Journal of Bacteriology, December 1998, p. 6450-6458, Vol. 180, No. 24
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Division of Infectious Diseases, Department of Medicine, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-2605,1 and Department of Veterans Affairs Medical Center, Nashville, Tennessee 37212-26372
Received 2 July 1998/Accepted 9 October 1998
| |
ABSTRACT |
|---|
|
|
|---|
The virulence of Campylobacter fetus, a bacterial pathogen of ungulates and humans, is mediated in part by the presence of a paracrystalline surface layer (S-layer) that confers serum resistance. The subunits of the S-layer are S-layer proteins (SLPs) that are secreted in the absence of an N-terminal signal sequence and attach to either type A or B C. fetus lipopolysaccharide in a serospecific manner. Antigenic variation of multiple SLPs (encoded by sapA homologs) of type A strain 23D occurs by inversion of a promoter-containing DNA element flanked by two sapA homologs. Cloning and sequencing of the entire 6.2-kb invertible region from C. fetus 23D revealed a probable 5.6-kb operon of four overlapping genes (sapCDEF, with sizes of 1,035, 1,752, 1,284, and 1,302 bp, respectively) transcribed in the opposite direction from sapA. The four genes also were present in the invertible region of type B strain 84-107 and were virtually identical to their counterparts in the type A strain. Although SapC had no database homologies, SapD, SapE, and SapF had predicted amino acid homologies with type I protein secretion systems (typified by Escherichia coli HlyBD/TolC or Erwinia chrysanthemi PrtDEF) that utilize C-terminal secretion signals to mediate the secretion of hemolysins, leukotoxins, or proteases from other bacterial species. Analysis of the C termini of four C. fetus SLPs revealed conserved structures that are potential secretion signals. A C. fetus sapD mutant neither produced nor secreted SLPs. E. coli expressing C. fetus sapA and sapCDEF secreted SapA, indicating that the sapCDEF genes are sufficient for SLP secretion. C. fetus SLPs therefore are transported to the cell surface by a type I secretion system.
| |
INTRODUCTION |
|---|
|
|
|---|
Campylobacter fetus is a gram-negative pathogen that causes infertility and infectious abortion in sheep and cattle and extraintestinal infections in immunocompromised humans (35, 55). Similar to many bacteria (54), wild-type C. fetus has a paracrystalline surface layer (S-layer) composed of S-layer proteins (SLPs) (23, 25). SLPs are the most abundant proteins in C. fetus, constituting as much as 10 to 15% of the total cell protein (19, 50). The C. fetus S-layer inhibits binding of complement factor C3b and therefore results in resistance to phagocytosis and to complement-mediated killing by normal or immune serum (13). Mutants lacking the S-layer are significantly less virulent in animal models than are those expressing the S-layer (11, 49).
Two types of SLPs exist (A and B), based on their specific binding to serotype A or B lipopolysaccharide. However, within each of the types are a number of SLP variants that range in size from 97 to 149 kDa. In C. fetus 23D, SLPs are encoded by a family of eight sapA homologs (26). A single C. fetus cell has the ability to change the type of SLP that it expresses by the recA-dependent inversion of a DNA segment containing a unique outward-facing sapA promoter (22). The minimum invertible DNA segment is 6.2 kb in size and is flanked by sapA homologs, although larger and more complex inversions allow expression of alternate sapA homologs (24, 31).
The majority of bacterial SLPs have N-terminal signal sequences and are secreted via the type II (sec-dependent) secretion pathway (15). The SLPs encoded by C. fetus (SapA homologs) and Caulobacter crescentus (RsaA) lack N-terminal signal sequences and therefore are probably secreted by a different mechanism (15). C terminally truncated versions of C. fetus and C. crescentus SLPs are not secreted, suggesting that the secretion signal lies in the C terminus of the protein (6, 8, 14). Furthermore, the C terminus of C. crescentus RsaA is sufficient to allow secretion of heterologous proteins from C. crescentus, and recent mutational studies on its C terminus have begun to delineate sequences important for RsaA secretion (7). SLPs lacking N-terminal signal sequences recently were identified in Serratia marcescens (38) and Campylobacter rectus (62).
The type I pathway uses C-terminal secretion signals on the targeted
protein for secretion from gram-negative bacteria. Proteins secreted by
this pathway include Escherichia coli
-hemolysin and
other bacterial RTX toxins and proteases from Erwinia
chrysanthemi, S. marcescens, and Pseudomonas
aeruginosa (51, 61). The secretion apparatus is
composed of three proteins homologous to HlyB, HlyD, and TolC of
E. coli or PrtDEF of E. chrysanthemi. These three proteins form a transmembrane complex by which a C-terminal signal in
the cognate protein is recognized, initiating its secretion from the
cytoplasm directly into the extracellular medium. The HlyB homologs are
cytoplasmic membrane proteins that are members of the ABC transporter
family and are responsible for recognizing the C-terminal secretion
signal on the protein to be transported (46, 61). HlyD-like
proteins also localize to the cytoplasmic membrane but belong to the
MFP (membrane fusion protein) family (18) and probably
facilitate the direct interaction of the cytoplasmic and outer
membranes during the secretion process. TolC homologs reside in the
outer membrane and appear to form a pore as the outer component of the
transport machinery (42). Recently, SLP-transporting type I
systems have been characterized in C. crescentus and
S. marcescens (2, 38). In C. crescentus, the ABC (RsaD) and MFP (RsaE) components are encoded
by DNA immediately downstream of the SLP structural gene
(rsaA), while the outer membrane component has not been
identified (2). The S. marcescens SLP (SlaA) is secreted by the LipBCD type I transporter and thus shares this pathway
with the S. marcescens extracellular lipase, LipA
(38).
