Previous Article
Journal of Bacteriology, December 1998, p. 6429-6432, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
mraY Is an Essential Gene for Cell
Growth in Escherichia coli
David S.
Boyle* and
William D.
Donachie
Institute of Cell and Molecular Biology,
University of Edinburgh, Edinburgh EH9 3JR, Scotland
Received 6 July 1998/Accepted 1 October 1998
 |
ABSTRACT |
The synthesis of the murein precursor lipid I is performed by MraY.
We have shown that mraY is an essential gene for cell growth. Cells depleted of MraY first swell and then lyse. The expression of mraY DNA in vitro produces a 40-kDa
polypeptide detectable by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis.
 |
TEXT |
In Escherichia coli, the
mra (murein region a [14]) cluster
is located at 2 min on the genetic map. The region contains 16 open
reading frames (ORFs), the functions of 14 of which have been
identified (Fig. 1). The genes are
involved in either cell division or murein synthesis or both (for
reviews, see references 3, 10, and
19). The mraY and murG genes
encode enzymes which together catalyze the formation of the
lipid-linked disaccharide pentapeptide, lipid II
[undecaprenyl-pyrophosphoryl-N-acetyl
muramyl-(pentapeptide)-N-acetyl glucosamine], the
precursor required for murein biosynthesis (8, 13, 15, 19).
The first step of this two-stage process involves MraY, a
membrane-bound translocase, which catalyzes the binding of
UDP-MurNAc-(pentapeptide) to bactoprenol, a membrane-bound C55 isoprenoid lipid, to produce lipid I
[undecaprenyl-pyrophosphoryl (PP)-MurNAc-pentapeptide] (8, 15,
20). The mraY mutant phenotype is not known. In this
study, the phenotype of an mraY-null mutant is
described. The proposed mraY ORF of 1,080 bp, identified by
Ikeda et al., (7), is shown to complement an
mraY-null allele. This ORF also produced a polypeptide
of ~40 kDa when it was expressed in an in vitro transcription and
translation system.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Organization of the mra region and the
plasmids constructed for the purpose of this study. The upper part
shows the ORFs in the mra region to scale in kilobase pairs.
The boxed letters refer to the genes within this region: w,
mraW; z, mraZ; L, ftsL; I, ftsI;
E, murE; F, murF; Y, mraY; D,
murD; W, ftsW; G, murG; C, murC;
B, ddlB; Q, ftsQ; A, ftsA; Z,
ftsZ; and eA, envA. Also shown are the cloned fragments
with direction of expression as indicated by arrowheads. The types of
promoter used to express these ORFs are listed at the left.
P, PvuII; K, KpnI;
Ev, EcoRV; N*, NdeI;
X, XmnI; and B, BglII. The
NdeI site was introduced by PCR-directed
mutagenesis.
|
|
Insertional inactivation of mraY.
An 8.4-kb
KpnI fragment from Kohara phage
6F3 (110) was cloned into
pUC18 to create pDEG1 (Fig. 1) (1, 9). The mraY locus in pDEG1 was inactivated by the insertion of the chloramphenicol resistance gene (cat) into the XmnI site of
mraY to make pDYC1 (Fig. 1). The disrupted
mraY::cat construct was used to replace a wild-type mraY allele in the recD strain
DSB1 [rodA(Am)
recD::minitet Tetr
Kanr Sup0], which has a duplication of the
2-min region (1). Chloramphenicol-resistant (Cmpr) colonies were isolated from cells transformed with a
linear 9.3-kb KpnI restriction fragment from pDYC1. Southern
blot analysis of the genomic DNA from one Cmpr clone showed
that both the wild-type and the disrupted copy of mraY were
present (Fig. 2). This strain was
designated DBYC1. P1 lysates were grown on DBYC1 and used to transduce
C600T (galK leu::Tn10 Tetr)
to Cmpr. No Cmpr transductants were
recovered. When C600T carrying pUC18 or pDEG1 was then transduced with
the same P1 lysate, Cmpr transductants were
recovered only from cells carrying pDEG1. The inability to transduce
C600T (with or without pUC18) suggested that mraY may be an
essential gene. The genetic linkage between leu::Tn10 and
mraY::cat was determined by measuring
the cotransduction frequency of the two markers. Of the
Cmpr isolates screened, 78% were Tets
Leu+, consistent with the proximity of leu and
mraY.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot analysis of the genomic DNA from the
partial diploid strains DSB1 (mraY wild type, lane 2) and
DBYC1 (mraY::cat mutant, lane 3). Lanes
1 and 4 contain control DNAs mraY::cat
(pDYC1) and mraY wild type (pDEG1), respectively. All of the
DNAs were restricted with EcoRV, electrophoresed through
agarose, and Southern blotted onto a nylon membrane. The blot was
first probed with mraY (A) to show
mraY::cat at 3.5 kb and mraY
at 2.7 kb (lanes 1 and 4, respectively). Lane 2 shows strain DSB1
to have only wild-type mraY at 2.7 kb. Lane 3 shows both the
wild-type and disrupted forms of mraY from DBYC1 DNA.
