Previous Article | Next Article 
Journal of Bacteriology, December 1998, p. 6408-6411, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Sequence Analysis of Tn10 Insertion
Sites in a Collection of Escherichia coli Strains Used for
Genetic Mapping and Strain Construction
Brian P.
Nichols,*
Obaid
Shafiq, and
Victoria
Meiners
Laboratory for Molecular Biology, Department
of Biological Sciences, University of Illinois at Chicago, Chicago,
Illinois 60607
Received 26 May 1998/Accepted 1 October 1998
 |
ABSTRACT |
The chromosomal insertion sites of Tn10-containing
Escherichia coli strains were amplified by inverse PCR, and
the nucleotide sequences of the junctions were determined. In 95 strains analyzed, 88 unique Tn10 positions were
determined and matched to the E. coli chromosome sequence.
Two gaps in insertion site positions were noted, one including the
terminus of DNA replication and another bounded by recombination hot
spots RhsA and RhsB.
 |
TEXT |
A collection of Escherichia
coli strains with Tn10 insertions located at
approximately 1-min intervals around the chromosome was reported in
1989 (12) and has been used in many laboratories for strain
construction and genetic mapping. The versatility of this collection of
strains is based on its regularity of map positions around the
chromosome and its combination of Tn10 and positionally equivalent Tn10kan members. To clarify an occasional
inconsistency in map position in certain members of the
collection in our laboratory, we developed an inverse PCR scheme
to allow determination of the precise positions of the
Tn10 insertion sites by DNA sequence analysis. We have
determined the nucleotide positions of nearly all of the
Tn10 insertion sites in the collection of strains originally reported by Singer et al. (12) and subsequently catalogued
by Berlyn et al. (2).
Strains used in this study were obtained either from the Carol Gross
laboratory or from the E. coli Genetic Stock Center. DNA
preparations were done by a modification of standard methods (10,
13). Cells from 5 ml of an overnight culture grown in Luria
broth-tetracycline (10 µg/ml) were harvested by centrifugation and resuspended in 2.5 ml of lysis solution (25 mM Tris-HCl [pH 7.4], 50 mM glucose, 10 mM EDTA, 2-µg/ml lysozyme). Cells were lysed
by the addition of 0.25 ml of 10% sodium dodecyl sulfate, and DNA was
extracted once with an equal volume of phenol saturated with 0.3 M
sodium acetate (NaOAc). The aqueous phase was retained and made 0.3 M
in NaOAc by addition of 0.1 volume of 3 M NaOAc, and DNA was
precipitated by addition of 2.5 volumes of ethanol. The precipitate was
transferred to 0.5 ml of 70% ethanol by using a Pasteur pipette.
Following a brief centrifugation (30 s at 13,000 × g),
the supernatant was removed and the DNA was resuspended in 0.25 ml of
10 mM Tris-HCl (pH 7.4)-0.1 mM EDTA. Chromosomal DNA was digested with
HpaII and circularized with DNA ligase preparatory to
inverse PCR (8).
Inverse PCR was performed as described by Ochman et al. (8)
by using Platinum Taq DNA Polymerase (Life Technologies).
The PCR primers (Integrated DNA Technologies) were designed from the Tn10 sequence (5, 7, 9, 11) and are illustrated
in Fig. 1. The product of the first PCR
using primers 1 and 2 was diluted 1/10, and 1 µl was used as the
template for a second round of PCR using primers 3 and 4. The sequences
of the primers were as follows: primer 1, ACATGAAGGTCATCGATAGCAGGA; primer 2, GGCTGTTGAGTTGAGGTTGACGAA; primer 3, AACAGTAATGGGCCAATAACACCG; primer 4, CGAGTTCGCACATCTTGTTGTCTG.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Map of a portion of Tn10 including
tetA and IS10R. Open reading frames (orfs) are
indicated, as are the positions of the PCR primers (pris) used in this
study. The single HpaII site in this region is also shown.
|
|
PCR products were sequenced by using a PCR sequencing kit (Amersham).
The sequencing primer was a 19-mer situated at positions
62 to
53
relative to the end of IS10R. Twenty- to 40-nucleotide-long sequences at the junction of IS10R were determined, and the
positions were identified by a BLAST search (1) of the
E. coli genome sequence (3).
Of 95 strains analyzed, 88 yielded sufficient sequences for confident
definition of positions on the E. coli chromosome (Table 1 and Fig.
