Previous Article | Next Article 
Journal of Bacteriology, December 1998, p. 6753-6756, Vol. 180, No. 24
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Insertion Mutagenesis of the Ferric Pyoverdine Receptor FpvA of
Pseudomonas aeruginosa: Identification of Permissive
Sites and a Region Important for Ligand Binding
Laurie
Kilburn,1
Keith
Poole,1,*
Jean-Marie
Meyer,2 and
Shadi
Neshat1
Department of Microbiology and Immunology,
Queen's University, Kingston, Ontario K7L 3N6,
Canada,1 and
Laboratoire de
Microbiologie et de Génétique, Unité de Recherche
Associée au Centre National de la Recherche Scientifique No.
1481, Université Louis-Pasteur, 67000 Strasbourg,
France2
Received 3 September 1998/Accepted 8 October 1998
 |
ABSTRACT |
Insertion of an 18-amino-acid-encoding sequence within the
fpvA gene identified permissive sites at residues Y350,
A402, R451, R521, and R558, consistent with these residues occurring in
extramembranous loop regions of the protein. Insertions at R451, R521,
and R558 did not adversely affect receptor function, although
insertions at Y350 and A402 compromised ferric pyoverdine binding and
uptake. The latter region likely contributes to or interacts with the ligand-binding site.
| |
TEXT |
Iron is an essential nutrient whose
acquisition by some bacteria is promoted by low-molecular-mass,
high-affinity iron-chelating molecules termed siderophores
(27). In conjunction with cell surface receptors specific
for the Fe(III) complex of these siderophores (27, 28), they
serve to facilitate iron acquisition under iron-limited conditions that
predominate in animal and plant hosts (8, 19, 24). Indeed,
siderophore production by human pathogens correlates with enhanced in
vivo iron acquisition and growth and, thus, virulence (12, 14,
18).
Pseudomonas aeruginosa synthesizes two known
siderophores, pyoverdine (13) and pyochelin
(11), in response to iron limitation in vitro and in vivo
(20). Pyoverdine displays higher affinity than does
pyochelin for iron in buffered solutions (31) and is by far
the superior siderophore in removing iron from transferrin (40) and in supporting growth in human serum (2).
Moreover, the production of pyoverdine is correlated with enhanced in
vivo growth and virulence (25, 31). The receptor for ferric
pyoverdine is a ca. 80- to 90-kDa outer membrane protein
(32) encoded by the fpvA gene (33).
FpvA is a member of a family of receptors dependent on a cytoplasmic
membrane-associated protein, TonB, which apparently couples the
energized state of this membrane to the operation of these receptors
(7, 35). A TonB homologue has been identified in
P. aeruginosa (34).
Ferric siderophore receptors are described as gated channels, with a
surface-exposed loop contributing to gate formation and acting as
ligand-binding site (22, 23, 26, 36). In an effort to
identify a potential gate/ligand-binding region of FpvA, we
mutagenized putative external loop regions of the protein. We report
here the identification of a region of FpvA necessary for ferric
pyoverdine binding.
Strains and procedures.
P. aeruginosa PAO1 is a
wild-type strain and parent of the FpvA-deficient mutant K691, in which
fpvA was disrupted by insertion of the
tetracycline-resistant derivative of the 
interposon (Tc) of
plasmid pHP45Tc (16). The interposon was recovered on a 2-kb SmaI fragment and inserted into the ScaI
site of fpvA on pPVR2 (a derivative of the cloning vector
pAK1900) (33). This necessitated partial digestion of pPVR2
with ScaI and isolation of a 9-kb fragment representing
full-length pPVR2. Transformants (Escherichia coli DH5
[3]) carrying pPVR2 with an Tc insert were selected
on L agar containing ampicillin and tetracycline, and insertion of
Tc within the fpvA gene was assessed by restriction analysis. The Tc-mutagenized fpvA gene was subsequently
recovered on a 6.5-kb PstI fragment and cloned into the
unique PstI site on plasmid pSUP202
Tc (15).
Following introduction into E. coli S17-1
(38), the vector was mobilized into P. aeruginosa PAO1 via conjugation (15). PAO1 derivatives
carrying a chromosomal fpvA::Tc mutation were
selected on L agar containing tetracycline and screened for the absence
of plasmid-encoded carbenicillin resistance. The lack of FpvA in
putative mutants was confirmed by sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis of isolated outer membranes.
