Previous Article | Next Article 
Journal of Bacteriology, December 1998, p. 6681-6688, Vol. 180, No. 24
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The First Gene of the Bacillus subtilis clpC Operon,
ctsR, Encodes a Negative Regulator of Its Own
Operon and Other Class III Heat Shock Genes
Elke
Krüger and
Michael
Hecker*
Institut für Mikrobiologie und
Molekularbiologie, Ernst-Moritz-Arndt-Universität, D-17487
Greifswald, Germany
Received 3 August 1998/Accepted 6 October 1998
 |
ABSTRACT |
The Bacillus subtilis clpC operon is regulated by two
stress induction pathways relying on either
B or a class
III stress induction mechanism acting at a
A-like
promoter. When the clpC operon was placed under the
control of the isopropyl-
-D-thiogalactopyranoside
(IPTG)-inducible Pspac promoter, dramatic
repression of the natural clpC promoters fused to a
lacZ reporter gene was noticed after IPTG induction. This result strongly indicated negative regulation of the clpC
operon by one of its gene products. Indeed, the negative regulator
could be identified which is encoded by the first gene of the
clpC operon, ctsR, containing a predicted
helix-turn-helix DNA-binding motif. Deletion of ctsR
abolished the negative regulation and resulted in high expression of
both the clpC operon and the clpP gene under nonstressed conditions. Nevertheless, a further increase in
clpC and clpP mRNA levels was observed after
heat shock, even in the absence of
B, suggesting a
second induction mechanism at the vegetative promoter. Two-dimensional
gel analysis and mRNA studies showed that the expression of other class
III stress genes was at least partially influenced by the
ctsR deletion. Studies with different clpC
promoter fragments either fused to the reporter gene bgaB
or used in gel mobility shift experiments with the purified CtsR
protein revealed a possible target region where the repressor seemed to
bind in vivo and in vitro. Our data demonstrate that the CtsR protein acts as a global repressor of the clpC operon, as well as
other class III heat shock genes, by preventing unstressed
transcription from either the
B- or
A-dependent promoter and might be inactivated or
dissociate under inducing stress conditions.
 |
INTRODUCTION |
In response to changes in their
natural environment, bacteria undergo a complex program of differential
gene expression. External signals are recognized by complex signal
transduction pathways via two-component systems, are transmitted by
transcriptional regulators and alternative
factors, and elicit
dramatic changes in bacterial gene expression.
Previous investigations have demonstrated that the heat shock response
of Bacillus subtilis is regulated by at least three different mechanisms at the level of transcription (for a review, see
reference 11). Induction of class I heat shock
genes, such as the classical chaperone genes dnaK and
groESL, is triggered strongly after exposure to either heat
shock or stresses that generate nonnative proteins in the cell
(27). Both operons were shown to be negatively controlled by
the HrcA repressor interacting with its operator site, CIRCE (35,
49-51). Recently, activation of the HrcA repressor by the GroE
chaperonin machine was demonstrated, pointing out a function of GroE as
a modulator of the class I heat shock response in B. subtilis (26).
In addition to heat shock, class II genes are induced in response
to various other stresses, as well as energy starvation. This large
group of general stress genes requires the alternative sigma factor
B for induction (for reviews, see references 9,
11, and 12).
B activity is
controlled by a complex signal transduction network including at least
seven other gene products encoded by the sigB operon
(1, 9, 45, 47).
Class III heat shock genes of B. subtilis were defined as
general stress genes that remain inducible at vegetative promoters in
response to several stresses in a sigB mutant background and in the absence of CIRCE and HrcA. These general stress genes might comprise a heterogeneous group encoding predominantly ATP-dependent proteases and their regulatory ATPase components. Besides the protease/chaperone genes, lon, ftsH,
clpP, clpC, clpX, and htpG, thioredoxin gene trxA, and alkylhydroperoxide reductase
operon ahpCF were also grouped into this class
(2, 5, 7, 8, 21, 31, 34, 36). With respect to their
regulation, a subgroup of class III stress genes could be determined,
namely, the clpC operon and the clpP and
trxA genes. Genes constituting this subgroup are regulated
by two stress induction pathways relying on either
B or
a novel stress induction mechanism acting at a vegetative
A-like promoter (7, 19, 34). On the basis of
earlier studies, we suggested that initiation of transcription seems to
be the predominant target of regulation, involving a repression
mechanism, as well as positive regulation at the
A-like
promoter (19).
The ClpC ATPase of B. subtilis, involved in controlling
competence gene expression, degradative enzyme production,
sporulation, cell division, and survival under stress
conditions (18, 21, 28, 29, 42), is encoded by the fourth
gene of a six-gene operon (19). To study the functions of
the other five, unknown, gene products encoded by the clpC
operon, database analyses were performed and phenotypes of mutants were
investigated. The second and third genes encode proteins with
similarities to zinc finger proteins (orf2) and arginine
kinases (orf3), respectively (20). By phenotypic
studies of mutants with changes in the fifth (sms) and sixth
(comY) genes, evidence for the involvement of both proteins in DNA repair and competence was obtained (20).
For the product of the first gene, orf1 (yacG or
ctsR) (20, 23), a predicted helix-turn-helix
DNA-binding motif was detected by the method of Dodd and Egan
(6), suggesting a regulatory role for this protein
(20). Recently, this regulatory role was confirmed
independently by two groups (4, 17). Derré and Msadek
(4) renamed the protein CtsR for class three stress gene
repressor. In this communication, the regulation of clpC operon expression by CtsR was analyzed as a model of the
molecular basis of the class III stress induction mechanism.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and culture conditions.
The
bacterial strains and plasmids used in this study are listed in Table
1. Escherichia coli was
routinely grown in Luria-Bertani (LB) medium. B. subtilis
was cultivated under vigorous agitation at 37°C in LB medium or in a
synthetic medium previously described (40). Since
clpC mutant cells showed impaired growth in minimal medium
(21, 22), the culture was supplemented with 0.05% (wt/vol) yeast extract. The different stress conditions were produced as described earlier (44). Briefly, the culture was divided
during exponential growth, and one half of the culture was grown at
37°C (control), whereas the other half was exposed to heat shock at 48 or 50°C. Glucose starvation was accomplished by cultivating the
bacteria in synthetic medium with limiting amounts of glucose (0.05%
[wt/vol]). Samples were taken during exponential growth immediately
prior to the shift or after the shift at the time indicated. The time
of the shift was defined as time zero.
Analysis of mRNA.
Total RNA of B. subtilis IS58
was isolated by the acid phenol method from exponentially growing
(control) and stressed cells as previously described (19).
Serial dilutions of total RNA were transferred onto a positively
charged nylon membrane by slot blotting and hybridized with
digoxigenin-labeled RNA probes in accordance with the manufacturer's
(Boehringer Mannheim) instructions. All filters were exposed to Fuji RX
films, and the volumes (i.e., the sum of the pixel values within an
object) were quantitated with a Personal Densitometer from Molecular
Dynamics. Digoxigenin-labeled RNA probes were synthesized in vitro with
T7 or T3 RNA polymerase specific for clpC, clpP,
clpX, lonA, trxA, dnaK, and
ctc as described earlier (7, 8, 21, 31, 34, 44).