To investigate whether the invertible region contains genes involved in the expression, antigenic variation, or secretion of C. fetus SLPs, we cloned and sequenced the invertible regions from type A strain 23D and type B strain 84-107. Since each DNA sequence predicted four genes (sapCDEF), three of which were homologous to genes encoding type I secretion proteins, we created a mutation in sapD and showed that this mutant did not produce or secrete SLPs. Coexpression of the sapA and sapCDEF genes in E. coli showed that the sapCDEF genes are sufficient to allow secretion of SapA from the bacterial cell.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains, plasmids, and culture conditions. The bacterial strains and plasmids used in this study are listed in Table 1. C. fetus strains were grown at 37°C under microaerobic conditions in a GasPak jar using a CampyPak Plus gas generator (BBL Microbiology Systems, Cockeysville, Md.) on brucella agar (Difco Laboratories, Detroit, Mich.) containing antibiotics at the following concentrations: 7-U/ml polymyxin B, 10-µg/ml vancomycin, 10-µg/ml trimethoprim lactate, 15-µg/ml nalidixic acid (designated PVNT), and 40-µg/ml kanamycin (PVNTK) for kanamycin-resistant strains. Strains were also grown in brucella broth containing the above concentrations of PVNT under microaerobic conditions at 37°C. E. coli strains were grown on LB plates or broth (52) supplemented with trimethoprim lactate (10 µg/ml), kanamycin (40 µg/ml), tetracycline (15 µg/ml), or ampicillin (50 µg/ml) when appropriate.
|
DNA and protein techniques. Restriction enzymes, the Klenow fragment of E. coli DNA polymerase I, and T4 DNA ligase were used as suggested by the manufacturer, either New England Biolabs (Beverly, Mass.), or Promega (Madison, Wis.). The sequences of the invertible regions from strains 23D and 84-107 were obtained by primer walking or direct sequencing of PCR products by using an ABI 377 (PE Applied Biosystems, Foster City, Calif.) automated sequencer by the Vanderbilt University Cancer Center Core Laboratory, and oligonucleotides were synthesized by the Vanderbilt University Molecular Biology Core Laboratory. DNA sequence analysis was done by using the GCG sequence analysis programs (17). Database similarity searches were performed by using the BLAST algorithms maintained by the National Center for Biotechnology Information (Bethesda, Md.). Searches of the PROSITE and MotifDic libraries for protein motifs were done by using the MotifFinder e-mail server (motiffinder{at}genome.ad.jp). Parsimony analysis of protein sequences was performed by using PAUP 3.1 (Smithsonian Institution, Washington, D.C.) with 1,000 bootstrap replicates.
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting. Whole-cell lysates and water extracts of strains 23D, 23B, and 97-205 were prepared by previously described methods (50), and protein concentrations were assayed by using the Pierce BCA Protein Reagent Assay (Pierce, Rockford, Ill.). Protein samples were analyzed by sodium dodecyl sulfate-10%-polyacrylamide gel electrophoresis, and SLPs were detected by immunoblotting (1:10,000 dilution) by using polyclonal rabbit serum against C. fetus SLPs, generated by Cocalico Biologicals (Reamstown, Pa.). The secondary antibody (1:2,000 dilution) was goat anti-rabbit immunoglobulin G-2 alkaline phosphatase (Boehringer Mannheim, Indianapolis, Ind.).
Cloning of the invertible region.
Clones representing the
invertible region from type A strain 23D were isolated as follows.
First, the entire invertible region was amplified by PCR by using
primer 2754 (59), which binds in the conserved sequences at
the 5' end of each flanking sapA homolog (see Fig. 1). This
6.2-kb product was subcloned into pAMP1 (Gibco-BRL, Gaithersburg, Md.)
to yield pIR100, and the pIR100 insert was used as a probe to identify
genomic clones for DNA sequence analysis. Clones were isolated from a
genomic library (26) constructed in
ZAPII (Stratagene, La
Jolla, Calif.) from random fragments resulting from partial
AluI digestion of chromosomal DNA from wild-type C. fetus 23D (48). Three
clones (IR12, IR13, and IR15)
hybridizing to the pIR100 insert were selected and characterized by
restriction digestion, PCR, and DNA sequence analysis. A
clone
(IR20) covering a gap at the right end of the invertible region was
identified by using as a probe a fragment released from pIR100 by
NdeI digestion, corresponding to nucleotides 4715 to 5345 of
the invertible region sequence. Plasmids (pIR12, pIR13, pIR15, and
pIR20) derived from these purified
clones were recovered by
following the in vivo excision protocol recommended by the manufacturer
(Stratagene). No clones were isolated for a region that represented a
small gap between pIR13 and pIR12. We therefore amplified this region
from C. fetus 23D chromosomal DNA by using primers A5598
(5' TGTATCGTTTATGCTGCG; nucleotide positions 1677 to 1694)
and C2968 (5' CCGTCCGGAAGTCTTAGTATC; positions 2963 to
2983). The resulting 1,305-bp PCR product was cloned into pT7Blue
(Novagen, Madison, Wis.), and the DNA sequences of three independent
subclones were determined.
Construction of a C. fetus sapD mutant. Clone pIR13 was digested with BglII and ligated with the aphA (Kmr) cassette excised from pILL600 by BamHI digestion, yielding pIR131. To create a mobilizable plasmid for conjugation, the pIR131 insert was released by BamHI and AccI digestion and ligated with ClaI/BamHI-digested pILL570. The resulting plasmid (pILL131) was transformed into E. coli S17-1, which was mated with C. fetus 23D by previously described methods (14). Transconjugants were recovered after 3 days of growth on plates containing PVNTK.
Southern hybridization. Chromosomal DNAs from C. fetus 23D and 97-205 were prepared by using the cetyltrimethylammonium bromide method (1). The DNA was digested with NdeI, and 1 µg was electrophoresed on a 0.7% agarose gel and then transferred to a nylon membrane (MSI, Westborough, Mass.). The membrane was hybridized with DNA probes labeled by using the Renaissance nonradioactive chemiluminescence kit supplied by NEN Research Products (Boston, Mass.). The membrane was probed with either BamHI-digested pIR13, BamHI-digested pILL570, or the aphA cassette from SmaI-digested pILL600 and subsequently exposed on Biomax MR scientific imaging film from Eastman Kodak (Rochester, N.Y.) for 1 h.
Primer extension analysis. The levels of sapA mRNA in wild-type and sapD mutant C. fetus were determined by primer extension analysis as described previously (30), with the following modifications. Total cellular RNA was prepared from C. fetus 23D (wild type) or 97-205 (sapD mutant) grown for 48 h on brucella agar plates by the hot-phenol method (63). Reverse transcription was initiated by using primer 2754 (59), which binds 117 nucleotides downstream of the sapA transcriptional initiation site.
Serum susceptibility assay.
