Previous Article | Next Article ![]()
Journal of Bacteriology, December 1998, p. 6757-6760, Vol. 180, No. 24
Department of Microbiology, Molecular Biology
and Biochemistry, University of Idaho, Moscow, Idaho 83844-3052
Received 1 May 1998/Accepted 2 October 1998
Plasmids with the aadA gene from plasmid R100, which
confers resistance to the aminoglycosides spectinomycin and
streptomycin in Escherchia coli, can be introduced into
wild-type Myxococcus xanthus, strain DK1622, by
electroporation. Recombinant M. xanthus strains with
integrated plasmids carrying the aadA gene acquire resistance to high levels of these antibiotics. Selection for aadA in M. xanthus can be carried out
independently of, or simultaneously with, selection for resistance to
kanamycin. The kinds and frequencies of recombination events observed
between integrative plasmids with aadA and the M. xanthus chromosome are similar to those observed after the
transformation of yeast. Cleavage of integrative plasmid DNA at a
site adjacent to a region of homology between the plasmid and
the M. xanthus genome favors the targeted disruption of
M. xanthus genes by allele replacement.
The soil bacterium Myxococcus
xanthus is a model prokaryotic system for the study of
intercellular communication. Cell-cell interactions play central roles
in both gliding motility and an elaborate multicellular developmental
cycle initiated by starvation. Development leads to the morphogenesis
of fruiting bodies containing differentiated, heat-resistant spores.
Although the change from rod-shaped vegetative cells to spherical
spores is rapid, genetic methods have been used successfully to arrange
the early steps of this process into an ordered series of molecular
events. Many mutations that block M. xanthus
development do not affect vegetative growth. Consequently, methods for
the analysis of mutations that block development have relied on genetic
manipulations with vegetative cells.
Following the discovery that transposon Tn5 is active in
M. xanthus (14), Tn5-lac, among
the first hybrid transposons used to generate reporter gene fusions,
was constructed and used in M. xanthus (11).
The isolation of transposon-generated fusions of lacZ with
developmentally induced promoters has resulted in a set of temporal
signposts that distinguish different developmental stages (12,
13). In addition, M. xanthus has generalized
transducing phages (5, 18). which permit fine-structure
mapping. One of these phages, Mx8, is temperate and
integrates as a prophage at a preferred chromosomal locus
(attB). Because plasmid origins of replication that
function in other gram-negative bacteria do not function as origins in
M. xanthus, these plasmids can be used as integrative
vectors if they carry either a region of homology with the
M. xanthus genome (19, 24, 26) or the Mx8
int-attP region (15, 20).
Because M. xanthus has a high frequency of homologous
recombination, the integration of plasmids by homologous recombination can be used to generate merodiploids and exchange engineered alleles with chromosomal alleles of targeted genes (19). Thus,
plasmids with cloned M. xanthus inserts can be used in
the same way that yeast integrative plasmids (yIPs) are used to
manipulate the Saccharomyces cerevisiae genome (8,
21). Alternatively, plasmids can be integrated at the
attB locus to construct more-stable merodiploids for
complementation tests (24, 26). Plasmids can be introduced into M. xanthus efficiently by using the improved
method for electroporation we developed (10).
The rules for homologous recombination between a plasmid and the
M. xanthus genome appear to be similar to those for
recombination between yIPs and the S. cerevisiae genome
(21). Both circular and linear plasmid DNAs give rise to
recombinants, and electroporation with linear plasmid DNA often results
in the integration of a circular form of the plasmid, presumably
mediated by gap repair of double-stranded ends. Gap repair of the ends
of linear plasmids poses a significant problem for the construction of
gene disruptions, because single crossover events between a repaired
plasmid and the genome, leading to cointegrate formation, can be more
frequent than double crossover events leading to allele replacement.