The iron-deficient succinate minimal medium has been described
previously (32). Luria broth (Luria broth base; Difco) was
employed as the rich medium throughout. Ampicillin (100 µg/ml),
tetracycline (for P. aeruginosa, 200 µg/ml; for
E. coli, 10 µg/ml), and carbenicillin (100 µg/ml)
were included in growth media where appropriate. Due to the instability
of the Tc insert in K691, K691 and plasmid-containing derivatives of this strain were always cultured in the presence of tetracycline. Bacteria were cultured at 37°C, with shaking (200 rpm) for broth cultures.
To generate a tet-linked DNA fragment encoding the
cleavage site for the factor Xa protease, oligonucleotides T1
(5'- AGATCTTTATCGAGGGGCGGTTATCGAGGGGCGGT TATCGAGGGGCGGCCCGGGTGGCGCCCTGCA-3'),
T2 (5'-GGGCGCCACCCGGGCCGCCCCTCGATAAC CGCCCCTCGATAACCGCCCCTCGATAAAGATCT-3'), T3 (5'-AATTAGATCTCCCGGGTGGCGCCGAGCT-3'), and T4 (5'-CGGCGCCACCCGGGAGATCT-3') were syn-thesized.
T1 and T2 (50 pmol/µl each) were incubated at 70°C for 3 min
followed by a 30-min incubation at room temperature to allow annealing of the oligonucleotides. The resultant duplex DNA carried internal restriction sites for BglII and SmaI, the coding
sequence for the factor Xa cleavage site in all three reading frames,
and a PstI-compatible 3' extension at one end; the other end
was blunt. Oligonucleotides T3 and T4 were similarly annealed, yielding
a duplex molecule possessing internal cleavage sites for
BglII and SmaI and an SstI-compatible
3' extension at one end and an EcoRI-compatible 5' extension
at the other. The duplex molecules were ligated to a 2.1-kb
EcoRI-PvuII fragment of pBR322 (37)
carrying the tet gene of this vector and cloned into
SstI-PstI-restricted pAK1900 to yield pXa-1. The
tet-factor Xa cartridge was used, ultimately, to insert 54 bp into various sites within the fpvA gene of plasmid pPVR2,
thereby disrupting the FpvA receptor by the addition of 18 amino acids
(including the factor Xa cleavage site). Although the intent was to use
the inserted factor Xa cleavage sites to assess the topology of FpvA,
the protease failed to cleave any of the modified FpvA. Still, the
insertion of 54 bp/18 amino acids did afford the opportunity to examine
the influence of the disruptions on FpvA receptor activity.
Initial-ly, then, the factor Xa sequence was recovered with the
tet gene on a 2.1-kb SmaI fragment of pXa-1. This
fragment was inserted into various sites within the fpvA gene of plasmid pPVR2 following partial digestion of pPVR2 with various
enzymes whose digestion products were blunt ended (MstI, NruI, RsaI, EcoRV, and
HincII). Briefly, 1 µg of plasmid was restricted with 5 to 10 units of enzyme in the presence of 25 to 50 µg of ethidium bromide per ml for 15 to 30 min at 37°C. The
conditions were optimized to produce a maximal yield of
unit-length plasmids which were each cut once.
Transformants (E. coli DH5) carrying pPVR2
with an insert of the tet-factor Xa cartridge were selected on L agar supplemented with tetracycline and ampicillin. The site and
orientation of the inserts were determined by restriction analysis and
by sequencing with a primer (5'-GTGCCTGACTGCGTTAGC-3') which
anneals upstream of the pBR322 tet gene. The tet
gene was subsequently excised by digestion with BglII
followed by religation of the plasmids and selection of transformants
which were ampicillin resistant but tetracycline sensitive. This
resulted in insertion of 54 bp within fpvA encoding either
the factor Xa cleavage site in all three reading frames
(orientation 1) and insertion of 18 amino acids in FpvA or
translational stop signals in all three reading frames (orientation 2)
and no FpvA product.
Protocols for preparation of plasmid DNA, restriction digests,
ligations, transformations and isolation of restriction fragments
from
agarose gels have been described previously (
39, 42). DNA
to
be sequenced was purified with the Wizard Minipreps DNA
purification
system (Promega). DNA sequencing and oligonucleotide
synthesis
were performed by Cortec DNA Service Laboratories,
Inc., Queen's
University. Outer membranes were prepared as Triton
X-100-insoluble
cell envelopes isolated following disruption of cells
with a French
pressure cell (
33) or a cell sonicator (Vibra
Cell; Sonics &
Materials, Inc.) (two bursts of 25 s at 50% power
on ice) (
39).