C. fetus 23D
(SapA+), 23B (SapA
), and 97-205 (sapD::aphA) were harvested from 48-h
plate cultures and assayed for killing by normal human serum (NHS) by
previously described methods (12), with the following
modifications. Dilutions of C. fetus cells (10
4 to 10
7) were incubated in a 37°C 5%
CO2 environment for 60 min in the presence of 40% pooled
NHS or heat-inactivated NHS (HINHS). Samples then were plated on
tryptic soy agar with 5% sheep blood (BBL Microbiology Systems), and
CFU were counted after 72 h. Net killing represented the
difference between counts of cells incubated in HINHS and NHS as
previously described (12).
E. coli SapA secretion assay. To construct E. coli strains for assaying the secretion of SapA, we created an E. coli strain containing C. fetus sapA and sapCDEF on compatible plasmids. First, the sapA-containing EcoRI fragment of pBG1 (10) was subcloned into the EcoRI site of pACYC184 to create pBGYC1. Next, we transformed E. coli C600 with pBGYC1 and either pIR100 (sapCDEF) or pSPORT1 (vector control; Gibco-BRL). This pair of C600 strains (pSPORT1 plus pBGYC1 or pIR100 plus pBGYC1) was grown to mid-log phase, and the cells were harvested by centrifugation. The supernatants were passaged through 0.2-µm-pore-size filters (Micro Filtration Systems, Dublin, Calif.) to rid the supernatants of residual bacterial cells. Trichloroacetic acid (TCA) precipitation of proteins was performed as previously described (28), and the proteins were resolved by Western blot analysis with rabbit anti-SLP serum as described above.
Nucleotide sequence accession numbers. The DNA sequence of the type A invertible region has been deposited in the GenBank database under accession no. AF027405. The DNA sequence of the 84-107 invertible region has been deposited in the GenBank database under accession no. AF071883.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the type A invertible region.
Since bacterial genes
involved in similar functions are often clustered, we sought to
characterize the 6.2-kb invertible region between two sapA
homologs. We first amplified the 6.2-kb fragment by PCR and subcloned
the product into pAMP1 to yield pIR100. Next, we used this subcloned
fragment as a probe to isolate a series of overlapping plasmid clones
derived from a C. fetus genomic library constructed in
ZAPII. Four of these, designated pIR15, pIR13, pIR12, and pIR20,
represented the majority of the invertible region (Fig.
1) and were subjected to DNA sequence
analysis. We were unable to isolate a clone that bridged a small gap
between pIR13 and pIR12; this segment was amplified from C. fetus 23D genomic DNA by PCR using appropriate primers and
subcloned into pT7Blue. To avoid the potential problem of PCR-induced
errors, we sequenced three independent subclones, and in each case, the sequence was the same.
|
Analysis of type A invertible region features.
The DNA
sequence of the 6,229-bp invertible region from strain 23D predicted
four open reading frames (ORFs), which we designated sapCDEFA. The sapC gene began 596 bp
from the initiation codon of the oppositely oriented upstream
sapA homolog (Fig. 1). The sapC ORF was 1,035 bp
in length and was immediately followed by the sapD,
sapE, and sapF ORFs, which were 1,752, 1,284, and
1,302 bp long, respectively. Each gene in this cluster had a typical ribosome binding site, and they overlapped the preceding genes by 14 bp
(sapC/D), 1 bp (sapD/E), and 11 bp
(sapE/F). The sapF gene ended 287 bp upstream of
the sapA homolog located downstream. The 74-bp sequences
preceding the ATG codons initiating translation of the sapA
homologs flanking sapCDEF were identical to each other (Fig.
1). These conserved segments have previously been noted upstream of the
three characterized sapA homologs and may play a role in the
inversion of this DNA segment (22, 24, 60). As a potential
component of this mechanism, sequences resembling
(RecBCD
recognition) sites were present at positions 31 to 38 and 6192 to 6199. Several potential
70-like promoters were noted 44 to 243 bp upstream of sapC. These putative sapCDEF
promoters were oriented in the opposite direction from the
sapA promoter, with the two
35 regions separated by 200 to
380 bp. Due to the overlapping nature of the sapCDEF genes and the lack of other putative promoters, it is likely that they are
cotranscribed. No putative transcriptional terminators were evident
within the invertible region.
Similarities of SapCDEF to other proteins. The sapC ORF predicted a protein product of 344 amino acids (aa) (39.7 kDa) that had no significant similarities in the nonredundant database maintained by the National Center for Biotechnology Information. A search by the MotifFinder server also did not reveal any recognizable protein motifs in SapC, and it did not have an N-terminal sequence suggestive of extracytoplasmic localization. In contrast, the products of the sapDEF genes had high similarities to proteins encoding type I secretion systems. SapD (584 aa, 64.0 kDa) was found to be related to the ABC family of transporters, especially those that are involved in translocation by the type I secretion systems of proteases, lipases, hemolysins, and leukotoxins across the envelopes of gram-negative bacterial pathogens. The degree of similarity found between SapD and these proteins was between 68% (with P. aeruginosa AprD) and 50% (Actinobacillus actinomycetemcomitans LktB; Fig. 2). In addition, SapD contained two motifs found in such proteins, an ATP/GTP binding site (GPSAAGKS; Walker box A) and a peptide (LSGGQRQRVALA) that is a signature sequence for ABC transporters. The SapE protein (428 aa, 47.9 kDa) was similar to the MFP proteins of type I transporters, typified by P. aeruginosa AprE (52% similar) and E. coli HlyD (49% similar). SapF (434 aa, 49.4 kDa) was related to the outer membrane component of type I systems such as P. aeruginosa AprF (45% similar), E. chrysanthemi PrtF (41% similar), and E. coli TolC (47% similar). The high similarity of each of the SapD, SapE, and SapF proteins to each of the proteins of type I secretion systems suggested that these proteins are involved in the secretion of C. fetus SLPs. Since the ABC component of type I transporters is responsible for substrate recognition (46), phylogenetic analysis of these proteins (SapD and homologs) is most likely to be informative with respect to the relationships between families of type I transporters. Parsimony and bootstrap analyses supported the classification of the C. fetus and C. crescentus SLP transporters on phylogenetic branches adjacent to the protease transporters but distinct from these and other type I secretion apparatuses (Fig. 2). Parsimony analysis of the MFPs (SapE and homologs) resulted in a similar tree, supporting this conclusion (data not shown). Phylogeny based on the type I outer membrane proteins showed few significant distinctions between subfamilies of transporters (data not shown).