To date, only the kanamycin resistance (Kmr) determinants
derived from Tn5 (14) or Tn903
(25) have worked well in both Escherichia coli
and M. xanthus hosts. Unfortunately, M. xanthus is naturally resistant to gentamicin. Although
tetracycline resistance determinants have been shown to function in
M. xanthus (2), these determinants work
poorly when it is grown in its preferred, rich medium
supplemented with Mg2+. Growth in the presence of
Mg2+ likely facilitates a natural mechanism for
tetracycline export and thereby leads to a high background of
tetracycline-resistance phenocopies. Although resistance to
tetracycline mediated by the Tn10 tetA determinant works
well in M. xanthus, selection for this gene on
high-copy-number plasmids in E. coli is lethal
(4), unless the cells are plated on media with
oxytetracycline. The tetA determinant of plasmid
pBR322, which works well in high copy numbers in E. coli,
works relatively poorly in M. xanthus (our unpublished observations). Li and Shimkets have used the
trimethoprim resistance determinant for plasmid R338 successfully
in M. xanthus (16). We have found that its
success in M. xanthus depends on the relative
concentration of competing folates in rich, Casitone-containing medium
and that selection for this marker in many E. coli hosts can
be problematic.
As part of our search for additional antibiotic resistance determinants
that function well in both M. xanthus and E. coli, we tested whether the aadA gene of plasmid R100
might confer resistance to both spectinomycin (Spr) and
streptomycin (Smr) in M. xanthus. Campos
and coworkers have shown that M. xanthus is sensitive
to both antibiotics (5). Consistent with this, we found that
wild-type M. xanthus (strain DK1622) (9)
plated with low efficiencies (8 × 10 To test whether the aadA gene confers antibiotic resistance
on M. xanthus, we constructed plasmid pAY952
(17). This plasmid was constructed by adding the
2.2-kb fragment of Mx8 DNA with the int and
attP genes to plasmid pGB2 (6), which has both the aadA gene and an origin of replication derived from
R100. Upon electroporation of pAY952 into DK1622, Spr
Smr recombinants arose at a frequency of about 200-fold
above the backgroud frequency of spontaneous resistant mutants
(Table 1), indicating that the
aadA gene functions in M. xanthus.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The aadA Gene of Plasmid R100 Confers Resistance to
Spectinomycin and Streptomycin in Myxococcus
xanthus
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
7) on rich CTPM
(28) medium supplemented with either 0.8 mg of spectinomycin
per ml or 1.0 mg of streptomycin per ml. On medium with both
antibiotics, M. xanthus plated with an even lower
efficiency (4 × 10
7), and usually >90% of the
colonies formed after 5 days at 32°C did not grow when
repurified on the same medium. Presumably, the potency of these
antibiotics decreased during the long (5- to 7-day) incubation
times required for the growth of M. xanthus colonies.
Consistent with this idea, the frequency of resistant phenocopies is
greater on plates that have been stored at room temperature for several
days before use.
TABLE 1.
Efficiencies of electroporation of int-attP
plasmids into wild-type M. xanthus
(strain DK1622).
To demonstrate that this Spr Smr marker can be used in combination with selection for kanamycin resistance, we constructed a cointegrate plasmid, pAY1074, with an insertion of pGB2 in the fibR gene (28). The fibR gene is located within a 3.5-kb region of the M. xanthus genome which we subcloned from plasmid pAY694 (28) into plasmid vector pBGS18, which has the Kmr determinant of transposon Tn903 (25), to make pAY1071. To build pAY1071, the 3.5-kb BglII-HindIII fragment of pAY694 was ligated to the BamHI and HindIII sites of pBGS18. To build pAY1074, pAY1071 was cleaved at a unique AgeI site within fibR, pGB2 was cleaved at its unique XmaI site in its polylinker, and the plasmids were ligated together.