Probing the same blot with cat (B) shows that only pDYC1
(lane 1) and DBYC1 (lane 3) contain the
mraY::cat fragment at 3.5 kb.
|
|
Complementation analysis of
mraY::cat.
The region required for the
independent expression of mraY was identified by using
several clones of mraY in the vector pT7-4 (17,
18), a multicopy plasmid lacking exogenous promoters. These
plasmids were pDBY4, pDFY4, pDEFY4, and pDIEFY4 (Fig. 1). The
expression of cloned DNA in these constructs is dependent on the
presence of T7 RNA polymerase, usually supplied by an inducible (lacUV5)
bacteriophage (
DE3, absent in the host
strain, C600T). Using P1 transduction, we were able to introduce the
mraY::cat allele into C600T carrying
either pDEFY4 or pDIEFY4 but not when it was carrying the other
pT7-4-based mraY clones, pDBY4 or pDFY4. Hara et al.
(6) recently demonstrated that transcription of the first
seven genes in the mra cluster is dependent on
Pmra, a promoter located at the start of the
mra region. Because complementation of
mraY::cat was achieved only in
multicopy number plasmids, it is possible that a weak promoter-like
sequence which exists in the upstream DNA is sufficient to complement
the null allele when present at a high copy number.
The mraY::cat phenotype.
To
study the effects of MraY depletion in growing cells, a 2.7-kb
EcoRV fragment containing mraY was cloned into
the vector pBAD18 (5) to create pBAY1 (Fig. 1).
Expression from PBAD can be induced or repressed
with arabinose or glucose, respectively. A second clone, pBEFY1,
was made by subcloning a 4.5-kb
EcoRI/HindIII fragment from pDEFY4 into
pBAD18 (Fig. 1). C600T containing either pBAD18 or the other
plasmids was transduced with P1 lysates prepared from DBYC1. The only
Cmpr transductants recovered contained either pBAY1 or
pBEFY1. Cmpr isolates carrying pBAY1 were arabinose
dependent for growth as expected, whereas Cmpr isolates
carrying pBEFY1 were able to grow in the presence of either glucose or
arabinose, as expected, since mraY can be expressed from
PmraY independently of
PBAD.
To achieve more-controlled regulation of expression of
mraY
from pBAY1 in strain DBYC2 (
galK
mraY::
cat Cmp
r), the plasmid copy
number was reduced by introducing the
pcnB::
kan allele (
11) by P1
transduction to give strain DBYC3 (as DBYC2
pcnB::
Kan Kan
r).
DBYC3/pBAY1 was initially grown in Luria broth (LB) plus
chloramphenicol
with 0.2% arabinose at 37°C until the cells reached
exponential
phase. The method for culturing DBYC3/pBAY1 in either LB
plus
0.2% arabinose (wt/vol) or LB plus 0.2% glucose (wt/vol)
was as
described earlier (
1). After 80 min, the growth rate
of the
glucose-containing culture started to decrease, and
growth stopped
after 120 min (Fig.