Whole-cell protein extracts were prepared as
described previously
(
30) with modifications. Briefly, 100 µl of overnight cell culture
was harvested by centrifugation,
resuspended in 30 µl of gel-loading
buffer (2% [wt/vol] SDS-62.5
mM Tris-HCl [pH 8.0]-1% [vol/vol]
glycerol), heated at 95°C for
5 min, and sonicated briefly. Following
centrifugation (5 min at 15,000 rpm) to remove insoluble material,
the whole-cell
protein-containing supernatants were recovered.
SDS-polyacrylamide
gel electrophoresis was carried out as described
previously
(
39) with 9% (wt/vol) acrylamide in the running gel.
Western immunoblotting was carried out as described previously
(
39) with a rabbit anti-FpvA antiserum (
33).
Uptake of ferric pyoverdine was assayed as described previously
(
32) with modifications. Cells were grown in iron-deficient
succinate minimal medium supplemented with Casamino Acids (0.1%
[wt/vol]; Difco) and antibiotics. Once cultures reached an
A600 of 0.8 to 0.9, cells (5 ml) were harvested
by centrifugation and
resuspended in the same volume of nitrogen-free
iron-deficient
succinate minimal medium. Following incubation at 37°C
with shaking
for 30 min, aliquots (1 ml) were removed and added to 20 µl of
a mixture of pyoverdine (3.5 mM) and
55FeCl
3 (0.29 µM), which had been previously
incubated for 5 min
at room temperature in a 10-ml disposable culture
tube. Cells
were vortexed gently, and aliquots (200 µl) were removed
at intervals,
harvested on membrane filters, washed with 10 ml of
distilled
water, dried, and counted in a scintillation counter
(
32).
Insertion mutagenesis of fpvA.
Alignment of the
predicted FpvA primary amino acid sequence with homologous receptor
proteins identified several potential membrane-spanning and loop
regions of FpvA (31, 33). Insertions of the 54-bp sequence
encoding the factor Xa cleavage site within the fpvA gene of
pPVR2 were achieved as outlined above, and insertion derivatives were
expressed in the FpvA-deficient strain K691. Several hundred inserts
within pPVR2 were screened, and many occurred outside the
fpvA coding region. Those harboring the factor Xa coding
sequences in the proper orientation within fpvA are
described in Table 1. Although these
derivatives were ultimately not susceptible to digestion with factor
Xa, the insertion derivatives, but not FpvA itself, were cleaved by
a nonspecific protease (subtilisin) in intact cells (data not
shown), suggesting that the insertion sites were, nonetheless,
surface accessible.
Most insertions yielded an FpvA product of slightly lower mobility than
native FpvA in whole-cell extracts (Fig.
1A), consistent
with the insertion of 18 additional amino acids, although an insertion
at an
RsaI
site at bp 1502 (pLK16-1 [Table
1]) failed to yield
an FpvA product
(Fig.
1A, lane 6). Regions of integral membrane
proteins which tolerate
amino acid insertions typically correspond
to extramembranous loops
(
1,
4,
6,
10,
17) rather
than membrane-spanning regions
(
1,
5). Indeed, the insertion
site in most derivatives in
Table
1 except FpvA
G473 was predicted
to be a
surface-exposed loop (
31,
33). In each case, the proteins
fractionated with the outer membrane (Fig.
1B), indicating that
the
insertions did not adversely affect proper export and localization
of
FpvA. The FpvA protein in each instance was also detectable
in intact
cells by using an FpvA-specific antiserum and indirect
immunofluorescence (
41) (data not shown). Some breakdown of
the FpvA protein carrying an insertion at R451 (pLK161-3 [Table
1])
was evident in outer membrane extracts (Fig.
1B, lane 7),
although this
was not seen in whole-cell extracts (Fig.