We electroporated both circular plasmid DNA and plasmid DNA treated with several different restriction endonucleases into DK1622, selected for Kmr Spr Smr or Spr Smr recombinants, and screened the Spr Smr recombinants for the Kmr phenotype. Four conclusions can be drawn from the results shown in Fig. 1. First, when a closed circular plasmid carrying a Spr Smr insertion in a 3.5-kb region of homology with the M. xanthus genome is electroporated into M. xanthus, about half of the recombinants are Kmr cointegrates, and the other half are Kms strains in which an allele replacement event has occurred. Second, cleavage of the plasmid at a unique site within the region of homology (FseI) stimulates recombination between the plasmid and chromosome. This result suggests that, as in yeast (21), DNA ends are recombinogenic in M. xanthus. However, cleavage at a unique site within the region of homology (such as the FseI site of pAY1074) does not discourage the formation of cointegrates. Third, cleavage of plasmid pAY1074 at a unique site past the end of the region of homology (SmaI or Acc65I) does not stimulate the yield of recombinants, as it does for some yIPs (21). However, it favors the recovery of Spr Smr strains resulting from allele replacement events, and this bias is more pronounced with SmaI, which generates a blunt-ended linear module. Fourth, cleavages of the plasmid at two sites (with XhoI), one at the junction of the homologous region and a second with the Kmr determinant of the plasmid vector backbone, have similar effects on the frequency and types of recombinants. In both M. xanthus and S. cerevisiae, illegitimate recombination events between homologous substrates and the genome are almost never observed, and the similarities between the recombinational fates of circular and linear plasmid DNAs in these hosts are striking. Thus, the simplest interpretation of our results is that, as in S. cerevisiae, double-stranded DNA ends are the preferred substrates for the M. xanthus recombinational machinery.
|
These results show that a simple procedure can be used to cross an insertion marked by an antibiotic resistance determinant onto the M. xanthus chromosome. A plasmid carrying the insertion should be cleaved at one or both ends of its region of homology with the chromosome prior to electroporation to discourage the formation of cointegrates. We have obtained similar results after cleavage and electroporation of plasmids with several different subcloned regions of the M. xanthus genome. In each case, cleavage of a plasmid at one or both ends of the region of homology with the chromosome favors the recovery of recombinants in which allele replacement events have occurred. This method for generating allele replacements on the M. xanthus genome is simpler than the previous methods, which have relied on two sequential selections for the integration and excision of plasmids carrying the selectable Kmr determinant and the counterselectable E. coli galK (27) or Bacillus subtilis sacBR (29) genes.
We note that the electroporation of linear DNA molecules derived from circular plasmids into several other bacteria has been used successfully to generate allele replacements. Linearization of a plasmid carrying a subcloned Haemophilus ducreyi gene interrupted by an antibiotic resistance determinant also appears to stimulate allele exchange (7). The more recent demonstrations that linear DNA molecules permit allelic exchange in Mycobacterium bovis BCG (1), Mycobacterium tuberculosis (3), and Borrelia burgdorferi (22) will facilitate the genetic analysis of these pathogens in the near future.
To increase the versatility of Spr Smr plasmids
as shuttle vectors for use in both E. coli and M. xanthus, we constructed a derivative of pGB2, pAY1099, with the
-complementing fragment of the lacZ gene from plasmid
pLTMUS28 (New England Biolabs). Primers 5'
GGAGGGTGGCCAAATGTGAGTTAGCTCACTCA and
GCCGGCCAATTGTTATTACCAAGCGAAGCGCC were used to amplify bp
2315 to 2798 of pLITMUS28, and the amplified product was cleaved with
MscI and MfeI and ligated to the EcoRI and filled-in HindIII sites of pGB2 (6). This
amplified fragment has many unique cloning sites within a polylinker
located at the 5' end of the lacZ gene. Many recombinant
plasmids with inserts in this polylinker can be screened by
-complementation in an appropriate E. coli host, such as
JM107 (30), in the presence of chromogenic substrates for
-galactosidase.
We also made a derivative of pGB2 with both the
-complementing
fragment and the Mx8 int-attP region present in pAY952.
pAY952 was cleaved with EcoRI and Acc65I, ends
were filled in, and the plasmid backbone was ligated to make plasmid
pAY1103. The amplified fragment of pLITMUS28 was cleaved with
MscI and MfeI and ligated to the filled-in
HindIII site of pAY1103 to make pAY1105. When derivatives of pAY1105 are electroporated into M. xanthus, they prefer to integrate at the attB bacterial
attachment site for prophage Mx8, even if they carry a region of
homology with the M. xanthus genome (data not shown).