|
Invertible region features from type B strain 84-107. To determine whether the features found in the invertible region of type A strain 23D also were conserved in a type B strain, we sequenced the invertible region from strain 84-107. The invertible region from this strain was 6,217 bp in length and was 99.1% identical to the invertible region from strain 23D. Similar to the conserved regions at each end of the type A invertible region, the first 67 nucleotides of the type B sequence were an exact inverse repeat of the last 67 nucleotides. However, these 67-bp segments at the ends of the type B invertible region were only 68.7% identical to the analogous sequences of the type A invertible region. Similar to the type A sequence, the type B invertible region sequence predicted a probable sapCDEF operon of 5.6 kb (designated sapCDEFB). The putative sapCDEFB promoter sequences and ribosome binding sites were identical to their counterparts in the 23D invertible region (data not shown). Most of the differences between the invertible regions of 23D and 84-107 were found in the noncoding regions upstream and downstream of sapCDEF, with the coding regions sharing 99.8% nucleotide identity. Due to the high sequence similarity between the two invertible regions, the SapC, SapD, SapE, and SapF proteins from the type A and B strains were nearly identical, sharing 99.7, 100, 99.5, and 100% amino acid identity, respectively.
Construction of a sapD mutant.
To test the
hypothesis that genes in the C. fetus invertible region
encode proteins responsible for SLP secretion, we constructed a
derivative of type A strain 23D containing an insertional mutation in
sapD. Since homologs of SapD (ABC transporters) are
essential components of type I secretion systems (5, 41,
46), C. fetus mutants lacking SapD would be expected
to be secretion deficient. To generate a sapD mutation, we
chose a unique BglII site 224 bp from the upstream end of
the gene (Fig. 1). The aphA cassette from pILL600 was
inserted into this site, and transformants were selected on plates
containing kanamycin. Plasmid DNA from kanamycin-resistant E. coli colonies was analyzed by EcoRI and
HindIII digestion, and the aphA cassette was
found to have been incorporated such that sapCDEF and the
antibiotic resistance gene were transcribed in the same direction. This
new clone was designated pIR131. The sapD insert containing
the resistance fragment was subcloned into suicide vector pILL570 to
yield pILL131, which was transformed into E. coli S17-1.
Transformants were selected from trimethoprim-kanamycin plates, and
verification of pILL131 was made by digestion with HindIII. E. coli S17-1 containing IncP DNA
transfer functions and pILL131 was used as the conjugation donor, and
wild-type C. fetus 23D was the recipient. Approximately
5,000 transconjugants were recovered (frequency of 4 × 10
6 transconjugants per recipient), 6 of which were
picked for further screening. Chromosomal DNAs extracted from these six
strains were digested with NdeI for Southern analysis by
using hybridization probes for sapD, aphA, and
pILL570. The hybridization results indicated that one of these strains
(97-205) was derived from a double-crossover event in which only the
mutagenized sapD allele was incorporated into the chromosome
(data not shown). The remaining five strains produced results
consistent with single crossovers in which the pILL570 vector also was
introduced into the chromosome (data not shown). PCR experiments using
sapD- and aphA-specific primers confirmed the
Southern hybridization data (not shown). These results indicate that a
strain containing an insertional mutation in sapD was
successfully constructed.
Properties of a C. fetus sapD mutant. We next sought to determine whether the C. fetus sapD mutant 97-205 was able to export SLPs and to assemble a functional S-layer on its surface. First, we tested the abilities of the wild-type and sapD mutant strains to resist complement-mediated killing, a phenotype consistent with the presence of the S-layer. Suspensions of cells were exposed either to NHS or to HINHS, and the extent of complement-mediated killing was determined. As expected, S+ strain 23D was completely resistant to killing (Fig. 3A). In contrast, as expected, there was approximately 3 log10 killing of strain 23B, which is unable to express an S-layer (48, 59) (Fig. 3A). Results for strain 97-205, the sapD mutant, were nearly identical to those for 23B and are consistent with the absence of a functional S-layer on the surface of sapD mutant strain 97-205.
|
strain 23B
(Fig. 3B, lane 2). However, SLPs were detected neither extracellularly
nor in whole-cell samples of the sapD mutant, (Fig. 3B, lane
3). Thus, disruption of sapD by the insertion of an
antibiotic resistance cassette had the effect of eliminating SLP
expression altogether, as well as SLP secretion. It could not be
ascertained from these experiments whether the effect of the
sapD mutation on the inability to detect SLPs in the
cytoplasm was due to a regulatory effect on SLP gene expression or
whether full-length SLPs were simply degraded in the absence of a
functional secretion apparatus. Primer extension experiments indicated
that wild-type levels of sapA mRNA were present in strain
97-205 (Fig. 4), showing that potential
regulatory effects of the sapD mutation on SapA expression
did not occur through diminished sapA transcription.
|
Secretion of SapA by E. coli expressing sapCDEF. We had cloned the PCR-amplified sapCDEF-containing invertible region (pIR100) for use as a hybridization probe with which to identify genomic clones as described above. To determine whether sapCDEF permits the secretion of SapA, we tested the ability of E. coli strains carrying pIR100 to mediate the specific secretion of C. fetus SapA (Fig. 5). E. coli C600 strains were isolated that contained pBGYC1, a pACYC184-derived plasmid containing C. fetus sapA, and either pIR100 (sapCDEF) or pSPORT1 (vector control). SapA secretion was assayed by using immunoblots to indicate the appearance of SapA in filtered, TCA-precipitated culture supernatants prepared from these strains. As expected (10), both E. coli strains produced SapA (Fig. 5, whole-cell proteins). Secretion of SapA was detected only in supernatants from E. coli cells expressing sapCDEF (Fig. 5, lane 4). These results indicate that the C. fetus sapCDEF genes are sufficient to allow E. coli to secrete SapA.