2). Two strains (CAG18463 and CAG12099)
yielded short sequences that occurred twice in the genome
sequence, once within 0.5 min of the reported map position and once
distant. The site near the reported map position was taken as the site
of insertion for these strains. The sequence derived from the junction
of CAG18491 was very short, but inspection of the sequence near
metE showed only two identities, one in the
metR-metE intergenic region and one downstream from the
metE coding region. We presumed that the intergenic
insertion was more likely to yield a metE phenotype and
placed the insertion site at that position. One additional sequence
(from CAG18429 zjh-6::Tn10) was too
short for unambiguous assignment, and no phenotype was available
to assist in placement. The remaining five strains yielded
sequences identical to others in the collection. These duplicate
strains were CAG12074 = CAG18465, CAG12159 = CAG18459 = CAG12151, CAG18483 = CAG12080, CAG18498 = CAG18499, and
CAG18709 = CAG18456. Each duplicate sequence was confirmed by
analysis of strains obtained from the E. coli Genetic Stock
Center.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Positions of Tn10 insertions on the E. coli map. Shown for each strain are its designation, the gene or
open reading frame disrupted by the insertion, and the base pair
position. Numbering on the inside of the circle is in minutes. ig,
intergenic.
|
|
Eleven of the Tn10 insertion sites were in intergenic
regions, 51 were in coding regions of known genes, and 26 were in
potential open reading frames identified by sequence analysis
(3). For the majority of strains, the nucleotide
positions of the Tn10 insertion site fell within 1 min
of the position determined by genetic mapping. Six of the sequences
differed in map position by greater than 2 min. All strains whose
Tn10 positions differed from the mapped position by
greater than 1.5 min were obtained from the E. coli
Genetic Stock Center and reanalyzed. In most cases, there was
agreement between the strains in our laboratory collection and those
obtained from the E. coli Genetic Stock Center. In several
cases, cross-contamination of cultures was evident. In most cases, the
mixture was resolved by isolation of single colonies from the cultures.
It is not clear whether the positional differences we noted were caused
by culture contamination that occurred prior to the distribution of
strains to this laboratory and the E. coli Genetic Stock
Center or some other artifact of the original genetic analysis.
There are two noticeable gaps in this particular collection of
transposon-containing strains, each about 5 min long. The gap at 33 to
38 min contains the DNA replication terminus and recombination hot spot
sites dif and RhsE. The gap at 77 to 82 min is
bounded by recombination hot spot sites RhsB and
RhsA. Three of the strains with transposons originally
mapped to these two gaps (CAG18640, CAG12163, and CAG18462) now contain
the transposon at a grossly different location on the chromosome. It
seems likely that the failure of the transposons to be maintained at
these locations is due to the same features that have led to the
characterization of these regions as "recombinationally unstable"
(4, 6).
 |
ACKNOWLEDGMENTS |
We thank Jonathan Narita, Mitchell Singer, and Mary Berlyn for
advice during the course of this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory for
Molecular Biology, Department of Biological Sciences, Molecular Biology Research Bldg. m/c 567, University of Illinois at Chicago, 900 S. Ashland Ave., Chicago, IL 60607. Phone: (312) 996-5064. Fax: (312)
413-2691. E-mail: brian.p.nichols{at}uic.edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Berlyn, M. K. B.,
K. B. Low,
K. E. Rudd, and M. Singer.
1996.
Linkage map of Escherichia coli K-12, edition 9, p. 1715-1902.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schoechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella, 2nd ed., vol. 2. ASM Press, Washington, D.C.
|
| 3.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 4.
|
Corre, J.,
F. Cornet,
J. Patte, and J. M. Louarn.
1997.
Unraveling a region-specific hyper-recombination phenomenon: genetic control and modalities of terminal recombination in Escherichia coli.
Genetics
147:979-989[Abstract].
|
| 5.
|
Halling, S. M.,
R. W. Simons,
J. C. Way,
R. B. Walsh, and N. Kleckner.
1982.
DNA sequence organization of IS10-right of Tn10 and comparison with IS10-left.
Proc. Natl. Acad. Sci. USA
79:2608-2612[Abstract/Free Full Text].
|
| 6.
|
Lin, R. J.,
M. Capage, and C. W. Hill.
1984.
A repetitive DNA sequence, rhs, responsible for duplications within the Escherichia coli K-12 chromosome.
J. Mol. Biol.
177:1-18[Medline].
|
| 7.
|
Nguyen, T. T.,
K. Postle, and K. P. Bertrand.
1983.
Sequence homology between the tetracycline-resistance determinants of Tn10 and pBR322.
Gene
25:83-92[Medline].
|
| 8.
|
Ochman, H.,
M. M. Medhora,
D. Garza, and D. L. Hartl.
1990.
