. J. Bacteriol. 182: 2672-2674 [Abstract] [Full Text]  
  • Hochhut, B., Marrero, J., Waldor, M. K. (2000). Mobilization of Plasmids and Chromosomal DNA Mediated by the SXT Element, a Constin Found in Vibrio cholerae O139. J. Bacteriol. 182: 2043-2047 [Abstract] [Full Text]  
  • Ellis, H. M., Yu, D., DiTizio, T., Court, D. L. (2001). High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA 98: 6742-6746 [Abstract] [Full Text]  
  • Sproul, A. A., Lambourne, L. T. M., Jean-Jacques D, J., Kornberg, H. L. (2001). Genetic control of manno(fructo)kinase activity in Escherichia coli. Proc. Natl. Acad. Sci. USA 98: 15257-15259 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nichols, B. P.
Right arrow Articles by Meiners, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nichols, B. P.
Right arrow Articles by Meiners, V.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»