|
Conserved features of SLP C termini. Proteins that are transported by type I secretion systems do not have the N-terminal signal peptides that are conserved in proteins exported by type II systems, instead relying on signals that are located at their extreme C termini (51, 61). However, these signals tend to have little primary sequence homology, and their exact structures have been difficult to elucidate. In an attempt to define candidate sequences or structures for C-terminal secretion signals in bacterial SLPs, we aligned the C-terminal 70 aa of four C. fetusSLPs for which the sequences are known (SapA, SapA1, SapA2, and SapB), as well as RsaA, the SLP from C. crescentus (9). Several conserved peptides were evident (Fig. 6). The sequences GDGS(T/G), GxTYVV(V/I)D, and DxxIKLxG were each present in at least four of the five SLPs (Fig. 6). The DVIV motifs implicated in protease secretion (33) were not present per se at the extreme C terminus of any of the SLPs, although a similar sequence (DGSVI) was found at the C termini of the SapA and SapB proteins (Fig. 6). Similar to type I secreted toxins and related exoproteins (56, 58), the SLPs had one to four hydroxylated residues (S or T) within the C-terminal 10 amino acids.
|
-helix,
-sheet, amphipathic
peptides, and turn-forming residues) were then superimposed on the
alignment of the five C-terminal peptides. Four of these peptides
(SapA, SapA1, SapB, and RsaA) consisted of segments predicted to form a
sheet-sheet-helix-sheet structure, with turn-forming residues
separating the domains (Fig. 6). The C-terminal domain of SapA2 was
predicted to form a helix-sheet-helix-sheet structure. Furthermore, the
sheet-forming regions of all five proteins, as well as the most
N-terminal helix-forming region of SapA2, were predicted to be
amphipathic. Taken together, these results suggest that the C termini
of four C. fetus SLPs and one C. crescentus SLP
contain conserved sequences and secondary structures that are
candidates for secretion signals.
Since SapC did not have any database homologies, yet sapC
was situated immediately upstream of sapDEF, we also
compared the C terminus of SapC to the conserved SLP C termini. The C
terminus of SapC did not at all resemble the C termini of the other
proteins (data not shown); therefore, it is likely that SapC is not
secreted by the C. fetus type I system.
| |
DISCUSSION |
|---|
|
|
|---|
Three genes in the sapA invertible region
(sapDEFA) and in the homologous sapB
invertible region (sapDEFB) encode proteins that
are homologous to type I transporters, typified by the E. coli
-hemolysin and S. marcescens LipB lipase
secretion systems. The sapDEF genes are adjacent to the
sapA homologs that encode the proteins that are substrates
for the C. fetus type I secretion system. Genes encoding
type I secretion systems of other bacteria often show such a clustered
arrangement (51, 61), although the gene encoding the outer
membrane component is not necessarily adjacent (2, 4, 51).
The first gene, sapC, predicts a protein that has no
database homologies, no amino acid motifs, and no other recognizable
features such as signal sequences or helix-turn-helix structures.
Furthermore, since the C-terminal 100 aa bore little resemblance to
those of the SLPs and proteases, SapC does not appear to be another
substrate for the SapDEF secretion apparatus. Therefore, the function
of SapC is unclear.
Some aspects of type I secretion systems have been well characterized, and studies by a number of researchers have yielded the following model of type I secretion. Three proteins form the secretion apparatus. ABC transporters homologous to SapD (e.g., HlyB and PrtD) localize to the cytoplasmic membrane, probably as homodimers (41, 61), and serve a number of functions in the initial stages of the transport process. ATP hydrolysis by the ABC protein plays a role in energizing the secretion process (40). Recognition of the C terminus of the secreted protein by the ABC protein sequesters, in turn, the MFP and the outer membrane proteins, completing the assembled apparatus (46). The MFP is located mostly within the cytoplasmic membrane but is thought also to associate with the outer membrane and mediate its juxtaposition with the cytoplasmic membrane (18). The outer membrane protein (TolC homolog) may serve as a pore through which the secreted protein is extruded (42). The secreted proteins are devoid of multiple cysteine residues and therefore lack disulfide bridges during their transit through both membranes. The high degree of conservation between each of the C. fetus transport proteins and each constituent of other type I transporters strongly suggests that the secretion mechanism of SLPs is similar to that shown for other proteins. However, the phylogram generated from comparisons of the ABC components of the secretion apparatus (Fig. 2) shows that the C. fetus and C. crescentus systems represent a third family of type I transporter, divergent from the toxin or protease transporters.
Analysis of the sequence of the C terminus of E. coli
-hemolysin revealed a potential signal consisting of a charged
region, followed by an amphipathic
-helix, and a number of
hydroxylated amino acid residues at the extreme C terminus of the
protein (56). The importance of these structures, as well as
of individual amino acid residues was supported by mutational analyses
(16, 39, 56). Similar features are found in the C termini of
other exoproteins that can be secreted by the HlyBD secretion apparatus
(58). In contrast, these features are not universally found
in other proteins secreted by type I systems. For example, in
proteases, a C-terminal amino acid motif of DVIV is involved in
secretion (33, 64). This exact motif is found in neither
type I-secreted toxins nor SLPs. The remainder of the C termini among
type I-secreted proteases, lipases, and the S. marcescens
heme-binding protein HasA share few structural similarities, although
amphipathic
-helices have been proposed as components of secretion
signals of some of these (21, 56, 58, 64). Nevertheless,
many of these proteins can be secreted by heterologous type I
transporters (5, 21, 45, 47, 57), suggesting the
conservation of secretion signals within divergent C termini.
It is likely that the secretion signals of C. fetus SLPs are
located at the C termini of the proteins, for the following reasons. None of the four characterized SLPs has an N-terminal signal sequence (10, 26, 27, 60). A 50-kDa C terminally truncated form of
SapA was not secreted by C. fetus, suggesting that the
signal directing its transport was located at the C terminus of the
protein (14). Furthermore, E. coli K-12 strains
are unable to secrete SapA (10; this work),
suggesting that proteins different than the E. coli type II
(sec) apparatus are necessary for its transport. Now we have
shown that type I secretion proteins are responsible for transporting
C. fetus SLPs to the cell surface, and with the exception of
colicin V (34), the signals recognized by type I
transporters are found at the extreme C terminus of the secreted protein (61). The SLP of C. crescentus, which
also is secreted by a type I system, contains a secretion signal within
its C-terminal 242 aa (7). Alignment of the C-terminal 70 aa
of four C. fetus and one C. crescentus SLPs
revealed a surprisingly large number of conserved amino acid residues
(Fig. 6). In fact, the C termini of C. fetus SapA and SapB
appeared to be more closely related to that of C. crescentus
RsaA than to the C termini of the C. fetus SapA1 and SapA2
proteins. These conserved residues, as well as predicted
-sheet and
-helical regions, provide attractive targets for mutational analyses
in determining the important components of SLP C-terminal secretion
signals. The availability of several related C. fetus SapA
homologs with somewhat different C termini allows the testing of a
variety of hypotheses regarding the secretion signals and offers
advantages to comparing the structures of type I-secreted proteins from
heterologous bacterial species.