1A, lane
7) and, therefore,
must have occurred during the fractionation
procedure.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Western immunoblot of whole-cell extracts (A) and outer
membrane proteins (B) of P. aeruginosa K691 (lanes 1)
and K691 harboring plasmids pPVR2 (lanes 2), pLK127-2 (lanes 3), pLK21S
(lanes 4), pLK39S-1 (lanes 5), pLK16-1 (lanes 6), pLK161-3 (lanes 7),
and pLK141-1 (lanes 8) probed with an FpvA-specific antiserum. Cells
were cultured overnight in iron-deficient minimal medium and used to
prepare whole-cell or outer membrane protein extracts which were
subsequently electrophoresed on SDS-polyacrylamide gels and
immunoblotted. In a typical experiment, 2.5 µl of outer membrane and
10 to 20 µl of whole-cell protein extracts were loaded onto
SDS-polyacrylamide gels.
|
|
Activity of FpvA derivatives.
We then assessed the
impact of the insertions on FpvA receptor activity. Growth of
P. aeruginosa in minimal medium supplemented with the nonmetabolizable iron chelator EDDHA [ethylene
diamine di(o-hydroxyphenyl acetic acid)] is dependent
upon the production of pyoverdine and the presence of a
functional ferric pyoverdine uptake system (32). Thus, the
growth of K691 harboring the various fpvA insertion
derivatives in medium containing EDDHA was measured. As expected,
K691 itself grew very poorly, if at all, while the same strain
harboring and expressing the wild-type fpvA gene
(pPVR2) grew well (Table 1). Most of the FpvA insertion derivatives
also provided for excellent growth of K691 in EDDHA-containing
medium (Table 1), including those with insertions at R451 (pLK161-3), R521 (pLK32S-1), and R558 (pLK39S-1), indicating that insertions in
these regions did not interfere with receptor function. In contrast,
insertions at Y350 (pLK141-1) and A402 (pLK127-2) abolished the ability
of these FpvA derivatives to support the growth of K691 in this medium
(Table 1), consistent with these regions being important for FpvA
activity. The apparent defect in activity of receptors
FpvAY350 and FpvAA402 was confirmed in
pyoverdine-mediated iron uptake assays (Fig.
2). As expected, K691 harboring wild-type fpvA (present on pPVR2) or an fpvA insertion
derivative which did not adversely affect growth in
EDDHA-containing medium (e.g., FpvAR521
[pLK21S-1]) was proficient in ferric pyoverdine uptake (Fig. 2).
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Pyoverdine-mediated iron uptake by P. aeruginosa K691 harboring pAK1900 ( ), pPVR2 ( ), pLK127-2
( ), pLK141-1 ( ), and pLK21S-1 ( ). The data are representative
of three separate experiments carried out in duplicate and are reported
for cells at an A600 of 1.0.
|
|
Given the functional importance of the region(s) of FpvA in the
vicinity of residues Y350 and A402, it seemed likely that
these regions
were somehow involved in ligand (i.e., ferric pyoverdine)
binding. To test this, outer membranes were prepared from K691
harboring native FpvA and various insertion derivatives and examined
for binding of ferric pyoverdine, as described previously
(
21).
As expected, K691 harboring the native receptor
(pPVR2) demonstrated
binding of ferric pyoverdine, as did K691
harboring insertion
derivative FpvA
R521 (Table
1).
FpvA
R521-expressing cells did
demonstrate less
binding of ferric pyoverdine than did cells expressing
native FpvA,
probably reflecting the decreased production of FpvA
R521 relative to the pPVR2-encoded native protein (Fig.
1, cf. lanes
3 and
5). In contrast, K691 harboring FpvA
A402 or
FpvA
Y350 showed
minimal ferric pyoverdine binding,
comparable to levels observed
for K691 carrying vector only (Table
1)
or PAO1 cultured under
iron-rich conditions (under which conditions
FpvA is not induced)
(0.64 ± 0.40 pmol of Fe). These data suggest
that the region(s)
of FpvA neighboring A402 and Y350 is important for
ferric pyoverdine
binding and may contribute to a binding site. Still,
it cannot
be ruled out that this region(s) interacts with the
ligand-binding
domain(s) of FpvA and its disruption indirectly impacts
the ligand-binding
site.