Amplification of flanking sequences by inverse PCR, p. 219-227.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
|
| 9.
|
Postle, K.,
T. T. Nguyen, and K. P. Bertrand.
1984.
Nucleotide sequence of the repressor gene of the Tn10 tetracycline resistance determinant.
Nucleic Acids Res.
12:4849-4863[Abstract/Free Full Text].
|
| 10.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 11.
|
Schollmeier, K., and W. Hillen.
1984.
Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R.
J. Bacteriol.
160:499-503[Abstract/Free Full Text].
|
| 12.
|
Singer, M.,
T. A. Baker,
G. Schnitzler,
S. M. Deischel,
M. Goel,
W. Dove,
K. J. Jaacks,
A. D. Grossman,
J. W. Erickson, and C. A. Gross.
1989.
Collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli.
Microbiol. Rev.
53:1-24[Abstract/Free Full Text].
|
| 13.
|
Wilson, K.
1987.
Preparation of genomic DNA from bacteria, p. 2.4.1-2.4.5.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York, N.Y.
|
Journal of Bacteriology, December 1998, p. 6408-6411, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Molt, K. L., Sutera, V. A. Jr., Moore, K. K., Lovett, S. T.
(2009). A Role for Nonessential Domain II of Initiator Protein, DnaA, in Replication Control. Genetics
183: 39-49
[Abstract]
[Full Text]
-
Lestini, R., Michel, B.
(2008). UvrD and UvrD252 Counteract RecQ, RecJ, and RecFOR in a rep Mutant of Escherichia coli. J. Bacteriol.
190: 5995-6001
[Abstract]
[Full Text]
-
Aguilera, L., Campos, E., Gimenez, R., Badia, J., Aguilar, J., Baldoma, L.
(2008). Dual Role of LldR in Regulation of the lldPRD Operon, Involved in L-Lactate Metabolism in Escherichia coli. J. Bacteriol.
190: 2997-3005
[Abstract]
[Full Text]
-
De Lay, N. R., Cronan, J. E.
(2008). Genetic Interaction Between the Escherichia coli AcpT Phosphopantetheinyl Transferase and the YejM Inner Membrane Protein. Genetics
178: 1327-1337
[Abstract]
[Full Text]
-
Massengo-Tiasse, R. P., Cronan, J. E.
(2008). Vibrio cholerae FabV Defines a New Class of Enoyl-Acyl Carrier Protein Reductase. J. Biol. Chem.
283: 1308-1316
[Abstract]
[Full Text]
-
Finn, J. A., Parks, A. R., Peters, J. E.
(2007). Transposon Tn7 Directs Transposition into the Genome of Filamentous Bacteriophage M13 Using the Element-Encoded TnsE Protein. J. Bacteriol.
189: 9122-9125
[Abstract]
[Full Text]
-
Prunier, A.-L., Schuch, R., Fernandez, R. E., Maurelli, A. T.
(2007). Genetic Structure of the nadA and nadB Antivirulence Loci in Shigella spp.. J. Bacteriol.
189: 6482-6486
[Abstract]
[Full Text]
-
De Lay, N. R., Cronan, J. E.
(2007). In Vivo Functional Analyses of the Type II Acyl Carrier Proteins of Fatty Acid Biosynthesis. J. Biol. Chem.
282: 20319-20328
[Abstract]
[Full Text]
-
Bubunenko, M., Baker, T., Court, D. L.
(2007). Essentiality of Ribosomal and Transcription Antitermination Proteins Analyzed by Systematic Gene Replacement in Escherichia coli. J. Bacteriol.
189: 2844-2853
[Abstract]
[Full Text]
-
Thacker, Z., Darmon, E., Keppel, F., Masters, M.
(2006). The Escherichia coli rpoS-Dependent htrC Gene Is Not Involved in the Heat Shock Response. J. Bacteriol.
188: 8317-8320
[Abstract]
[Full Text]
-
Yim, G., de la Cruz, F., Spiegelman, G. B., Davies, J.
(2006). Transcription Modulation of Salmonella enterica Serovar Typhimurium Promoters by Sub-MIC Levels of Rifampin. J. Bacteriol.
188: 7988-7991
[Abstract]
[Full Text]
-
Nicoloff, H., Perreten, V., McMurry, L. M., Levy, S. B.
(2006). Role for Tandem Duplication and Lon Protease in AcrAB-TolC- Dependent Multiple Antibiotic Resistance (Mar) in an Escherichia coli Mutant without Mutations in marRAB or acrRAB.. J. Bacteriol.