3). The arabinose-containing culture
continued
to grow unaffected (Fig.
3). Cells from the
arabinose-containing
culture at 0 and 180 min were mainly
short rods (Fig.
4). But,
after 180 min
in glucose, the cells were misshapen or had lysed
(Fig.
4). Cells of
C600T/pBAY1 cultured under the same conditions
were
indistinguishable from DBYC3/pBAY1 grown in 0.2% arabinose
with
respect to growth rate and cell morphology (data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Induction and repression of
PBAD::mraY in the
mraY-null mutant strain DBYC3/pBAY1 cultured in LB plus
kanamycin supplemented with either 0.2% (vol/vol) arabinose ( ) or
0.2% (vol/vol) glucose ( ) at 37°C. O.D., optical density.
|
|

View larger version (146K):
[in this window]
[in a new window]
|
FIG. 4.
Micrographs of DBYC3/pBAY1 grown in LB supplemented with
either arabinose or glucose. (A and C) Cells from the
arabinose-containing culture sampled at 0 and 180, respectively. (B and
D) Cells from the glucose-containing culture sampled at 0 and 180 min,
respectively. Bar, 5 µm.
|
|
The phenotype of the
mraY::
cat strain
is very similar to that of mutants of peptidoglycan precursor genes
(
19). This suggests
that synthesis of peptidoglycan is
interrupted, presumably by
a depletion in the pool of lipid I, causing
cell death by autolysis.
We conclude that
mraY is an
essential gene required for cell wall
growth in
E. coli.
Identification of MraY.
The MraY polypeptide has not
been detected by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) analysis even when overproduced in vivo
(12), although increased levels of enzyme activity have been
observed (2, 8). We failed to detect radiolabelled MraY from
the T7 clones listed in Fig. 1 by SDS-PAGE. These included pETY3c, in
which mraY was cloned in frame to the T7 gene 10 Shine-Dalgarno sequence by PCR-directed mutagenesis with primers DAV2
(5' GGAGAATGGCATATGTTAGTTTGG 3') and DAV3 (5'
CAATCAGATCTGCCGCCA 3') (16). mraY was
subcloned from pETY3c into pJF118EH (4) to create
pJFY3c (Fig. 1). pJF118EH and pJFY3c DNA were used as the templates for
in vitro translation. Analysis (SDS-10% PAGE) revealed that
pJFY3c produced a peptide of ~40 kDa (Fig.
5) which was absent
in the pJF118EH control (Fig. 5). In agreement with this
result, pJFY3c complemented the null allele (introduced by
P1 transduction to C600T/pJFY3c), whereas pJF118EH did not.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
SDS-10% PAGE analysis of the in vitro translation
products (radiolabelled) produced by pJFY3c (lane 1) and pJF118EH (lane
2) after induction with 0.5 M
isopropyl- -D-thiogalactopyranoside. In lane 1 a
unique polypeptide migrates as a 40-kDa peptide. This band is absent
from the pJF118EH sample and is therefore presumed to be MraY.
|
|
 |
ACKNOWLEDGMENTS |
This work was funded by a grant from the BBSRC.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
University of Edinburgh, I.C.M.B., Darwin Building, King's Buildings,
Mayfield Rd., Edinburgh EH9 3JR, Scotland, United Kingdom. Phone: 44 131 650-5356. Fax: 44 131 668-3870. E-mail:
DBOYLE{at}srv0.bio.ed.ac.uk.
 |
REFERENCES |
| 1.
|
Boyle, D. S.,
M. M. Khattar,
S. G. Addinall,
J. Lutkenhaus, and W. D. Donachie.
1997.
ftsW is an essential cell-division gene in Escherichia coli.
Mol. Microbiol.
24:1263-1273[Medline].
|
| 2.
|
Brandish, P. E.,
M. K. Burnham,
J. T. Lonsdale,
R. Southgate,
M. Inukai, and T. D. H. Bugg.
1996.