Ferric siderophore receptors appear to be gated porins, with the gate
region functioning both to control access to the channel
and as a
ligand-binding site. Indeed, deletion of a single aspartic
acid residue
(D348) within the
E. coli FhuA ferrichrome receptor
obviates ligand binding (
23), and this residue occurs in a
region
of the receptor whose deletion converts FhuA into a diffusion
channel (
22). Similarly, deletion of a region of the ferric
enterobactin receptor FepA, implicated in ligand binding, also
converts
the protein into a nonspecific channel, indicating that
the binding
domain exists as part of a gate region in this receptor
as well
(
26,
36). The identification here of a region of FpvA
which
is likely extramembranous and possibly involved in ligand
binding
suggests that the Y350-A402 region of FpvA may comprise
part of a gate
region for this receptor. Despite repeated attempts
to delete this
region of FpvA, however, we have failed to express
the deletion
derivative in
E. coli or
P. aeruginosa.
Certain deletions
of other ferric siderophore receptors appear also to
be unobtainable
(
9). Intriguingly, the insertions at Y350
and A402 occur adjacent
to basic amino acids, and arginine residues of
the FepA gate region
have recently been implicated in ferric
siderophore binding (
29).
We are currently using
site-directed mutagenesis to assess the
significance of these and other
residues near Y350 and A402 in
ferric pyoverdine
binding.
| |
ACKNOWLEDGMENTS |
We thank P. Klebba for helpful suggestions regarding the
ferric pyoverdine binding assay.
This work was supported by an operating grant from the Medical Research
Council of Canada. K.P. is a Natural Sciences and Engineering
Research Council University Research Fellow.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Queen's University, Kingston, Ontario K7L 3N6, Canada. Phone: (613) 545-6677. Fax: (613) 545-6796. E-mail: poolek{at}post.queensu.ca.
| |
REFERENCES |
| 1.
|
Agterberg, M.,
H. Adriaanse,
E. Tijhaar,
A. Resink, and J. Tommassen.
1989.
Role of the cell surface-exposed regions of outer membrane protein PhoE of Escherichia coli K12 in the biogenesis of the protein.
Eur. J. Biochem.
185:365-370[Medline].
|
| 2.
|
Ankenbauer, R.,
S. Sriyosachati, and C. D. Cox.
1985.
Effects of siderophores on the growth of Pseudomonas aeruginosa in human serum and transferrin.
Infect. Immun.
49:132-140[Abstract/Free Full Text].
|
| 3.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1992.
Short protocols in molecular biology, 2nd ed.
John Wiley & Sons, Inc., New York, N.Y.
|
| 4.
|
Bosch, D., and J. Tommassen.
1987.
Effects of linker insertions on the biogenesis and functioning of the Escherichia coli outer membrane pore protein PhoE.
Mol. Gen. Genet.
208:485-489[Medline].
|
| 5.
|
Bosch, D.,
W. Voorhout, and J. Tommassen.
1988.
Export and localization of N-terminally truncated derivatives of Escherichia coli K-12 outer membrane protein PhoE.
J. Biol. Chem.
263:9952-9957[Abstract/Free Full Text].
|
| 6.
|
Boulain, J. C.,
A. Charbit, and M. Hofnung.
1986.
Mutagenesis by random linker insertion into the lamB gene of Escherichia coli K12.
Mol. Gen. Genet.
205:339-348[Medline].
|
| 7.
|
Braun, V.
1995.
Energy-coupled transport and signal transduction through the Gram-negative outer membrane via TonB-ExbB-ExbD-dependent receptor proteins.
FEMS Microbiol. Rev.
16:295-307[Medline].
|
| 8.
|
Brown, M. R. W.,
H. Anwar, and P. A. Lambert.
1984.
Evidence that mucoid Pseudomonas aeruginosa in the cystic fibrosis lung grows under iron-restricted conditions.
FEMS Microbiol. Lett.
21:113-117.
|
| 9.
|
Carmel, G., and J. W. Coulton.
1991.
Internal deletions in the FhuA receptor of Escherichia coli K-12 define domains of ligand interactions.
J. Bacteriol.
173:4394-4403[Abstract/Free Full Text].
|
| 10.
|
Charbit, A.,
J. Ronco,
V. Michel,
C. Werts, and M. Hofnung.
1991.
Permissive sites and topology of an outer membrane protein with a reporter epitope.
J. Bacteriol.
173:262-275[Abstract/Free Full Text].
|
| 11.
|
Cox, C. D.
1980.
Iron uptake with ferripyochelin and ferric citrate by Pseudomonas aeruginosa.
J. Bacteriol.
142:581-587[Abstract/Free Full Text].
|
| 12.
|
Cox, C. D.