The transcription initiation sites of the operon were
identified by the primer extension method by means of reverse
transcriptase
(Stratagene) and [

-
32P]ATP
5'-labelled primer PE1 (CCATTTTGATCTAACACTCG). The
corresponding
sequence was obtained from plasmid pUP1 (
19).
Primer extension
experiments were performed as described by Wetzstein
et al. (
46).
-Galactosidase assay.
For assay of both LacZ and BgaB
activities, B. subtilis cells were grown in LB or synthetic
medium as indicated in Results. Samples (1 ml) were taken during
exponential growth, after entry into stationary phase, and 30 min after
heat shock at 50°C.
-Galactosidase activities were determined
after permeabilizing the cells with chloroform and sodium dodecyl
sulfate in accordance with the method of Kenney and Moran
(15). For measurement of BgaB activity, the assay buffer was
modified as described by Yuan and Wong (49) and an
incubation temperature of 60°C was used.
Construction of mutant strains and reporter gene fusions.
Strain BEO2 was constructed by cloning of the 268-bp
HindIII/BamHI fragment obtained with primers
TM-120 (AAGGAAGCTTAAAGGAGGGGGTTGAGTGGGAC) and TM-103
(GGAGGATCCTTATTGATCAGGACAACTTCATTG) into plasmid
pHV501 (43) and transforming competent cells with the
resulting plasmid, pHORF1.
Transcriptional fusions of
ctsR with
bgaB
encoding a heat-stable

-galactosidase were constructed by using
plasmid pDL (
49).
The 271-bp
EcoRI/
BamHI fragment of pMEC56 (
19)
was cloned into
pDL, giving plasmid pDL56. Several deletions in the
promoter region
were generated by PCR using primers EK15
(GAAGAATTCCGAGAAAGTTGAAATTCTCG)
and TM-111
(GGAGGATCCGAAATATTATGTCCCACTCAACC), primers TM-110
(GAAGAATTCAGGACGCCGCCAAGCAAGCTTAAACCC) and EK16
(GGAGGATCCGACTTTAATCTTACTATAAGCCG),
and primers EK15
and EK16. All PCR products were cloned as
EcoRI/
BamHI
fragments into pDL, resulting in
plasmids pDL61, pDL84, and pDL85,
respectively. Linearized pDL
derivatives were integrated into
the
amyE site of the
chromosome by a double-crossover recombination
event, giving strains
BEK49, BEK61, BEK84, and BEK85. The corresponding
strains bearing
the
sigB deletion were obtained by transforming
BEK49,
BEK61, BEK84, and BEK85 with chromosomal DNA of
sigB mutant
BEK38. Transformants carrying chromosomal
lacZ fusions in
amyE were screened for expression of

-galactosidase
activity and deficiency
of

-amylase activity. Transformants were
picked on LB agar plates
containing 1% (wt/vol) starch, and
starch degradation was detected
by sublimating iodine onto the
plates. LacZ or BgaB activity was
visualized on plates by
5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside
(X-Gal;
100 µg/ml)
hydrolysis.
To alter antibiotic resistance in the
amyE or
sigB gene, plasmids pCm::Nm and pCm::Er
(
38) were used as indicated in Table
1. Transformants were
tested for chloramphenicol sensitivity
and neomycin or
erythromycin resistance,
respectively.
A nonpolar in-frame deletion of the
ctsR gene was generated
by using plasmid pDORF1. Construction of plasmid pDORF1 was performed
by cloning of a 911-bp
KpnI/blunt PCR fragment (primers
PORF1DELUPF
[GGTGGTACCATCGCTCAACGGATAAAAGC] and
PORF1DELUPR [AGAAATATTATGTCCCACTCAACC])
covering the
region upstream of
ctsR and the first six
codons
of the
ctsR gene into pBluescriptSK.
Behind this fragment, a 409-bp
blunt/
BamHI PCR fragment
(primers PORF1DELDF [CGTGATGAATTAAGAGCGAG]
and TM-115
[GGAGGATCCATGCAGGAACTCAAATGTTCA]) was inserted covering
the last 19 codons of
ctsR and part of the downstream
orf2 gene.
For selection in
B. subtilis, a
kanamycin resistance determinant,
aphAIII (
41),
was cloned into the unique
HindIII site upstream
of the
two promoters.
ctsR deletion strain BEK86 was obtained
after
linearizing plasmid pDORF1 with
ScaI and transforming
B. subtilis BEK49 cells bearing the wild-type
promoter-
bgaB fusion.
Positive candidates were selected for
kanamycin resistance and
blue colonies at 37°C and verified by PCR. A
double-crossover
recombination event at the correct sites resulted in
the following
chromosomal situation for the
ctsR deletion
strain. A kanamycin
resistance cassette upstream of the deletion was
followed by the
entire regulatory region of the
clpC
operon and the truncated
ctsR gene containing the
first six codons, as well as the last
19 codons. The genetic structure
and expression of the complete
downstream part of the operon
were not influenced by this deletion,
as confirmed by PCR and mRNA slot
blot analysis with a
clpC probe.
orf2 was disrupted by integration of plasmid pDORF2, a
derivative of pHT181 (
24) carrying a 136-bp internal
BamHI fragment
of
orf2 amplified by PCR with
primers TM-114 (GGAGGATCCATGCAGGAACTCAAATGTTCA)
and TM-115.
The mutant strain obtained was BEK21. A 263-bp internal
fragment of
orf3 was amplified by PCR using primers TM-104
(GGAGGATCCACACCTTTAGAAAAGCGTGT)
and TM-105
(GGAGGATCCGGACAGCTGGTTAAGTATCCTCTT) and cloned into
the
BamHI site of plasmid pHT181 (
24) to give plasmid
pMEC55.
Transformation of
B. subtilis resulted in a
Campbell-type integration
event generating BEK8 containing two copies
of
orf3, one lacking
the last 195 codons and one missing the
first 80 codons. Both
disruptions were confirmed by Southern blot
analysis. Disruptions
of
orf2,
orf3,
sms, and
comY and the
clpC deletion
were also introduced
into strain
BEK49.
2D PAGE.
B. subtilis wild-type and
ctsR
mutant cells were grown at 37°C in LB medium to an optical density at
540 nm of 0.5 before (control) and 30 min after exposure to heat stress
(50°C). Disruption of the cells by a French press, two-dimensional
(2D) polyacrylamide gel electrophoresis (PAGE) of the protein extracts,
and silver staining of the resulting 2D PAGE gels were carried out as
described earlier (7, 34). Scanned gels were matched by
using the MELANIE II program (Bio-Rad Laboratories, Inc.), and the
protein spots were allocated in accordance with the Sub2D database
(http://pc13mi.biologie.uni-greifswald.de/sub2D/ sub2d.htm).
Purification of the CtsR protein.