Slow binding inhibition of phospho-N-acetylmuramyl-pentapeptide-translocase (Escherichia coli) by mureidomycin A.
J. Biol. Chem.
271:7609-7614[Abstract/Free Full Text].
|
| 3.
|
Donachie, W. D.
1993.
The cell cycle of Escherichia coli.
Annu. Rev. Microbiol.
47:199-230[Medline].
|
| 4.
|
Furste, J. P.,
W. Pansegrau,
R. Frank,
H. Blocker,
P. Scholtz,
M. Bagdasarian, and E. Lanka.
1986.
Molecular cloning of the plasmid RP4 primase region in a multi-host range tacP expression vector.
Gene
48:119-131[Medline].
|
| 5.
|
Guzman, L.-M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 6.
|
Hara, H.,
S. Yasuda,
K. Horiuchi, and J. T. Park.
1997.
A promoter for the first nine genes of the Escherichia coli mra cluster of cell division and cell envelope biosynthesis genes, including ftsI and ftsW.
J. Bacteriol.
179:5802-5811[Abstract/Free Full Text].
|
| 7.
|
Ikeda, M.,
M. Wachi,
F. Ishino, and M. Matsuhashi.
1990.
Nucleotide sequence involving murD and an open reading frame orf-Y spacing murF and ftsW in Escherichia coli.
Nucleic Acids Res.
18:1058[Free Full Text].
|
| 8.
|
Ikeda, M.,
M. Wachi,
H. K. Jung,
F. Ishino, and M. Matsuhashi.
1991.
The Escherichia coli mraY gene encoding UDP-N-acetylmuramoyl-pentapeptide:undecaprenyl-phosphate phospho-N-acetylmuramoyl-pentapeptide transferase.
J. Bacteriol.
173:1021-1026[Abstract/Free Full Text].
|
| 9.
|
Kohara, Y.,
K. Akiyama, and K. Isono.
1987.
The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library.
Cell
50:495-508[Medline].
|
| 10.
|
Lutkenhaus, J., and A. Mukherjee.
1996.
Cell division, p. 1615-1626.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 11.
|
Masters, M.,
M. D. Colloms,
I. R. Oliver,
L. He,
E. J. MacNaughton, and Y. Charters.
1993.
The pcnB gene of Escherichia coli, which is required for ColE1 copy number maintenance, is dispensable.
J. Bacteriol.
175:4405-4413[Abstract/Free Full Text].
|
| 12.
|
Mengin-Lecreuix, D. M.,
C. Parquet,
L. R. Desviat,
J. Plà,
B. Flouret,
J. A. Ayala, and J. van Heijenoort.
1989.
Organization of the murE-murG region of Escherichia coli: identification of the murD gene encoding the D-glutamic-acid-adding enzyme.
J. Bacteriol.
171:6126-6134[Abstract/Free Full Text].
|
| 13.
|
Mengin-Lecreulx, D.,
L. Texier,
M. Rousseau, and J. van Heijenoort.
1991.
The murG gene of Escherichia coli codes for the UDP-N-acetyl glucosamine:N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase involved in the membrane steps of peptidoglycan synthesis.
J. Bacteriol.
173:4625-4636[Abstract/Free Full Text].
|
| 14.
|
Miyakawa, T.,
H. Matsuzawa,
M. Matsuhashi, and Y. Sugino.
1972.
Cell wall peptidoglycan mutants of Escherichia coli K-12: existence of two clusters of genes, mra and mrb, for cell wall peptidoglycan biosynthesis.
J. Bacteriol.
112:950-958[Abstract/Free Full Text].
|
| 15.
|
Park, J. T.
1996.
The murein sacculus, p. 48-57.
In
F. C. Neidhardt, R. Curtiss, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
|
| 16.
|
Rosenberg, A. H.,
B. N. Lade,
D.-S. Chui,
S.-W. Lin,
J. J. Dunn, and F. W. Studier.
1987.
Vectors for selective expression of cloned DNAs by T7 polymerase.