1982.
Effect of pyochelin on the virulence of Pseudomonas aeruginosa.
Infect. Immun.
36:17-23[Abstract/Free Full Text].
|
| 13.
|
Cox, C. D., and P. Adams.
1985.
Siderophore activity of pyoverdin for Pseudomonas aeruginosa.
Infect. Immun.
48:130-138[Abstract/Free Full Text].
|
| 14.
|
Crosa, J. H.
1984.
The relationship of plasmid-mediated iron transport and bacterial virulence.
Annu. Rev. Microbiol.
38:69-89[Medline].
|
| 15.
|
Dean, C. R., and K. Poole.
1993.
Expression of the ferric enterobactin receptor (PfeA) of Pseudomonas aeruginosa: involvement of a two-component regulatory system.
Mol. Microbiol.
8:1095-1103[Medline].
|
| 16.
|
Fellay, R.,
J. Frey, and H. Krisch.
1987.
Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative bacteria.
Gene
52:147-154[Medline].
|
| 17.
|
Freudl, R.
1989.
Insertion of peptides into cell-surface-exposed area of the Escherichia coli OmpA protein does not interfere with export and membrane assembly.
Gene
82:229-236[Medline].
|
| 18.
|
Griffiths, E.
1987.
The iron-uptake systems of pathogenic bacteria, p. 69-137.
In
J. J. Bullen, and E. Griffiths (ed.), Iron and infection. John Wiley & Sons, Inc., New York, N.Y.
|
| 19.
|
Griffiths, E.,
P. Stevenson, and P. Joyce.
1983.
Pathogenic Escherichia coli express new outer membrane proteins when growing in vivo.
FEMS Microbiol. Lett.
16:95-99.
|
| 20.
|
Haas, B.,
J. Kraut,
J. Marks,
S. Cassin Zanker, and D. Castignetti.
1991.
Siderophore presence in sputa of cystic fibrosis patients.
Infect. Immun.
59:3997-4000[Abstract/Free Full Text].
|
| 21.
|
Hohnadel, D., and J.-M. Meyer.
1988.
Specificity of pyoverdine-mediated iron uptake among fluorescent Pseudomonas strains.
J. Bacteriol.
170:4865-4873[Abstract/Free Full Text].
|
| 22.
|
Killmann, H.,
R. Benz, and V. Braun.
1993.
Conversion of the FhuA transport protein into a diffusion channel through the outer membrane of Escherichia coli.
EMBO J.
12:3007-3016[Medline].
|
| 23.
|
Killmann, H., and V. Braun.
1992.
An aspartate deletion mutation defines a binding site of the multifunctional FhuA outer membrane receptor of Escherichia coli K-12.
J. Bacteriol.
174:3479-3486[Abstract/Free Full Text].
|
| 24.
|
Lam, C.,
F. Turnowsky,
E. Schwarzinger, and W. Neruda.
1984.
Bacteria recovered without subculture from infected human urines expressed iron-regulated outer membrane proteins.
FEMS Microbiol. Lett.
24:255-259.
|
| 25.
|
Meyer, J.-M.,
A. Neely,
A. Stintzi,
C. Georges, and I. A. Holder.
1996.
Pyoverdin is essential for virulence of Pseudomonas aeruginosa.
Infect. Immun.
64:518-523[Abstract].
|
| 26.
|
Murphy, C. K.,
V. I. Kalve, and P. E. Klebba.
1990.
Surface topology of the Escherichia coli K-12 ferrienterobactin receptor.
J. Bacteriol.
172:2736-2746[Abstract/Free Full Text].
|
| 27.
|
Neilands, J. B.
1981.
Iron absorption and transport in microorganisms.
Annu. Rev. Nutr.
1:27-46[Medline].
|
| 28.
|
Neilands, J. B.
1981.
Microbial iron compounds.
Annu. Rev. Biochem.
50:715-731[Medline].
|
| 29.
|
Newton, S. M.,
J. S. Allen,
Z. Cao,
Z. Qi,
X. Jiang,
C. Sprencel,
J. D. Igo,
S. B. Foster,
M. A. Payne, and P. E. Klebba.
1997.
Double mutagenesis of a positive charge cluster in the ligand-binding site of the ferric enterobactin receptor, FepA.