For overproduction and
purification of CtsR in E. coli, the entire ctsR
gene was amplified by PCR using primers PRORF1F
(GGAGGATCCGTGGGACATAATATTTTCTG) and PRORF1R
(GAAGAATTCCACCCGCTTATTTTAATTTTAA) and cloned as a BamHI/EcoRI fragment into pRSETA (InVitrogen,
Inc.). This plasmid allowed in-frame fusion of the ctsR gene
to six histidine codons at the N terminus and transcription from a T7
promoter. Competent cells of E. coli BL21(DE3)
(39) containing plasmid pLysS (encoding the phage lysozyme)
and the T7 RNA polymerase gene in the chromosome under the control of
the lac promoter were transformed with the resulting
plasmid, pRORF1. For overproduction, the recombinant strain obtained
was grown in LB medium supplemented with ampicillin and chloramphenicol
for selection of plasmid-containing cells. At an optical density of 0.3 at 540 nm, the T7 phage RNA polymerase was induced by adding 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) to the culture
and incubating it for 2 h. After induction, cells were harvested
by centrifugation, washed once in disruption buffer, and disrupted by a
French press. Cellular debris were removed by centrifugation, and the
crude extract was incubated with Ni-nitrilotriacetic acid-agarose for
2 h at 4°C. Afterwards, the protein-Ni-agarose mixture was
loaded onto columns and the 6×His-tagged CtsR protein was purified
under native conditions via Ni-nitrilotriacetic acid affinity
chromatography as recommended by the manufacturer (Qiagen, Inc.). The
6×His-CtsR protein was substantially pure as judged by sodium dodecyl
sulfate-PAGE analysis.
Gel retardation experiments.
Gel retardation experiments
were performed by using DNA fragments PCR amplified by means of primer
pairs TM-110 and TM-111, EK15 and TM-111, EK15 and EK16, TM-110 and
EK16, and TM-103 and TM-120 (for fragments, see above). Purified DNA
fragments (0.5 µg) were incubated in 30-µl reaction mixtures
containing 20 mM Tris-HCl (pH 8.0), 50 mM KCl, 3% (wt/vol)
Ficoll, 20 mM EDTA, 0.5 mM dithiothreitol, and 1 µg of competitor DNA
(sonicated herring sperm DNA). After 20 min of incubation at 30°C,
the samples were loaded onto 5% polyacrylamide gels with 1× TBE
buffer (90 mM Tris/HCl, 90 mM boric acid, 1 mM EDTA) and the gels were
stained with ethidium bromide.
General methods.
Plasmid isolation, restriction enzyme
analysis, transformation of E. coli, ligation of DNA
fragments, and filling in of the recessed 3' termini by using the
Klenow fragment of DNA polymerase I were performed in accordance with
standard protocols (32). Recombinant plasmids were sequenced
by the dideoxy-chain termination method of Sanger et al.
(33). DNA fragments were amplified by PCR as described
earlier (21). Some oligonucleotides used for PCR included
mismatches allowing the creation of EcoRI, BamHI, KpnI, and HindIII restriction sites.
Chromosomal DNA from B. subtilis was isolated by using a
Wizard genomic DNA purification kit (Promega, Inc.). Transformation of
B. subtilis was carried out by using a two-step protocol
(14).
 |
RESULTS |
The clpC operon is negatively
autoregulated.
The clpC operon is controlled by
stress-inducible
B- and
A-dependent
promoters. Initiation of transcription seems to be the predominant
target of regulation (19). In order to investigate whether
any of the genes in the operon might be involved in this regulation, strain BEO2 was constructed with the clpC
operon placed under the control of the IPTG-inducible
Pspac promoter (13, 48) (see
Materials and Methods). In this strain, expression of the
clpC operon was dependent on IPTG addition, but the
natural promoters were fused to the reporter gene lacZ (Fig.
1A). A plate assay with agar plates
containing X-Gal revealed pale blue colonies after growth in the
presence of 1 mM IPTG, a condition under which the operon was
highly expressed. However, without IPTG, the colonies became dark blue,
indicating that one of the genes may encode a negative regulator. This
phenomenon was verified by measuring
-galactosidase activity in
minimal medium during exponential growth and after entry into
stationary phase triggered by glucose starvation. Cell growth without
IPTG resulted in a high basal level (approximately 25 Miller units in
contrast to 5 U) and in approximately fivefold induction after entry
into stationary phase, probably due to increased transcription at the
B-dependent promoter after glucose starvation
(19). By contrast, addition of IPTG to the culture at the
beginning of growth caused very low LacZ activity without the typical
stationary-phase induction, indicating that the
B
promoter stayed repressed. After addition of IPTG to exponentially growing cells at an optical density of 0.5,
-galactosidase activity decreased very rapidly from 25 to 7 U (Fig. 1B). High-level expression of the clpC operon in the presence of IPTG seems to
block the glucose starvation-inducible transcription at the
B promoter (19), whereas low-level expression
of the operon resulted in clear induction after entry into
stationary phase (Fig. 1B). These results strongly suggested
negative regulation of the clpC operon by one of its
gene products.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Schematic representation of the Campbell-type
integration of plasmid pHORF1 into the chromosome of B. subtilis IS58 and the resulting order of genes in strain BEO2:
B-dependent promoter PB and vegetative
promoter PA fused to lacZ, lacI,
bla for the -lactamase gene, erm for the
erythromycin resistance gene, the Pspac
promoter, and orf1 ctsR. (B) -Galactosidase activities,
in Miller units per unit of optical density (OD), caused by a
ctsR-lacZ fusion in strain BEO2 in the presence or absence
of IPTG in the medium. The solid, thick line portrays the growth curve
of strain BEO2 in minimal medium with limiting amounts of glucose.
Symbols: , -galactosidase activity in the absence of IPTG, ,
-galactosidase activity in the presence of IPTG; ,
-galactosidase activity after addition of IPTG during midexponential
phase at an optical density of 0.5 at 540 nm.
|
|
Phenotype of a ctsR mutant with respect to regulation
of the clpC operon.
To study regulation at
both promoters of the clpC operon, a reporter gene
fusion with the bgaB gene encoding a thermostable
-galactosidase was constructed. The transcriptional
bgaB-ctsR fusion was inserted into the amyE site
of the chromosome in the wild-type background. In order to determine
which gene of the clpC operon might encode its
putative negative regulator, it was necessary to test mutant forms of
each individual gene of the clpC operon for
bgaB expression under nonstressed conditions. A strain with
a nonpolar in-frame deletion of the ctsR gene was constructed in which most of the coding region was removed and a
kanamycin resistance cassette was placed near the deletion upstream of
both promoters (see Materials and Methods). Firstly, the mutant strains
were screened on agar plates containing X-Gal for increased expression
of the bgaB reporter gene at low temperatures. The wild-type
strain gave white colonies under nonstressed growth conditions and dark
blue colonies after heat shock. By contrast, deletion of
ctsR resulted in dark blue colonies not only after heat
shock at 50°C but already at 37°C under nonstressed conditions. With respect to BgaB expression, sms (orf5) and
comY (orf6) mutants showed no striking difference
from the wild-type reference strain in the plate assay. The
orf2, orf3, and clpC mutations
produced pale blue colonies at 37°C and dark blue colonies after heat
shock (data not shown).
Results similar to those of the plate assay for the
ctsR-encoded phenotype were obtained by determination of
the BgaB activity
of
ctsR deletion mutant strain BEK86
before (control) and 30 min
after 50°C heat shock in comparison with
that of isogenic strain
BEK67 (wild type) (Table
2). In the
ctsR mutant, the
basal level
of the operon was increased approximately eightfold
in comparison
with that in the wild type, but approximately threefold
remaining
induction by heat shock was noticed. Heat shock induction of
the
clpC operon occurs predominantly at the
B-dependent promoter (
19). Therefore, a
sigB deletion was introduced
into reference strain BEK67 and
ctsR mutant BEK86 to avoid interference
by
B-dependent transcription. However, BgaB activities
similar to
those obtained in the wild-type and
ctsR deletion
backgrounds
were obtained with the
ctsR sigB double mutant
(BEK87) in comparison
with the isogenic
sigB mutant (BEK68)
(Table
2). BgaB activities
indeed suggested that the first gene encodes
a negative regulator
of
clpC operon expression.