188: 4413-4423
[Abstract]
[Full Text]
-
Chaperon, D.-N.
(2006). Construction and Complementation of In-Frame Deletions of the Essential Escherichia coli Thymidylate Kinase Gene. Appl. Environ. Microbiol.
72: 1288-1294
[Abstract]
[Full Text]
-
Froelich, J. M., Tran, K., Wall, D.
(2006). A pmrA Constitutive Mutant Sensitizes Escherichia coli to Deoxycholic Acid. J. Bacteriol.
188: 1180-1183
[Abstract]
[Full Text]
-
Coros, A. M., Twiss, E., Tavakoli, N. P., Derbyshire, K. M.
(2005). Genetic Evidence that GTP Is Required for Transposition of IS903 and Tn552 in Escherichia coli. J. Bacteriol.
187: 4598-4606
[Abstract]
[Full Text]
-
Buurman, E. T., McLaggan, D., Naprstek, J., Epstein, W.
(2004). Multiple Paths for Nonphysiological Transport of K+ in Escherichia coli. J. Bacteriol.
186: 4238-4245
[Abstract]
[Full Text]
-
Goh, E.-B., Siino, D. F., Igo, M. M.
(2004). The Escherichia coli tppB (ydgR) Gene Represents a New Class of OmpR-Regulated Genes. J. Bacteriol.
186: 4019-4024
[Abstract]
[Full Text]
-
Strauss, B., Kelly, K., Dincman, T., Ekiert, D., Biesieda, T., Song, R.
(2004). Cell Death in Escherichia coli dnaE(Ts) Mutants Incubated at a Nonpermissive Temperature Is Prevented by Mutation in the cydA Gene. J. Bacteriol.
186: 2147-2155
[Abstract]
[Full Text]
-
Harinarayanan, R., Gowrishankar, J.
(2004). A dnaC Mutation in Escherichia coli That Affects Copy Number of ColE1-Like Plasmids and the PriA-PriB (but Not Rep-PriC) Pathway of Chromosomal Replication Restart. Genetics
166: 1165-1176
[Abstract]
[Full Text]
-
Grompone, G., Bidnenko, V., Ehrlich, S. D., Michel, B.
(2004). PriA Is Essential for Viability of the Escherichia coli Topoisomerase IV parE10(Ts) Mutant. J. Bacteriol.
186: 1197-1199
[Abstract]
[Full Text]
-
Wolfe, M. D., Ahmed, F., Lacourciere, G. M., Lauhon, C. T., Stadtman, T. C., Larson, T. J.
(2004). Functional Diversity of the Rhodanese Homology Domain: THE ESCHERICHIA COLI ybbB GENE ENCODES A SELENOPHOSPHATE-DEPENDENT tRNA 2-SELENOURIDINE SYNTHASE. J. Biol. Chem.
279: 1801-1809
[Abstract]
[Full Text]
-
Lai, C.-Y., Cronan, J. E.
(2003). {beta}-Ketoacyl-Acyl Carrier Protein Synthase III (FabH) Is Essential for Bacterial Fatty Acid Synthesis. J. Biol. Chem.
278: 51494-51503
[Abstract]
[Full Text]
-
Gimenez, R., Nunez, M. F., Badia, J., Aguilar, J., Baldoma, L.
(2003). The Gene yjcG, Cotranscribed with the Gene acs, Encodes an Acetate Permease in Escherichia coli. J. Bacteriol.
185: 6448-6455
[Abstract]
[Full Text]
-
Suiter, A. M., Banziger, O., Dean, A. M.
(2003). Fitness consequences of a regulatory polymorphism in a seasonal environment. Proc. Natl. Acad. Sci. USA
100: 12782-12786
[Abstract]
[Full Text]
-
Soupene, E., van Heeswijk, W. C., Plumbridge, J., Stewart, V., Bertenthal, D., Lee, H., Prasad, G., Paliy, O., Charernnoppakul, P., Kustu, S.
(2003). Physiological Studies of Escherichia coli Strain MG1655: Growth Defects and Apparent Cross-Regulation of Gene Expression. J. Bacteriol.
185: 5611-5626
[Abstract]
[Full Text]
-
Bosling, J., Poulsen, S. M., Vester, B., Long, K. S.
(2003). Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3. Antimicrob. Agents Chemother.
47: 2892-2896
[Abstract]
[Full Text]
-
Burgis, N. E., Brucker, J. J., Cunningham, R. P.
(2003). Repair System for Noncanonical Purines in Escherichia coli. J. Bacteriol.