Proc. Natl. Acad. Sci. USA
94:4560-4565[Abstract/Free Full Text].
|
| 30.
|
Nicas, T. I., and R. E. W. Hancock.
1980.
Outer membrane protein H1 of Pseudomonas aeruginosa: involvement in adaptive and mutational resistance to ethylenediaminetetraacetate, polymyxin B, and gentamicin.
J. Bacteriol.
143:872-878[Abstract/Free Full Text].
|
| 31.
|
Poole, K.,
C. Dean,
D. Heinrichs,
S. Neshat,
K. Krebes,
L. Young, and L. Kilburn.
1996.
Siderophore-mediated iron transport in Pseudomonas aeruginosa, p. 371-383.
In
T. Nakazawa, K. Furukawa, D. Haas, and S. Silver (ed.), Molecular biology of pseudomonads. American Society for Microbiology, Washington, D.C.
|
| 32.
|
Poole, K.,
S. Neshat, and D. Heinrichs.
1991.
Pyoverdine-mediated iron transport in Pseudomonas aeruginosa: involvement of a high-molecular-mass outer membrane protein.
FEMS Microbiol. Lett.
78:1-5.
|
| 33.
|
Poole, K.,
S. Neshat,
K. Krebes, and D. E. Heinrichs.
1993.
Cloning and nucleotide sequence analysis of the ferripyoverdine receptor gene fpvA of Pseudomonas aeruginosa.
J. Bacteriol.
175:4597-4604[Abstract/Free Full Text].
|
| 34.
|
Poole, K.,
Q. Zhao,
S. Neshat,
D. E. Heinrichs, and C. R. Dean.
1996.
The tonB gene of Pseudomonas aeruginosa encodes a novel TonB protein.
Microbiology
142:1449-1458[Abstract/Free Full Text].
|
| 35.
|
Postle, K.
1990.
TonB and the gram-negative dilemma.
Mol. Microbiol.
4:2019-2025[Medline].
|
| 36.
|
Rutz, J. M.,
J. Liu,
J. A. Lyons,
J. Goranson,
S. K. Armstrong,
M. McIntosh,
J. B. Feix, and P. E. Klebba.
1992.
Formation of a gated channel by a ligand-specific transport protein in the bacterial outer membrane.
Science
258:471-475[Abstract/Free Full Text].
|
| 37.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 38.
|
Simon, R.,
U. Priefer, and A. Puehler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology
1:784-791.
|
| 39.
|
Srikumar, R.,
T. Kon,
N. Gotoh, and K. Poole.
1998.
Expression of Pseudomonas aeruginosa multidrug efflux pumps MexA-MexB-OprM and MexC-MexD-OprJ in a multidrug-sensitive Escherichia coli strain.
Antimicrob. Agents Chemother.
42:65-71[Abstract/Free Full Text].
|
| 40.
|
Sriyosachati, S., and C. D. Cox.
1986.
Siderophore-mediated iron acquisition from transferrin by Pseudomonas aeruginosa.
Infect. Immun.
52:885-891[Abstract/Free Full Text].
|
| 41.
|
Wong, K. K. Y.,
K. Poole,
N. Gotoh, and R. E. W. Hancock.
1997.
Influence of OprM expression on multiple antibiotic resistance in Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
41:2009-2012[Abstract].
|
Journal of Bacteriology, December 1998, p. 6753-6756, Vol. 180, No. 24
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shen, J.-S., Geoffroy, V., Neshat, S., Jia, Z., Meldrum, A., Meyer, J.-M., Poole, K.
(2005). FpvA-Mediated Ferric Pyoverdine Uptake in Pseudomonas aeruginosa: Identification of Aromatic Residues in FpvA Implicated in Ferric Pyoverdine Binding and Transport. J. Bacteriol.
187: 8511-8515
[Abstract]
[Full Text]
-
James, H. E., Beare, P. A., Martin, L. W., Lamont, I. L.
(2005). Mutational Analysis of a Bifunctional Ferrisiderophore Receptor and Signal-Transducing Protein from Pseudomonas aeruginosa. J. Bacteriol.
187: 4514-4520
[Abstract]
[Full Text]
-
Shen, J., Meldrum, A., Poole, K.
(2002). FpvA Receptor Involvement in Pyoverdine Biosynthesis in Pseudomonas aeruginosa. J. Bacteriol.
184: 3268-3275
[Abstract]
[Full Text]
Top
Abstract
Text