Nevertheless, an induction by heat
stress observed for all strains was
evident even in the
ctsR sigB double mutant (Table
2).
These data were also confirmed by primer extension analysis. Primer
extension experiments were performed by using RNA isolated
before and 6 min after exposure to 50°C heat shock from
sigB mutant
strain BGH1 and also from
ctsR sigB double mutant strain
BEK87.
Comparison of the primer extension results of both strains
revealed
that increased transcription initiation occurred in the
ctsR deletion
background at the vegetative promoter under
nonstressed conditions
(Fig.
2). However,
the transcription rate from this vegetative
promoter was still
increased after heat shock, indicating the
requirement for an
additional regulator element.

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 2.
Initiation of transcription at the
A-dependent promoter in sigB mutant and
sigB ctsR double mutant cells. An autoradiograph of a primer
extension experiment mapping the 5' end of ctsR mRNA is
shown. Equal amounts of RNA isolated from sigB mutant and
sigB ctsR double mutant cells before (co) and 6 min after
(heat) heat shock were used as templates for reverse transcription. The
corresponding sequence of plasmid pUP1 was obtained with the
appropriate primer. The complement of the DNA sequence illustrated in
the sequencing gel is shown on the right. The transcriptional start
site is indicated by the asterisk.
|
|
Influence of the ctsR deletion on the expression of
other stress genes.
The similar regulation patterns of at least
the double-controlled class III heat shock genes, namely,
clpC, clpP, and trxA, led to the
suggestion that they might be subjected to the same induction mechanism
(7, 19, 34). In order to investigate whether other class III
stress genes are also influenced by a ctsR deletion, mRNA
levels of clpC, clpP, clpX,
lon, and trxA were investigated by slot blot
analysis. Digoxigenin-labeled RNA probes of these genes were hybridized
with RNAs isolated from the wild type and from the ctsR
mutant before and 6 min after heat shock at 50°C. Slot blot analysis
using the same RNA preparation with probes of the chaperone gene
dnaK (class I) and the
B-dependent gene
ctc (class II) served as a control (44). Indeed, no difference in induction levels between the wild type and the ctsR deletion strain was observed for the dnaK
and ctc genes. In the wild type and the ctsR
deletion strain, both genes showed similar basal levels and were
induced after heat shock. By contrast, a clear increase in the
basal-level expression of the clpC and clpP genes
was observed in the ctsR mutant in comparison with the wild
type. In case of the clpX, lon, and
trxA genes, this effect was also detected but to a lesser
extent (Fig. 3). However, in the
ctsR deletion strain, an additional induction after exposure to heat shock was also determined for the other genes as observed for
the clpC operon.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of mRNA levels in the wild type and the
ctsR deletion strain by slot blot hybridization with probes
specific for the clpC, clpP, clpX,
trxA, lonA, dnaK, and ctc
genes. The schematic representation shows the mRNA levels of the genes
using RNA of wild-type cells before (wild-type control; black bars) and
6 min after (wild-type heat; white bars) heat shock at 50°C, as well
as the respective signals of the isogenic ctsR deletion
mutant before (mutant control; hatched bars) and after (mutant heat;
cross-hatched bars) exposure to heat shock. The signal intensity of
each slot is given in pixel volumes quantitated by densitometry as
described in Materials and Methods. The results are averages of at
least five experiments; standard deviations were less than 10%.
|
|
Using the 2D PAGE approach, we tried to confirm our data on the protein
level. Protein extracts of wild-type and
ctsR mutant
cells
grown exponentially under nonstressed conditions were separated
by 2D
PAGE and the 2D protein patterns of the silver-stained gels
were
compared. The protein patterns of wild-type and
ctsR mutant
cells differed, suggesting that the CtsR regulator might have
a strong
influence on the expression of several genes (Fig.
4).
Striking differences were found in
the ClpP and ClpC proteins,
which were present in significantly larger
amounts in the
ctsR mutant than in the wild-type strain
(Fig.
4A and B). A larger
amount of the thioredoxin spot was also
found, but here the differences
between the wild type and the
ctsR mutant were less pronounced.
Several unidentified
protein spots on 2D PAGE gels (marked unknown)
were also increased in
the
ctsR mutant (Fig.
4B), suggesting the
existence of a
regulon controlled by CtsR. Furthermore, a few
protein spots were
decreased in the mutant strain. Proteins grouped
into class III that
are more or less specifically induced by oxidative
stress as the
alkylhydroperoxide reductase AhpC/AhpF (
2) do
not seem to be
influenced by the
ctsR deletion.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
Influence of the ctsR deletion on the protein
pattern of exponentially growing B. subtilis cells. Equal
amounts of crude protein extracts (100 µg) of wild-type (A) and
ctsR mutant (B) cells were separated by 2D PAGE.
Silver-stained gels were scanned and matched as described in Materials
and Methods. The identified protein spots are indicated, and the
unknown spots are marked as such.
|
|
Identification of the CtsR binding site in front of the
clpC operon.
The high probability of a
helix-turn-helix DNA-binding motif proposes that CtsR might act
directly as a repressor of clpC operon expression.
However, no classical repressor-binding sites like inverted repeats
could be identified within the regulatory region of the clpC
operon (19). From our previous data, it was tempting
to speculate that the repression mechanism may act downstream of both
promoters, because CtsR appeared to prevent transcription from both the
B- and
A-dependent promoters
(19). Therefore, we started to define the possible binding
region of CtsR in vivo by deletion analysis using different
bgaB fusions, as well as in vitro by using purified CtsR and
different PCR-generated promoter fragments in gel mobility shift
experiments. All bgaB reporter gene fusions and their
resulting BgaB activities are schematically represented in Fig.
5A. The corresponding gel shift
experiments are summarized in Fig. 5B and C. The strain containing the
fusion with fragment A comprising the entire regulatory region of the
clpC operon including both promoters served as a
control. Exposure to 50°C resulted in about 30-fold induction of BgaB
activity. Fragment B, containing the vegetative promoter and its
downstream region, gave considerably lower induction, indicating that
the sequences upstream of the
A-dependent promoter may
stimulate transcription initiation at this promoter. However,
incubation of both fragments A and B with 0.05 or 0.1 nM purified CtsR
protein resulted in efficient retardation of the fragment in gel
electrophoresis with two retardation signals. Increasing amounts of
purified CtsR protein appeared to show increased intensity of the
second retardation band (Fig. 5B). Deleting the part downstream of the
vegetative promoter, as done for fragments C and D, caused a
significant 16-fold increase in expression under nonstressed
conditions. Nevertheless, there was still approximately twofold
induction for fragment C after heat shock, whereas more or less
constitutive expression was observed for fragment D missing the
sequences upstream and downstream of the
A-dependent
promoter. Both fragments C and D, as well as fragment E, were not
retarded in gel electrophoresis after incubation with purified CtsR
protein (Fig. 5C; data not shown for fragment D). These results suggest
a localization of the target region for CtsR binding between the
10
region of the vegetative promoter and the ribosome-binding site.