185: 3101-3110
[Abstract]
[Full Text]
-
Mori, H., Akiyama, Y., Ito, K.
(2003). A SecE Mutation That Modulates SecY-SecE Translocase Assembly, Identified as a Specific Suppressor of SecY Defects. J. Bacteriol.
185: 948-956
[Abstract]
[Full Text]
-
Laurie, A. D., Bernardo, L. M. D., Sze, C. C., Skarfstad, E., Szalewska-Palasz, A., Nystrom, T., Shingler, V.
(2003). The Role of the Alarmone (p)ppGpp in sigma N Competition for Core RNA Polymerase. J. Biol. Chem.
278: 1494-1503
[Abstract]
[Full Text]
-
Merlin, C., Gardiner, G., Durand, S., Masters, M.
(2002). The Escherichia coli metD Locus Encodes an ABC Transporter Which Includes Abc (MetN), YaeE (MetI), and YaeC (MetQ). J. Bacteriol.
184: 5513-5517
[Abstract]
[Full Text]
-
Suzuki, K., Wang, X., Weilbacher, T., Pernestig, A.-K., Melefors, O., Georgellis, D., Babitzke, P., Romeo, T.
(2002). Regulatory Circuitry of the CsrA/CsrB and BarA/UvrY Systems of Escherichia coli. J. Bacteriol.
184: 5130-5140
[Abstract]
[Full Text]
-
Sproul, A. A., Lambourne, L. T. M., D, J. J.-J., Kornberg, H. L.
(2001). Genetic control of manno(fructo)kinase activity in Escherichia coli. Proc. Natl. Acad. Sci. USA
10.1073/pnas.211569798v1
[Abstract]
[Full Text]
-
Campbell, J. W., Cronan, J. E. Jr.
(2001). Escherichia coli FadR Positively Regulates Transcription of the fabB Fatty Acid Biosynthetic Gene. J. Bacteriol.
183: 5982-5990
[Abstract]
[Full Text]
-
Hoffer, S. M., Schoondermark, P., van Veen, H. W., Tommassen, J.
(2001). Activation by Gene Amplification of pitB, Encoding a Third Phosphate Transporter of Escherichia coli K-12. J. Bacteriol.
183: 4659-4663
[Abstract]
[Full Text]
-
Bochner, B. R., Gadzinski, P., Panomitros, E.
(2001). Phenotype MicroArrays for High-Throughput Phenotypic Testing and Assay of Gene Function. Genome Res
11: 1246-1255
[Abstract]
[Full Text]
-
Ellis, H. M., Yu, D., DiTizio, T., Court, D. L.
(2001). High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA
10.1073/pnas.121164898v1
[Abstract]
[Full Text]
-
Sardesai, A. A., Gowrishankar, J.
(2001). trans-Acting Mutations in Loci Other than kdpDE That Affect kdp Operon Regulation in Escherichia coli: Effects of Cytoplasmic Thiol Oxidation Status and Nucleoid Protein H-NS on kdp Expression. J. Bacteriol.
183: 86-93
[Abstract]
[Full Text]
-
Kozmin, S. G., Pavlov, Y. I., Dunn, R. L., Schaaper, R. M.
(2000). Hypersensitivity of Escherichia coli Delta (uvrB-bio) Mutants to 6-Hydroxylaminopurine and Other Base Analogs Is Due to a Defect in Molybdenum Cofactor Biosynthesis. J. Bacteriol.
182: 3361-3367
[Abstract]
[Full Text]
-
Monterrubio, R., Baldoma, L., Obradors, N., Aguilar, J., Badia, J.
(2000). A Common Regulator for the Operons Encoding the Enzymes Involved in D-Galactarate, D-Glucarate, and D-Glycerate Utilization in Escherichia coli. J. Bacteriol.
182: 2672-2674
[Abstract]
[Full Text]
-
Hochhut, B., Marrero, J., Waldor, M. K.
(2000). Mobilization of Plasmids and Chromosomal DNA Mediated by the SXT Element, a Constin Found in Vibrio cholerae O139. J. Bacteriol.
182: 2043-2047
[Abstract]
[Full Text]
-
Ellis, H. M., Yu, D., DiTizio, T., Court, D. L.
(2001). High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA
98: 6742-6746
[Abstract]
[Full Text]
-
Sproul, A. A., Lambourne, L. T. M., Jean-Jacques D, J., Kornberg, H. L.
(2001). Genetic control of manno(fructo)kinase activity in Escherichia coli. Proc. Natl. Acad. Sci. USA
98: 15257-15259
[Abstract]
[Full Text]