The structures of these integrative shuttle vectors, which may have
more general uses in other myxobacteria or gram-negative hosts
sensitive to the aminoglycosides spectinomycin and
streptomycin, are shown in Fig. 2.
|
| |
ACKNOWLEDGMENTS |
|---|
We thank George Churchward for the gift of plasmid pGB2 DNA and Ellie Graham for technical assistance.
This work was supported by grants GM50962 and GM53392 to P.L.H. and P.Y., respectively, from the National Institutes of Health and by EPSCoR grant OSR-9350539 to P.L.H.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Molecular Biology and Biochemistry, University of Idaho, Moscow, ID 83844-3052. Phone: (208) 885-0571. Fax: (208) 885-6518. E-mail: pay{at}uidaho.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Aldovini, A.,
R. N. Husson, and R. A. Young.
1993.
The uraA locus and homologous recombination in Mycobacterium bovis BCG.
J. Bacteriol.
175:7282-7289 |
| 2. | Avery, L., and D. Kaiser. 1983. In situ transposon replacement and isolation of a spontaneous tandem genetic duplication. Mol. Gen. Genet. 191:99-109[Medline]. |
| 3. |
Balasubramanian, V.,
M. S. Pavelka, Jr.,
S. S. Bardarov,
J. Martin,
T. R. Weisbrod,
R. A. McAdam,
B. R. Bloom, and W. R. Jacobs, Jr.
1996.
Allelic exchange in Mycobacterium tuberculosis with long linear recombination substrates.
J. Bacteriol.
178:273-279 |
| 4. |
Berg, C. M.,
L. Liu,
B. Wang, and M-D. Wang.
1988.
Rapid identification of bacterial genes that are lethal when cloned on multicopy plasmids.
J. Bacterial.
170:468-470.
|
| 5. | Campos, J. M., J. Geisselsoder, and D. R. Zusman. 1978. Isolation of bacteriophage MX4, a generalized transducing phage for Myxococcus xanthus. J. Mol. Biol. 119:167-178[Medline]. |
| 6. | Churchward, G., D. Belin, and Y. Nagamine. 1984. A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors. Gene 31:165-171[Medline]. |
| 7. |
Hansen, E. J.,
J. L. Latimer,
S. E. Thomas,
M. Helminen,
W. L. Albritton, and J. D. Radolf.
1992.
Use of electroporation to construct isogenic mutants of Haemophilus ducreyi.
J. Bacteriol.
174:5442-5449 |
| 8. |
Hinnen, A.,
J. B. Hicks, and G. R. Fink.
1978.
Transformation of yeast.
Proc. Natl. Acad. Sci. USA
75:1929-1933 |
| 9. |
Kaiser, D.
1979.
Social gliding is correlated with the presence of pili in Myxococcus xanthus.
Proc. Natl. Acad. Sci. USA
76:5952-5956 |
| 10. |
Kashefi, K., and P. L. Hartzell.
1995.
Genetic suppression and phenotypic masking of a Myxococcus xanthus frzF defect.
Mol. Microbiol.
15:483-494[Medline].
|
| 11. |
Kroos, L., and D. Kaiser.
1984.
Construction of Tn5-lac, a transposon that fuses lacZ expression to exogenous promoters, and its introduction into Myxococcus xanthus.
Proc. Natl. Acad. Sci. USA
81:5816-5820 |
| 12. |
Kroos, L., and D. Kaiser.
1987.
Expression of many developmentally regulated genes in Myxococcus depends on a sequence of cell interactions.
Genes Dev.
1:840-854 |
| 13. | Kroos, L., A. Kuspa, and D. Kaiser. 1986. A global analysis of developmentally regulated genes in Myxococcus xanthus. Dev. Biol. 117:252-266[Medline]. |
| 14. |
Kuner, J., and A. D. Kaiser.