The mutation of sapD had an inhibitory effect on SapA
synthesis by C. fetus 97-205, although this is most likely
related to the inability of the sapD mutant to export SLPs.
Since SLPs are the most abundant protein produced by C. fetus, their accumulation in the cytoplasm would probably be
deleterious to growth or viability. The detection of wild-type levels
of sapA mRNA in the sapD mutant precludes the
possibility that a mutation occurred (in either sapD or
another locus) that ablated transcription from the sapA promoter. We therefore consider two main possibilities for the lack of
detection of SLPs in the C. fetus sapD mutant. First, nonsecreted SLPs may simply be degraded. Smit and colleagues were unable to detect derivatives of C. crescentus RsaA resulting
from disruption of the C-terminal secretion signal, presumably due to
the degradation of the secretion-deficient protein (7). A
similar phenomenon previously had been noted for nonsecreted E. coli
-hemolysin (16), P. aeruginosa AprA,
or hybrids of AprA with Pseudomonas fluorescens lipase
(20, 21, 36). Therefore, the disruption of the secretion
process of these proteins may necessitate their degradation. Second,
the accumulation of SLPs within the cytoplasm may have an inhibitory
effect on their own synthesis at a posttranscriptional level. It seems
desirable for the expression of such an abundant protein to be tightly
regulated, and in fact, this occurs with the SLPs of Thermus
thermophilus (29). Although the T. thermophilus SLPs are secreted by the general secretory pathway
(type II secretion), recent studies have shown that the C terminus of
the T. thermophilus SLP is able to bind to the 127-bp 5'
untranslated region (UTR) of its own message and inhibit SLP synthesis
(29). The C. fetus sapA mRNA has a highly
structured 114-bp 5' UTR, and it is possible that a similar repression
of SLP synthesis occurs in C. fetus. If C. fetus
SLPs can inhibit their own synthesis in such a manner, then it is
probably also dependent on the C-terminal half of the protein, since
the expression of a 50-kDa N-terminal (secretion-deficient) fragment of
SapA is tolerated (14). We cannot rule out either of these
hypotheses, and further studies, such as pulse-chase labeling of SLPs
to examine protein turnover and genetic studies with SLPs truncated at
the C terminus, will address these possibilities.
That sapCDEF are sufficient for the secretion of C. fetus SLPs was demonstrated by the ability of these genes to direct the transport of SapA from E. coli. Therefore, it appears that, similar to other type I systems, three proteins (SapDEF) are probably necessary and sufficient for the secretion of C. fetus SLPs. In contrast to the inability to detect nonsecreted SLPs in C. fetus, large quantities of SapA are present in E. coli lacking sapCDEF. This difference may have been due to the 5' UTR of sapA in the clone used in this secretion experiment. The sapA gene encoded by pBGYC1 is not expressed from its native promoter and has only 23 bp of the 114-bp 5' UTR found in C. fetus sapA homologs (10). The ability to reconstruct the C. fetus SLP secretion system in E. coli now facilitates genetic studies intended to define the interactions between SapA and the SapDEF transport apparatus and to investigate the possible autoregulation of sapA.
We have characterized the SapDEF system that is responsible for the secretion of C. fetus SLPs and shown that it is a related but somewhat divergent member of the type I secretion family. Future studies intended to define the C-terminal secretion signals of C. fetus SLPs and their recognition by the SapDEF apparatus, as well as by heterologous type I transporters, may provide new insight into transporter-substrate interactions within these systems.
| |
ACKNOWLEDGMENT |
|---|
This work was supported in part by R01A124145 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Infectious Diseases, Vanderbilt University School of Medicine, MCN A-3310, Nashville, TN 37232-2605. Phone: (615) 322-2035. Fax: (615) 343-6160. E-mail: thompssa{at}ctrvax.vanderbilt.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1997. Current protocols in molecular biology, vol. 1. John Wiley & Sons, Inc., New York, N.Y. |
| 2. |
Awram, P., and J. Smit.
1998.
The Caulobacter crescentus paracrystalline S-layer protein is secreted by an ABC transporter (type I) secretion apparatus.
J. Bacteriol.
180:3062-3069 |
| 3. | Bachman, B. J. 1987. Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p. 1190-1219. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. 2. American Society for Microbiology, Washington, D.C. |
| 4. | Binet, R., and C. Wandersman. 1997. Cloning of the Serratia marcescens hasF gene encoding the Has ABC exporter outer membrane component: a TolC analogue. Mol. Microbiol. 22:265-273. |
| 5. | Binet, R., and C. Wandersman. 1995. Protein secretion by hybrid bacterial ABC-transporters: specific functions of the membrane ATPase and the membrane fusion protein. EMBO J. 14:2298-2306[Medline]. |
| 6. | Bingle, W. H., K. D. Le, and J. Smit. 1996. The extreme N-terminus of the Caulobacter crescentus S-layer protein directs export of passenger proteins from the cytoplasm but is not required for secretion of the native protein. Can. J. Microbiol. 42:672-684[Medline]. |
| 7. |
Bingle, W. H.,
J. F. Nomellini, and J. Smit.
1997.
Linker mutagenesis of the Caulobacter crescentus S-layer protein: toward a definition of an N-terminal anchoring region and a C-terminal secretion signal and the potential for heterologous protein secretion.
J. Bacteriol
179:601-611 |
| 8. | Bingle, W. H., and J. Smit. 1994. Alkaline phosphatase and a cellulase reporter are not exported from the cytoplasm when fused to large N-terminal portions of the Caulobacter crescentus S-layer protein. Can. J. Microbiol. 40:777-782[Medline]. |
| 9. | Bingle, W. H., S. G. Walker, and J. Smit. 1993. Definition of form and function for the S-layer of Cavlobacter crescentus, p. 181-194. In T. L. Beveridge, and S. F. Koval (ed.), Advances in paracrystalline bacterial surface layers. Plenum Press, New York, N.Y. |
| 10. |
Blaser, M. J., and E. C. Gotschlich.