View larger version (11K):
[in this window]
[in a new window]

View larger version (51K):
[in this window]
[in a new window]

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Schematic representation of the 5' upstream region
of the clpC operon including simplified maps of
ctsR'-bgaB fusions or fragments used in gel mobility shift
experiments. The 10 and 35 boxes of the B-dependent
promoter (PB), the A-dependent promoter (PA), the PCR
primers (arrows), the Shine-Dalgarno region (SD), and the
bgaB reporter gene are indicated. DNA fragments either fused
to the bgaB reporter gene or used in gel mobility shift
experiments are represented by gray lines, and a possible target region
for the repressor is in bold and black. The corresponding results of
the BgaB assays before (37°C) and after heat shock at 50°C,
induction of expression, and behavior in gel mobility shift experiments
are shown. (B) Gel mobility shift experiments with fragments A and B. Gel retardation experiments were performed as described in Materials
and Methods. Fragment length (A, 271 bp; B, 111 bp) is indicated on the
left. The lanes were loaded as follows: 1, free fragment; 2 and 3, fragments incubated with 0.05 and 0.1 nM purified CtsR protein; 4, fragment incubated with bovine serum albumin. (C) Gel mobility shift
experiments with fragments C and E. Fragment length (C, 220 bp; E, 268 bp) is indicated on the left. The lanes were loaded as described above.
|
|
 |
DISCUSSION |
In order to study possible autoregulation of the clpC
operon, the phenotypes produced by mutations within this
operon were investigated with respect to its expression. The
strongest effect was observed in strains carrying the nonpolar
ctsR deletion. These mutants exhibit significant
derepression of the basal level, strongly indicating negative control
of the clpC operon by CtsR. Mutations in
orf2 and orf3, as well as clpC, caused
slight upregulation of the expression of the operon, but polar
effects on clpC cannot be excluded in these mutants.
However, our preliminary data suggest that Orf2 and Orf3, showing
similarities to zinc finger proteins or kinases, respectively
(20), and the ClpC-ATPase itself might play a role in the
control of CtsR activity. Despite this derepression in the
ctsR mutant, reproducible induction was evident even in the
ctsR sigB double mutant, suggesting a repression mechanism involving CtsR together with additional positive regulation by a
different mechanism. This approximately twofold induction by heat
shock failed in bgaB fusion strain BEK85 missing the AT-rich sequence upstream of the vegetative promoter (fragment E in Fig. 5A) (16). Such AT-rich regions may cause DNA bending and
thereby function as promoter up elements (for a review, see reference 30).
In the case of the clpC operon, the negative effect
of the CtsR repressor was dominant and could not be overcome by
stationary-phase induction at the
B promoter. A high
CtsR level prevented transcription from both promoters, whereas a low
level of the repressor resulted in clear induction after entry into
stationary phase (Fig. 1B). CtsR binding seems to block the glucose
starvation-inducible transcription at the
B promoter
(19), explaining the relatively low induction after entry
into stationary phase for the clpC operon and the
clpP gene (7, 19).
Deletion of ctsR led to global changes in the gene
expression profile of B. subtilis cells. For the
clpP and clpC genes, a clear dependency on the
CtsR regulator was determined on the RNA and protein levels (Fig. 3 and
4). An at least partial effect of CtsR on the regulation of thioredoxin
gene trxA and the lon and clpX genes
was also observed. It is tempting to speculate that these
stress-inducible genes are regulated by more than one mechanism.
Additionally, synthesis of further proteins appeared to be influenced
by the ctsR deletion as observed by 2D PAGE analysis (Fig.
4). Possibly, the induction mechanism of those genes acts directly via
CtsR but an indirect effect via repressors which become unstable by
protease overproduction in the ctsR mutant might also be
considered. Oxidative stress proteins AhpC and AhpF were previously
classified as class III heat shock genes because of their weak
induction after heat shock and ethanol stress (2). However,
no dependency on the CtsR regulator could be shown for those proteins
induced particularly in response to oxidative stress. These results
suggest a CtsR regulon comprising proteins implicated in protein
renaturation, protein repair, or ATP-dependent proteolysis such as
ClpC, ClpP, ClpX, and Lon, as well as thioredoxin.
The determination of the CtsR binding region by both in vivo gene
fusion studies and in vitro binding of CtsR in gel retardation experiments revealed a target region located in front of the
clpC operon between the
10 box of the vegetative
promoter and the ribosome-binding site. No striking similarities were
observed by comparison of the regulatory regions of those genes
influenced by a ctsR deletion. Recently, the target region
of a putative repressor of the clpP gene was found to
overlap the vegetative promoter by using reporter gene fusions
(7). Derré and Msadek (4) determined a
target sequence for the CtsR repressor of the clpP gene by
site-directed mutagenesis and DNase I footprinting assays. This
putative binding site consists of the directly repeated sequence
YGTCAAW, which is present in the promoter region of the clpP
gene, as well the clpC operon. A similar sequence
was found between the
10 box of the vegetative promoter and the
ribosome-binding site in front of the lon gene
(31).
The induction pattern of the
A-dependent promoter
indicates that the CtsR repressor is inactivated by several stresses,
such as heat shock, puromycin stress, ethanol treatment, or oxidative stress, but not by energy starvation or salt stress, which specifically induce
B-dependent transcription (7, 19).
However, the elucidation of the signal transduction pathway leading
from the stress signal to the nonfunctional state of the repressor
deserves further work.
 |
ACKNOWLEDGMENTS |
We thank Steffen Krüger and Gerhard Mittenhuber for
critical reading of the manuscript. We acknowledge Elke Witt for
support in mutant analysis, Steffen Ohlmeier for construction of strain BEO2, and Uwe Völker and Knut Büttner for help in 2D PAGE
analysis. Furthermore, we are grateful to Tarek Msadek for sharing
unpublished results and useful discussions. We thank Renate Gloger and
Anita Harang for excellent technical assistance.
This work was supported by grants from the Deutsche
Forschungsgemeinschaft and the Fonds der Chemischen Industrie to M.H.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für
Mikrobiologie und Molekularbiologie, Ernst-Moritz-Arndt-Universität, D-17487 Greifswald,
Germany. Phone: 03834/864200. Fax: 03834/864202. E-mail: hecker{at}microbio7.biologie.uni-greifswald.de.
 |
REFERENCES |
| 1.
|
Alper, L.,
A. Dufour,
D. A. Garsin,
M. L. Duncan, and R. Losick.
1996.
Role of adenosine nucleotide in the regulation of a stress response transcription factor in Bacillus subtilis.
J. Mol. Biol.
260:165-177[Medline].
|
| 2.
|
Antelmann, H.,
S. Engelmann,
R. Schmid, and M. Hecker.
1996.
General and oxidative stress responses in Bacillus subtilis: cloning, expression, and mutation of the alkyl hydroperoxide reductase operon.
J. Bacteriol.
178:6571-6578[Abstract/Free Full Text].
|
| 3.
|
Bolivar, F.,
R. L. Rodrigues,
P. J. Greener,
M. C. Betlach,
H. L. Heyneker,
H. W. Boyer,
J. H. Crosa, and S. Falkow.
1977.