1981.
Introduction of transposon Tn5 into Myxococcus for analysis of developmental and other non-selectable mutants.
Proc. Natl. Acad. Sci. USA
78:425-429 |
| 15. |
Li, S., and L. J. Shimkets.
1988.
Site-specific integration and expression of a developmental promoter in Myxococcus xanthus.
J. Bacteriol.
170:5552-5556 |
| 16. |
Li, S-F., and L. J. Shimkets.
1993.
Effect of dsp mutations on the cell-to-cell transmission of CsgA in Myxococcus xanthus.
J. Bacteriol.
175:3648-3652 |
| 17. | Magrini, V., C. Creighton, M. L. Storms, and P. Youderian. Site-specific recombination of temperate Myxococcus xanthus phage Mx8: genetic elements required for integration. Submitted for publication. |
| 18. | Martin, S., E. Sodergren, T. Masuda, and A. D. Kaiser. 1978. Systematic isolation of transducing phages for Myxococcus xanthus. Virology 88:44-53[Medline]. |
| 19. |
O'Connor, K. A., and D. R. Zusman.
1983.
Coliphage P1-mediated transduction of cloned DNA from Escherichia coli to Myxococcus xanthus: use for complementation and recombinational analyses.
J. Bacteriol.
155:317-329 |
| 20. |
Orndorff, P.,
E. Stellwag,
T. Starich,
M. Dworkin, and J. Zissler.
1983.
Genetic and physical characterization lysogeny by bacteriophage MX8 in Myxococcus xanthus.
J. Bacteriol.
154:772-779 |
| 21. |
Orr-Weaver, T. L.,
J. W. Szostak, and R. J. Rothstein.
1981.
Yeast transformation: a model system for the study of recombination.
Proc. Natl. Acad. Sci. USA
78:6354-6358 |
| 22. |
Rosa, P.,
D. S. Samuels,
D. Hogan,
B. Stevenson,
C. Casjens, and K. Tilly.
1996.
Directed insertion of a selectable marker into a circular plasmid of Borrelia burgdorferi.
J. Bacteriol.
178:5946-5953 |
| 23. |
Salmi, D.,
V. Magrini,
P. L. Hartzell, and P. Youderian.
1998.
Genetic determinants of immunity and integration of temperate Myxococcus xanthus phage Mx8.
J. Bacteriol.
180:614-621 |
| 24. | Shimkets, L. J., and S. J. Asher. 1988. Use of recombination techniques to examine the structure of the csg locus of Myxococcus xanthus. Mol. Gen. Genet. 211:63-71[Medline]. |
| 25. | Spratt, B. G., P. J. Hedge, S. te Heesen, Edelman, and J. K. Broome-Smith. 1986. Kanamycin-resistant vectors that are analogues of plasmids pUC8, pUC9, pEMBL8 and pEMBL9. Gene 41:337-342[Medline]. |
| 26. | Stephens, K., and A. D. Kaiser. 1987. Genetics of gliding motility in Myxococcus xanthus: molecular cloning of the mgl locus. Mol. Gen. Genet. 207:256-266. |
| 27. | Ueki, T., S. Inouye, and M. Inouye. 1996. Positive-negative KG cassettes for construction of multi-gene deletions using a single drug marker. Gene 183:153-157[Medline]. |
| 28. |
Weimer, R. M.,
C. Creighton,
A. Stassinopoulos,
P. Youderian, and P. L. Hartzell.
1998.
A chaperone in the HSP70 family controls production of extracellular fibrils in Myxococcus xanthus.
J. Bacteriol.
180:5357-5368 |
| 29. |
Wu, S. S., and D. Kaiser.
1996.
Markerless deletions of pil genes in Myxococcus xanthus generated by counterselection with the Bacillus subtilis sacB gene.
J. Bacteriol.
178:5817-5821 |
| 30. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»