1990.
Surface array protein of Campylobacter fetus: cloning and gene structure.
J. Biol. Chem.
265:14529-14535 |
| 11. | Blaser, M. J., and Z. Pei. 1993. Pathogenesis of Campylobacter fetus infections: critical role of high-molecular-weight S-layer proteins in virulence. J. Infect. Dis. 167:372-377[Medline]. |
| 12. | Blaser, M. J., P. F. Smith, and P. A. Kohler. 1985. Susceptibility of Campylobacter isolates to the bactericidal activity in human serum. J. Infect. Dis. 151:227-235[Medline]. |
| 13. | Blaser, M. J., P. F. Smith, J. E. Repine, and K. A. Joiner. 1988. Pathogenesis of Campylobacter fetus infections: failure of encapsulated Campylobacter fetus to bind C3b explains serum and phagocytosis resistance. J. Clin. Invest. 81:1434-1444. |
| 14. | Blaser, M. J., E. Wang, M. K. R. Tummuru, R. Washburn, S. Fujimoto, and A. Labigne. 1994. High-frequency S-layer protein variation in Campylobacter fetus revealed by sapA mutagenesis. Mol. Microbiol. 14:453-462[Medline]. |
| 15. | Boot, H. J., and P. H. Pouwels. 1996. Expression, secretion and antigenic variation of bacterial S-layer proteins. Mol. Microbiol. 21:1117-1123[Medline]. |
| 16. |
Chervaux, C., and I. B. Holland.
1996.
Random and directed mutagenesis to elucidate the functional importance of helix II and F-989 in the C-terminal secretion signal of Escherichia coli hemolysin.
J. Bacteriol.
178:1232-1236 |
| 17. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 18. |
Dinh, T.,
I. T. Paulsen, and M. H. Saier, Jr.
1994.
A family of extracytoplasmic proteins that allow transport of large molecules across the outer membranes of gram-negative bacteria.
J. Bacteriol.
176:3825-3831 |
| 19. |
Dubreuil, J. D.,
M. Kostrzynska,
J. W. Austin, and T. J. Trust.
1990.
Antigenic differences among Campylobacter fetus S-layer proteins.
J. Bacteriol.
172:5035-5043 |
| 20. | Duong, F., A. Lazdunski, and M. Murgier. 1996. Protein secretion by heterologous bacterial transporters: the C-terminus secretion signal of the secreted protein confers high recognition specificity. Mol. Microbiol. 21:459-470[Medline]. |
| 21. | Duong, F., C. Soscia, A. Lazdunski, and M. Murgier. 1994. The Pseudomonas fluorescens lipase has a C-terminal secretion signal and is secreted by a three-component bacterial ABC-exporter system. Mol. Microbiol. 11:1117-1126[Medline]. |
| 22. | Dworkin, J., and M. J. Blaser. 1996. Generation of Campylobacter fetus S-layer protein diversity utilizes a single promoter on an invertible DNA segment. Mol. Microbiol. 19:1241-1253[Medline]. |
| 23. | Dworkin, J., and M. J. Blaser. 1997. Molecular mechanisms of Campylobacter fetus surface layer protein expression. Mol. Microbiol. 26:433-440[Medline]. |
| 24. |
Dworkin, J., and M. J. Blaser.
1997.
Nested DNA inversion as a paradigm of programmed gene rearrangement.
Proc. Natl. Acad. Sci. USA
94:985-990 |
| 25. |
Dworkin, J.,
O. L. Shedd, and M. J. Blaser.
1997.
Nested DNA inversion of Campylobacter fetus S-layer genes is recA dependent.
J. Bacteriol.
179:7523-7529 |
| 26. |
Dworkin, J.,
M. K. R. Tummuru, and M. J. Blaser.
1995.
A lipopolysaccharide-binding domain of the Campylobacter fetus S-layer protein resides within the conserved N terminus of a family of silent and divergent homologs.
J. Bacteriol.
177:1734-1741 |
| 27. |
Dworkin, J.,
M. K. R. Tummuru, and M. J. Blaser.
1995.
Segmental conservation of sapA sequences in type B Campylobacter fetus cells.
J. Biol. Chem.
270:15093-15101 |
| 28. |
Felmlee, T.,
S. Pellett,
E.-Y. Lee, and R. A. Welch.
1985.
Escherichia coli hemolysin is released extracellularly without cleavage of a signal peptide.
J. Bacteriol.
163:88-93 |
| 29. | Fernandez-Herrero, L. A., G. Olabarria, and J. Berenguer. 1997. Surface proteins and a novel transcription factor regulate the expression of the S-layer gene in Thermus thermophilus HB8. Mol. Microbiol. 24:61-72[Medline]. |
| 30. |
Forsyth, M. H.,
J. C. Atherton,
M. J. Blaser, and T. L. Cover.
1998.
Heterogeneity in levels of vacuolating cytotoxin gene (vacA) transcription among Helicobacter pylori strains.
Infect. Immun.
66:3088-3094 |
| 31. | Fujita, M., T. Morooka, S. Fujimoto, T. Moriya, and K. Amako. 1995. Southern blotting analyses of strains of Campylobacter fetus using the conserved region of sapA. Arch. Microbiol. 164:444-447[Medline]. |
| 32. | Garnier, J., D. J. Osguthorpe, and B. Robson. 1978. Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J. Mol. Biol. 120:97-120[Medline]. |
| 33. |
Ghigo, J. M., and C. Wandersman.
1994.
A carboxy-terminal four amino acid motif is required for secretion of the metalloprotease PrtG through the Erwinia chrysanthemi protease secretion pathway.
J. Biol. Chem.
269:1-7 |
| 34. | Gilson, L., H. K. Mahanty, and R. Kolter. 1990. Genetic analysis of an MDR-like export system: the secretion of colicin V. EMBO J. 9:3875-3884[Medline]. |
| 35. | Guerrant, R. L., R. G. Lahita, W. C. Winn, and R. B. Roberts. 1978. Campylobacteriosis in man: pathogenic mechanisms and review of 91 bloodstream infections. Am. J. Med. 65:584-592[Medline]. |
| 36. |
Guzzo, J.,
J.-M. Pages,
F. Duong,
A. Lazdunski, and M. Murgier.
1991.
Pseudomonas aeruginosa alkaline protease: evidence for secretion genes and study of secretion mechanism.