Construction and characterization of new cloning vehicles. II. A multipurpose cloning system.
Gene
2:95-133[Medline].
|
| 4.
|
Derré, I., and T. Msadek.
1997.
CtsR is a DNA-binding protein controlling class III heat shock gene expression in Bacillus subtilis, abstr. G121.
In
Abstracts of posters. 9th International Conference on Bacilli.
|
| 5.
|
Deuerling, E.,
B. Paeslack, and W. Schumann.
1995.
The ftsH gene of Bacillus subtilis is transiently induced after osmotic and temperature upshift.
J. Bacteriol.
177:4105-4112[Abstract/Free Full Text].
|
| 6.
|
Dodd, I. B., and J. B. Egan.
1990.
Improved detection of helix-turn-helix DNA-binding motifs in protein sequences.
Nucleic Acids Res.
18:5019-5026[Abstract/Free Full Text].
|
| 7.
|
Gerth, U.,
E. Krüger,
I. Derré,
T. Msadek, and M. Hecker.
1998.
Stress induction of the Bacillus subtilis clpP gene encoding the proteolytic component of the Clp protease and involvement of ClpP and ClpX in stress tolerance.
Mol. Microbiol.
28:787-802[Medline].
|
| 8.
|
Gerth, U.,
A. Wipat,
C. Harwood,
N. Carter,
P. T. Emmerson, and M. Hecker.
1996.
Sequence and transcriptional analysis of clpX a class III heat shock gene of Bacillus subtilis.
Gene
181:77-83[Medline].
|
| 9.
|
Haldenwang, W. G.
1995.
The sigma factors of Bacillus subtilis.
Microbiol. Rev.
59:1-30[Abstract/Free Full Text].
|
| 10.
|
Hanahan, D.
1985.
Techniques for transformation of Escherichia coli, p. 109-135.
In
D. M. Glover (ed.), DNA cloning: a practical approach, vol. 1. IRL Press, Oxford, England.
|
| 11.
|
Hecker, M.,
W. Schumann, and U. Völker.
1996.
Heat shock and general stress response in Bacillus subtilis.
Mol. Microbiol.
19:417-428[Medline].
|
| 12.
|
Hecker, M., and U. Völker.
1998.
Non-specific, general and multiple stress resistance of growth restricted Bacillus subtilis cells by the expression of the B-regulon.
Mol. Microbiol.
29:1129-1136[Medline].
|
| 13.
|
Henner, D. J.
1990.
Inducible expression of regulatory genes in Bacillus subtilis.
Methods Enzymol.
185:223-228[Medline].
|
| 14.
|
Hoch, J. A.
1991.
Genetic analysis in Bacillus subtilis.
Methods Enzymol.
204:305-320[Medline].
|
| 15.
|
Kenney, T. J., and C. P. Moran, Jr.
1987.
Organization and regulation of an operon that encodes a sporulation-essential sigma factor in Bacillus subtilis.
J. Bacteriol.
169:3329-3339[Abstract/Free Full Text].
|
| 16.
| Krüger, E., and J. Bandow. Unpublished data.
|
| 17.
|
Krüger, E.,
U. Gerth, and M. Hecker.
1997.
Stress inducible Clp-proteins: regulation and function, abstr. G120.
In
Abstracts of posters. 9th International Conference on Bacilli.
|
| 18.
|
Krüger, E., and M. Hecker.
1997.
Bacillus subtilis ClpC, p. 243-245.
In
M. J. Gething (ed.), Guidebook to molecular chaperones and protein-folding catalysts. Oxford University Press, Oxford, United Kingdom.
|
| 19.
|
Krüger, E.,
T. Msadek, and M. Hecker.
1996.
Alternate promoters direct stress induced transcription of the Bacillus subtilis clpC operon.
Mol. Microbiol.
20:713-723[Medline].
|
| 20.
|
Krüger, E.,
T. Msadek,
S. Ohlmeier, and M. Hecker.
1997.
The Bacillus subtilis clpC operon encodes DNA repair and competence proteins.
Microbiology
143:1309-1316[Abstract/Free Full Text].
|
| 21.
|
Krüger, E.,
U. Völker, and M. Hecker.
1994.
Stress induction of clpC in Bacillus subtilis and its involvement in stress tolerance.
J. Bacteriol.
176:3360-3367[Abstract/Free Full Text].
|
| 22.
|
Kunst, F.,
T. Msadek, and G. Rapoport.
1994.
Signal transduction network controlling degradative enzyme synthesis and competence in Bacillus subtilis, p. 1-20.
In
P. J. Piggot, C. P. Moran, Jr., and P. Youngman (ed.), Regulation of bacterial differentiation. American Society for Microbiology, Washington, D.C.
|
| 23.
|
Kunst, F.,
N. Ogasawara,
I. Moszer,
A. M. Albertini,
G. Alloni,
V. Azevedo,
M. G. Bertero,
P. Bessieres,
A. Bolotin,
S. Borchert,
R. Borriss,
L. Boursier,
A. Brans,
M. Braun,
S. C. Brignell,
S. Bron,
S. Brouillet,
C. V. Bruschi,
B. Caldwell,
V. Capuano,
N. M. Carter,
S. K. Choi,
J. J. Codani,
I. F. Connerton,
A. Danchin, et al.
1997.
The complete genome sequence of the gram-positive bacterium Bacillus subtilis.
Nature
390:249-256[Medline].
|
| 24.
|
Lereclus, D., and O. Arantes.
1992.
spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon.
Mol. Microbiol.
6:35-46[Medline].
|
| 25.
|
Maul, B.,
U. Völker,
S. Riethdorf,
S. Engelmann, and M. Hecker.
1995.
B-dependent induction of gsiB by multiple stimuli in Bacillus subtilis.
Mol. Gen. Genet.
248:114-120[Medline].
|
| 26.
|
Mogk, A.,
G. Homuth,
C. Scholz,
L. Kim,
F. X. Schmid, and W. Schumann.
1997.
The GroE chaperone machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis.
EMBO J.
16:4579-4590[Medline].
|
| 27.
|
Mogk, A.,
A. Völker,
S. Engelmann,
M. Hecker,
W. Schumann, and U. Völker.
1998.
Nonnative proteins induce expression of the Bacillus subtilis CIRCE regulon.
J. Bacteriol.
180:2895-2900[Abstract/Free Full Text].
|
| 28.
|
Msadek, T.,
F. Kunst, and G. Rapoport.
1994.
MecB of Bacillus subtilis, a member of the ClpC ATPase family, is a pleiotropic regulator controlling competence gene expression and survival at high temperature.
Proc. Natl. Acad. Sci. USA
91:5788-5792[Abstract/Free Full Text].
|
| 29.
|
Nanamiya, H.,
Y. Ohashi,
K. Asai,
S. Moriya,
N. Ogasawara,
M. Fujita,
Y. Sadiae, and F. Kawamura.
1998.
ClpC regulates the fate of a sporulation initiation sigma factor, H protein, in Bacillus subtilis at elevated temperatures.
Mol. Microbiol.
29:505-513[Medline].
|
| 30.
|
Perez-Martin, J.,
R. Fernando, and V. de Lorenzo.
1994.
Promoters responsive to DNA bending: a common theme in procaryotic gene expression.
Microbiol. Rev.