Gene
56:125-135[Medline].
|
| 17.
|
Studier, F. W., and B. A. Moffatt.
1986.
Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[Medline].
|
| 18.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
| 19.
|
van Heijenoort, J.
1996.
Murein synthesis, p. 1025-1034.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 20.
|
Wright, A.,
M. Dankert,
P. Fennessey, and P. W. Robbins.
1967.
Characterisation of a polyisoprenoid compound functional in O-antigen biosynthesis.
Proc. Natl. Acad. Sci. USA
57:1789-1803.
|
Journal of Bacteriology, December 1998, p. 6429-6432, Vol. 180, No. 23
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Norris, V., den Blaauwen, T., Cabin-Flaman, A., Doi, R. H., Harshey, R., Janniere, L., Jimenez-Sanchez, A., Jin, D. J., Levin, P. A., Mileykovskaya, E., Minsky, A., Saier, M. Jr., Skarstad, K.
(2007). Functional Taxonomy of Bacterial Hyperstructures. Microbiol. Mol. Biol. Rev.
71: 230-253
[Abstract]
[Full Text]
-
Price, N. P., Momany, F. A.
(2005). Modeling bacterial UDP-HexNAc: polyprenol-P HexNAc-1-P transferases. Glycobiology
15: 29R-42R
[Abstract]
[Full Text]
-
Solapure, S. M., Raphael, P., Gayathri, C. N., Barde, S. P., Chandrakala, B., Das, K. S., deSousa, S. M.
(2005). Development of a Microplate-Based Scintillation Proximity Assay for MraY Using a Modified Substrate. J Biomol Screen
10: 149-156
[Abstract]
-
Bouhss, A., Crouvoisier, M., Blanot, D., Mengin-Lecreulx, D.
(2004). Purification and Characterization of the Bacterial MraY Translocase Catalyzing the First Membrane Step of Peptidoglycan Biosynthesis. J. Biol. Chem.
279: 29974-29980
[Abstract]
[Full Text]
-
Stachyra, T., Dini, C., Ferrari, P., Bouhss, A., van Heijenoort, J., Mengin-Lecreulx, D., Blanot, D., Biton, J., Le Beller, D.
(2004). Fluorescence Detection-Based Functional Assay for High-Throughput Screening for MraY. Antimicrob. Agents Chemother.
48: 897-902
[Abstract]
[Full Text]
-
Barbosa, M. D. F. S., Yang, G., Fang, J., Kurilla, M. G., Pompliano, D. L.
(2002). Development of a Whole-Cell Assay for Peptidoglycan Biosynthesis Inhibitors. Antimicrob. Agents Chemother.
46: 943-946
[Abstract]
[Full Text]
-
Chandrakala, B., Elias, B. C., Mehra, U., Umapathy, N. S., Dwarakanath, P., Balganesh, T. S., deSousa, S. M.
(2001). Novel Scintillation Proximity Assay for Measuring Membrane-Associated Steps of Peptidoglycan Biosynthesis in Escherichia coli. Antimicrob. Agents Chemother.
45: 768-775
[Abstract]
[Full Text]
-
Snyder, L. A. S., Saunders, N. J., Shafer, W. M.
(2001). A Putatively Phase Variable Gene (dca) Required for Natural Competence in Neisseria gonorrhoeae but Not Neisseria meningitidis Is Located within the Division Cell Wall (dcw) Gene Cluster. J. Bacteriol.
183: 1233-1241
[Abstract]
[Full Text]
-
Bernhardt, T. G., Roof, W. D., Young, R.
(2000). Genetic evidence that the bacteriophage phi X174 lysis protein inhibits cell wall synthesis. Proc. Natl. Acad. Sci. USA
97: 4297-4302
[Abstract]
[Full Text]
-
Bernhardt, T. G., Struck, D. K., Young, R.
(2001). The Lysis Protein E of phi X174 Is a Specific Inhibitor of the MraY-catalyzed Step in Peptidoglycan Synthesis. J. Biol. Chem.
276: 6093-6097
[Abstract]
[Full Text]