J. Bacteriol.
173:5290-5297 |
| 37. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557[Medline]. |
| 38. | Kawai, E., H. Akatsuka, A. Idei, T. Shibatani, and K. Omori. 1998. Serratia marcescens S-layer protein is secreted extracellularly via an ATP-binding cassette exporter, the Lip system. Mol. Microbiol. 27:941-952[Medline]. |
| 39. | Kenny, B., S. Taylor, and I. B. Holland. 1992. Identification of individual amino acids required for secretion within the haemolysin (HlyA) C-terminal targeting region. Mol. Microbiol. 6:1477-1489[Medline]. |
| 40. | Koronakis, E., C. Hughes, I. Milislav, and V. Koronakis. 1995. Protein exporter function and in vitro ATPase activity are correlated in ABC-domain mutants of HlyB. Mol. Microbiol. 16:87-96[Medline]. |
| 41. | Koronakis, V., and C. Hughes. 1996. Synthesis, maturation and export of the E. coli hemolysin. Med. Microbiol. Immunol. 185:65-71[Medline]. |
| 42. | Koronakis, V., J. Li, E. Koronakis, and K. Stauffer. 1997. Structure of TolC, the outer membrane component of the bacterial type I efflux system, derived from two-dimensional crystals. Mol. Microbiol. 23:617-626[Medline]. |
| 43. |
Labigne, A.,
V. Cussac, and P. Courcoux.
1991.
Shuttle cloning and nucleotide sequences of Helicobacter pylori genes responsible for urease activity.
J. Bacteriol.
173:1920-1931 |
| 44. |
Labigne-Roussel, A.,
P. Courcoux, and L. Tompkins.
1988.
Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter jejuni.
J. Bacteriol.
170:1704-1708 |
| 45. |
Létoffé, S.,
P. Delepelaire, and C. Wandersman.
1991.
Cloning and expression in Escherichia coli of the Serratia marcescens metalloprotease gene: secretion of the protease from E. coli in the presence of the Erwinia chrysanthemi protease secretion functions.
J. Bacteriol.
173:2160-2166 |
| 46. | Létoffé, S., P. Delepelaire, and C. Wandersman. 1996. Protein secretion in Gram-negative bacteria: assembly of the three components of ABC protein-mediated exporters is ordered and promoted by substrate binding. EMBO J. 15:5804-5811[Medline]. |
| 47. |
étoffé, S., and C. Wandersman.
1992.
Secretion of CyaA-PrtB and HlyA-PrtB fusion proteins in Escherichia coli: involvement of the glycine-rich repeat domain of Erwinia chrysanthemi protease B.
J. Bacteriol.
174:4920-4927 |
| 48. |
McCoy, E. C.,
D. Doyle,
K. Burda,
L. B. Corbeil, and A. J. Winter.
1975.
Superficial antigens of Campylobacter (Vibrio) fetus: characterization of an antiphagocytic component.
Infect. Immun.
11:517-525 |
| 49. | Pei, Z., and M. J. Blaser. 1990. Pathogenesis of Campylobacter fetus infections: role of surface array proteins in virulence in a mouse model. J. Clin. Invest. 85:1036-1043. |
| 50. |
Pei, Z.,
R. T. I. Ellison,
R. Lewis, and M. J. Blaser.
1988.
Purification and characterization of a family of high molecular weight surface-array proteins from Campylobacter fetus.
J. Biol. Chem.
263:6416-6420 |
| 51. | Salmond, G. P. C., and P. J. Reeves. 1993. Membrane traffic wardens and protein secretion in gram-negative bacteria. Trends Biochem. Sci. 18:8-12. |
| 52. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1987. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 53. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Bio/Technology 1:784-791. |
| 54. | Sleytr, U. B., P. Messner, D. Pum, and M. Sara. 1993. Crystalline bacterial surface layers. Mol. Microbiol. 10:911-916[Medline]. |
| 55. | Smibert, R. M. 1978. The genus Campylobacter. Annu. Rev. Microbiol. 32:673-709[Medline]. |
| 56. | Stanley, P., V. Koronakis, and C. Hughes. 1991. Mutational analysis supports a role for multiple structural features in the C-terminal secretion signal of Escherichia coli haemolysin. Mol. Microbiol. 5:2391-2403[Medline]. |
| 57. |
Suh, Y., and M. J. Benedik.
1992.
Production of active Serratia marcescens metalloprotease from Escherichia coli by -hemolysin HlyB and HlyD.
J. Bacteriol.
174:2361-2366 |
| 58. |
Thompson, S. A., and P. F. Sparling.
1993.
The RTX cytotoxin-related FrpA protein of Neisseria meningitidis is secreted extracellularly by meningococci and by HlyBD+ Escherichia coli.
Infect. Immun.
61:2906-2911 |
| 59. |
Tummuru, M. K. R., and M. J. Blaser.
1992.
Characterization of the Campylobacter fetus sapA promoter: evidence that the sapA promoter is deleted in spontaneous mutant strains.
J. Bacteriol.
174:5916-5922 |
| 60. |
Tummuru, M. K. R., and M. J. Blaser.
1993.
Rearrangement of sapA homologs with conserved and variable regions in Campylobacter fetus.
Proc. Natl. Acad. Sci. USA
90:7265-7269 |
| 61. | Wandersman, C. 1992. Secretion across the bacterial outer membrane. Trends Genet. 8:317-321[Medline]. |
| 62. |
Wang, B.,
E. Kraig, and D. Kolodrubetz.
1998.
A new member of the S-layer protein family: characterization of the crs gene from Campylobacter rectus.
Infect. Immun.
66:1521-1526 |
| 63. |
Wilson, H. R.,
C. D. Archer,
J. Liu, and C. L. Turnbough, Jr.
1992.
Translational control of pyrC expression mediated by nucleotide-sensitive selection of transcriptional start sites in Escherichia coli.
J. Bacteriol.
174:514-524 |
| 64. | Wolff, N., J.-M. Ghigo, P. Delepelaire, C. Wandersman, and M. Delepierre. 1994. C-terminal secretion signal of an Erwinia chrysanthemi protease secreted by a signal peptide-independent pathway: proton NMR and CD conformational studies in membrane-mimetic environments. Biochemistry 33:6792-6801[Medline]. |
This article has been cited by other articles:
| ||||||||||||||