58:268-290[Abstract/Free Full Text].
|
| 31.
|
Riethdorf, S.,
U. Völker,
U. Gerth,
A. Winkler,
S. Engelmann, and M. Hecker.
1994.
Cloning, nucleotide sequence, and expression of the Bacillus subtilis lon gene.
J. Bacteriol.
176:6518-6527[Abstract/Free Full Text].
|
| 32.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 34.
|
Scharf, C.,
S. Riethdorf,
H. Ernst,
S. Engelmann,
U. Völker, and M. Hecker.
1998.
Thioredoxin is as essential protein induced by multiple stresses in Bacillus subtilis.
J. Bacteriol.
180:1869-1877[Abstract/Free Full Text].
|
| 35.
|
Schulz, A., and W. Schumann.
1996.
hcrA, the first gene of the of Bacillus subtilis dnaK operon, encodes a negative regulator of class I heat shock genes.
J. Bacteriol.
178:1088-1093[Abstract/Free Full Text].
|
| 36.
|
Schulz, A.,
S. Schwab,
G. Homuth,
S. Versteeg, and W. Schumann.
1997.
The htpG gene of Bacillus subtilis belongs to class III heat shock genes and is under negative control.
J. Bacteriol.
179:3103-3109[Abstract/Free Full Text].
|
| 37.
|
Smith, I.,
P. Paress,
K. Cabane, and E. Dubnau.
1980.
Genetics and physiology of the rel system of Bacillus subtilis.
Mol. Gen. Genet.
178:271-279[Medline].
|
| 38.
|
Steinmetz, M., and R. Richter.
1994.
Plasmids designed to alter the antibiotic resistance expressed by insertion mutations in Bacillus subtilis, through in vivo recombination.
Gene
142:79-83[Medline].
|
| 39.
|
Studier, F. W.,
A. H. Rosenberg,
J. J. Dunn, and J. W. Dubendorff.
1990.
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol.
185:60-89[Medline].
|
| 40.
|
Stülke, J.,
R. Hanschke, and M. Hecker.
1993.
Temporal activation of -glucanase synthesis in Bacillus subtilis is mediated by the GTP pool.
J. Gen. Microbiol.
139:2041-2045[Medline].
|
| 41.
|
Trieu-Cout, P., and P. Courvalin.
1983.
Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'-5"-aminoglycoside phosphotransferase type III.
Gene
23:331-341[Medline].
|
| 42.
|
Turgay, K.,
L. Hamoen,
G. Venema, and D. Dubnau.
1997.
Biochemical characterization of a molecular switch involving the heat shock protein ClpC, which controls the activity of ComK, the competence transcription factor of Bacillus subtilis.
Genes Dev.
11:119-128[Abstract/Free Full Text].
|
| 43.
|
Vagner, V.,
E. Dervyn, and S. D. Ehrlich.
1995.
A vector for systematic analysis of unknown genes, abstr. T 14, p. 74.
In
Proceedings of the 8th Conference on Bacilli.
|
| 44.
|
Völker, U.,
S. Engelmann,
B. Maul,
S. Riethdorf,
A. Völker,
R. Schmid,
H. Mach, and M. Hecker.
1994.
Analysis of the induction of general stress proteins of Bacillus subtilis.
Microbiology
140:741-752[Abstract/Free Full Text].
|
| 45.
|
Völker, U.,
A. Völker, and W. G. Haldenwang.
1996.
Reactivation of the Bacillus subtilis anti- B antagonist, RsbV, by stress- or starvation-induced phosphatase activities.
J. Bacteriol.
178:5456-5463[Abstract/Free Full Text].
|
| 46.
|
Wetzstein, M.,
U. Völker,
J. Dedio,
S. Löbau,
U. Zuber,
M. Schiesswohl,
C. Herget,
M. Hecker, and W. Schumann.
1992.
Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis.
J. Bacteriol.
174:3300-3310[Abstract/Free Full Text].
|
| 47.
|
Yang, X.,
C. M. Kang,
M. S. Brody, and C. W. Price.
1996.
Opposing pairs of serine protein kinases and phosphatases transmit signals of environmental stress to activate a bacterial transcription factor.
Genes Dev.
10:2265-2275[Abstract/Free Full Text].
|
| 48.
|
Yansura, D. G., and D. J. Henner.
1984.
Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
81:439-443[Abstract/Free Full Text].
|
| 49.
|
Yuan, G., and S.-L. Wong.
1995.
Regulation of groE expression in Bacillus subtilis: the involvement of the A-like promoter of the inverted repeat sequence (CIRCE).
J. Bacteriol.
177:5427-5433[Abstract/Free Full Text].
|
| 50.
|
Yuan, G., and S.-L. Wong.
1995.
Isolation and characterization of Bacillus subtilis groE regulatory mutants: evidence for orf39 in the dnaK operon as a repressor gene in regulation of both groE and dnaK.
J. Bacteriol.
177:6462-6468[Abstract/Free Full Text].
|
| 51.
|
Zuber, U., and W. Schumann.
1994.
CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis.
J. Bacteriol.
176:1359-1363[Abstract/Free Full Text].
|
Journal of Bacteriology, December 1998, p. 6681-6688, Vol. 180, No. 24
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zomer, A., Fernandez, M., Kearney, B., Fitzgerald, G. F., Ventura, M., van Sinderen, D.
(2009). An Interactive Regulatory Network Controls Stress Response in Bifidobacterium breve UCC2003. J. Bacteriol.
191: 7039-7049
[Abstract]
[Full Text]
-
Jung, K., Jung, H.
(2009). A New Mechanism of Phosphoregulation in Signal Transduction Pathways. Sci Signal
2: pe71-pe71
[Abstract]
[Full Text]
-
Fuhrmann, J., Schmidt, A., Spiess, S., Lehner, A., Turgay, K., Mechtler, K., Charpentier, E., Clausen, T.
(2009). McsB Is a Protein Arginine Kinase That Phosphorylates and Inhibits the Heat-Shock Regulator CtsR. Science
324: 1323-1327
[Abstract]
[Full Text]
-
Ehira, S., Teramoto, H., Inui, M., Yukawa, H.
(2009). Regulation of Corynebacterium glutamicum Heat Shock Response by the Extracytoplasmic-Function Sigma Factor SigH and Transcriptional Regulators HspR and HrcA. J. Bacteriol.
191: 2964-2972
[Abstract]
[Full Text]
-
Fiocco, D., Collins, M., Muscariello, L., Hols, P., Kleerebezem, M., Msadek, T., Spano, G.
(2009). The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon. J. Bacteriol.
191: 1688-1694
[Abstract]
[Full Text]
-
Russo, S., Schweitzer, J.-E., Polen, T., Bott, M., Pohl, E.
(2009). Crystal Structure of the Caseinolytic Protease Gene Regulator, a Transcriptional Activator in Actinomycetes. J. Biol. Chem.
284: 5208-5216
[Abstract]
[Full Text]
-
Hu, Y., Raengpradub, S., Schwab, U., Loss, C., Orsi, R. H., Wiedmann, M., Boor, K. J.
(2007). Phenotypic and Transcriptomic Analyses Demonstrate Interactions between the Transcriptional Regulators CtsR and Sigma B in Listeria monocytogenes. Appl. Environ. Microbiol.
73: 7967-7980
[Abstract]
[Full Text]
-
van der Veen, S., Hain, T., Wouters, J. A., Hossain, H., de Vos, W. M., Abee, T., Chakraborty, T., Wells-Bennik, M. H. J.
(2007). The heat-shock response of Listeria monocytogenes comprises genes involved in heat shock, cell division, cell wall synthesis, and the SOS response. Microbiology
153: 3593-3607
[Abstract]
[Full Text]
-
Wolff, S., Otto, A., Albrecht, D., Zeng, J. S., Buttner, K., Gluckmann, M., Hecker, M., Becher, D.
(2006). Gel-free and Gel-based Proteomics in Bacillus subtilis: A Comparative Study. Mol. Cell. Proteomics
5: 1183-1192
[Abstract]
[Full Text]
-
Suokko, A., Savijoki, K., Malinen, E., Palva, A., Varmanen, P.
(2005). Characterization of a Mobile clpL Gene from Lactobacillus rhamnosus. Appl. Environ. Microbiol.
71: 2061-2069
[Abstract]
[Full Text]
-
Holtmann, G., Brigulla, M., Steil, L., Schutz, A., Barnekow, K., Volker, U., Bremer, E.
(2004). RsbV-Independent Induction of the SigB-Dependent General Stress Regulon of Bacillus subtilis during Growth at High Temperature. J. Bacteriol.
186: 6150-6158
[Abstract]
[Full Text]
-
Alkema, W. B.L., Lenhard, B., Wasserman, W. W.
(2004). Regulog Analysis: Detection of Conserved Regulatory Networks Across Bacteria: Application to Staphylococcus aureus. Genome Res
14: 1362-1373
[Abstract]
[Full Text]
-
Mostertz, J., Scharf, C., Hecker, M., Homuth, G.
(2004). Transcriptome and proteome analysis of Bacillus subtilis gene expression in response to superoxide and peroxide stress. Microbiology
150: 497-512
[Abstract]
[Full Text]
-
Gerth, U., Kirstein, J., Mostertz, J., Waldminghaus, T., Miethke, M., Kock, H., Hecker, M.
(2004). Fine-Tuning in Regulation of Clp Protein Content in Bacillus subtilis. J. Bacteriol.
186: 179-191
[Abstract]
[Full Text]
-
Varmanen, P., Vogensen, F. K., Hammer, K., Palva, A., Ingmer, H.
(2003). ClpE from Lactococcus lactis Promotes Repression of CtsR-Dependent Gene Expression. J. Bacteriol.
185: 5117-5124
[Abstract]
[Full Text]
-
Pan, Q., Losick, R.
(2003). Unique Degradation Signal for ClpCP in Bacillus subtilis. J. Bacteriol.
185: 5275-5278
[Abstract]
[Full Text]
-
Weichart, D., Querfurth, N., Dreger, M., Hengge-Aronis, R.
(2003). Global Role for ClpP-Containing Proteases in Stationary-Phase Adaptation of Escherichia coli. J. Bacteriol.
185: 115-125
[Abstract]
[Full Text]
-
Lemos, J. A. C., Burne, R. A.
(2002). Regulation and Physiological Significance of ClpC and ClpP in Streptococcus mutans. J. Bacteriol.
184: 6357-6366
[Abstract]
[Full Text]
-
Fedhila, S., Msadek, T., Nel, P., Lereclus, D.
(2002). Distinct clpP Genes Control Specific Adaptive Responses in Bacillus thuringiensis. J. Bacteriol.
184: 5554-5562
[Abstract]
[Full Text]
-
Narberhaus, F.
(2002). {alpha}-Crystallin-Type Heat Shock Proteins: Socializing Minichaperones in the Context of a Multichaperone Network. Microbiol. Mol. Biol. Rev.
66: 64-93
[Abstract]
[Full Text]
-
Pummi, T., Leskela, S., Wahlstrom, E., Gerth, U., Tjalsma, H., Hecker, M., Sarvas, M., Kontinen, V. P.
(2002). ClpXP Protease Regulates the Signal Peptide Cleavage of Secretory Preproteins in Bacillus subtilis with a Mechanism Distinct from That of the Ecs ABC Transporter. J. Bacteriol.
184: 1010-1018
[Abstract]
[Full Text]
-
Helmann, J. D., Wu, M. F. W., Kobel, P. A., Gamo, F.-J., Wilson, M., Morshedi, M. M., Navre, M., Paddon, C.
(2001). Global Transcriptional Response of Bacillus subtilis to Heat Shock. J. Bacteriol.
183: 7318-7328
[Abstract]
[Full Text]
-
Becker, P., Hufnagle, W., Peters, G., Herrmann, M.
(2001). Detection of Differential Gene Expression in Biofilm-Forming versus Planktonic Populations of Staphylococcus aureus Using Micro-Representational-Difference Analysis. Appl. Environ. Microbiol.
67: 2958-2965
[Abstract]
[Full Text]
-
Zuber, U., Drzewiecki, K., Hecker, M.
(2001). Putative Sigma Factor SigI (YkoZ) of Bacillus subtilis Is Induced by Heat Shock. J. Bacteriol.
183: 1472-1475
[Abstract]
[Full Text]
-
Melly, E., Setlow, P.
(2001). Heat Shock Proteins Do Not Influence Wet Heat Resistance of Bacillus subtilis Spores. J. Bacteriol.
183: 779-784
[Abstract]
[Full Text]
-
Gertz, S., Engelmann, S., Schmid, R., Ziebandt, A.-K., Tischer, K., Scharf, C., Hacker, J., Hecker, M.
(2000). Characterization of the sigma B Regulon in Staphylococcus aureus. J. Bacteriol.
182: 6983-6991
[Abstract]
[Full Text]
-
Moch, C., Schrögel, O., Allmansberger, R.
(2000). Transcription of the nfrA-ywcH Operon from Bacillus subtilis Is Specifically Induced in Response to Heat. J. Bacteriol.
182: 4384-4393
[Abstract]
[Full Text]
-
Krüger, E., Witt, E., Ohlmeier, S., Hanschke, R., Hecker, M.
(2000). The Clp Proteases of Bacillus subtilis Are Directly Involved in Degradation of Misfolded Proteins. J. Bacteriol.
182: 3259-3265
[Abstract]
[Full Text]
-
Varmanen, P., Ingmer, H., Vogensen, F. K.
(2000). ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology
146: 1447-1455
[Abstract]
[Full Text]
-
Noone, D., Howell, A., Devine, K. M.
(2000). Expression of ykdA, Encoding a Bacillus subtilis Homologue of HtrA, Is Heat Shock Inducible and Negatively Autoregulated. J. Bacteriol.
182: 1592-1599
[Abstract]
[Full Text]
-
Jobin, M.-P., Garmyn, D., Diviès, C., Guzzo, J.
(1999). The Oenococcus oeni clpX Homologue Is a Heat Shock Gene Preferentially Expressed in Exponential Growth Phase. J. Bacteriol.
181: 6634-6641
[Abstract]
[Full Text]
-
Petersohn, A., Bernhardt, J., Gerth, U., Höper, D., Koburger, T., Völker, U., Hecker, M.
(1999). Identification of sigma B-Dependent Genes in Bacillus subtilis Using a Promoter Consensus-Directed Search and Oligonucleotide Hybridization. J. Bacteriol.
181: 5718-5724
[Abstract]
[Full Text]