Previous Article | Next Article 
J Bacteriol, February 1998, p. 614-621, Vol. 180, No. 3
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Genetic Determinants of Immunity and Integration of
Temperate Myxococcus xanthus Phage Mx8
Daniel
Salmi,
Vincent
Magrini,
Patricia L.
Hartzell, and
Philip
Youderian*
Department of Microbiology, Molecular Biology
and Biochemistry, University of Idaho, Moscow, Idaho 83844-3052
Received 25 July 1997/Accepted 17 November 1997
 |
ABSTRACT |
An 8.1-kb fragment of the temperate Myxococcus xanthus
phage Mx8 genome, when cloned into a plasmid vector, permits
site-specific integration of the plasmid and confers superinfection
immunity. Sequence analysis of a 9.5-kb region of Mx8 DNA containing
this fragment reveals 19 densely packed open reading frames, four of which have predicted products with known or suspected activities. The
Mx8 imm gene, required for superinfection immunity, has a sequence similar to that of Arabidopsis thaliana
G-box-binding factor 1. Mx8 makes a DNA adenine methylase, Mox, and
integrase, Int, related to other methylases and integrases. The
int gene has two alternate translation initiation codons
within the extensively overlapping uoi (upstream of int)
gene. Comparison of the predicted product of the uoi gene
with Salmonella phage P22 and Streptomyces plasmid Xis proteins shows that temperate phage excisionases may use
variations of a helix-turn-helix motif to recognize specific DNA
sequences.
 |
INTRODUCTION |
Myxococcus xanthus is the
best-characterized representative of the myxobacteria, gram-negative
bacteria that live in the soil. The myxobacteria are unique among the
eubacteria, because they undergo a complex, multicellular developmental
cycle when starved for nutrients. When nutrient levels are low,
hundreds of thousands of bacteria glide to aggregate into macroscopic
fruiting bodies with a complex cellular organization. Within these
fruiting bodies, a fraction of cells differentiate into spores that are
resistant to UV light, desiccation, and heat and are capable of
germination into totipotent vegetative cells once nutrients become
available.
Several bacteriophages are known to infect M. xanthus. These
include the lytic phages Mx1 (8), Mx4 (10), and
Mx9 (28). Mx1 and Mx4 resemble coliphages T4 and P1,
respectively, in morphology and have large genome sizes (7,
10). Although one mutant strain of Mx4, Mx4 ts-27 htf-1
hrm-1, is routinely used for the generalized transduction of
M. xanthus (10, 15), its use is limited by its
small burst sizes and low efficiencies of plating (EOPs) when grown on
motile, fruiting strains of M. xanthus. Mx9 resembles
Salmonella typhimurium phage P22 in morphology and has a
smaller genome (28). The lytic myxophages exhibit an unusual adaptation to their host. When phage-infected cells of M. xanthus are starved, lytic phage growth arrests upon development.
The infecting phage genome is trapped in mature spores in a dormant state and can escape this state to lyse vegetative cells formed by the
germination of spores (8, 9).
Three serologically related myxophages, Mx8, Mx81, and Mx82, are
temperate and, like Mx9, resemble P22 in morphology (28). All three phages package terminally repetitious, circularly permuted, double-stranded genomes. Among these, the best understood is Mx8, which
encapsidates a genome 49 kb in length with a terminal repetition of
about 4 kb (reference 43 and this report). Among the
myxophages, Mx8 shows the most promise as a genetic tool to investigate
the complex multicellular development of its host. Because Mx8 can lysogenize M. xanthus, and the resulting lysogen is stable
during vegetative growth, Mx8 could be used as a cloning vector to
construct specialized transducing phages, which would facilitate the
study of vegetative M. xanthus functions. Moreover, like the
lytic phages of M. xanthus, the temperate phages have
adapted to respond to the unusual developmental cycle of their host.
The Mx8 prophage is stable upon the passage of an M. xanthus
lysogen through development (31). This is true despite the
fact that M. xanthus, like Bacillus subtilis,
uses a variety of different repressors, activators, and alternative
sigma factors of RNA polymerase to trigger the sequential expression of
different subsets of genes during successive stages of development. The
question of why and how the prophage remains refractory to these
dramatic changes in host gene expression during the developmental
process merits investigation. Because the Mx8 prophage is stable during
the developmental process, specialized transducing derivatives of Mx8
could be used to probe M. xanthus functions required for
development.
Although little is known about the establishment of lysogeny by Mx8,
previous work has shown that a 12-kb fragment of Mx8 DNA
(EcoRI-B) includes both a trans-acting integrase
gene (int) and a cis-acting attP
sequence, required for prophage integration into the host chromosome
(27, 43, 46). When a subfragment of EcoRI-B
fragment is cloned into a plasmid, the hybrid plasmid can recombine
efficiently with the bacterial attB locus and form a stable
cointegrate with the M. xanthus genome (25).
Even less is known about how the Mx8 prophage maintains lysogeny. We
presume that, like other temperate phages, Mx8 makes one or more
repressors that inhibit lytic development and confer superinfection
immunity. In this report, we show that a 9.5-kb region of the Mx8
genome includes the genes necessary for prophage integration and
superinfection immunity. The sequence of this region shows that the Mx8
genes involved in immunity and integration are densely packed and
transcribed in a single direction.
 |
MATERIALS AND METHODS |
Bacterial strains.
M. xanthus strains used in this
work are derived from strain DZ1, a nonmotile, multiple mutant of
strain DZF1 (10). CT liquid medium (14) was used
for the routine growth of DZ1; electroporants of DZ1 with integrated
plasmids were grown on CT medium with kanamycin sulfate (40 µg/ml).
Escherichia coli strains are derivatives of JM107
(47) and were grown in LB medium supplemented with
ampicillin (100 µg/ml) and/or kanamycin sulfate (40 µg/ml) (Sigma
Chemical Co.)
Bacteriophage strains and methods.
Phage strains used in
this work include the wild-type strains of Mx8, Mx81, and Mx82, which
were reisolated from M. xanthus DK883, DK879, and DK893,
respectively (28); these strains were the kind gifts of Dale
Kaiser. Supernatants of exponential cultures of each strain grown in CT
medium at 32°C were plated on a lawn of DZ1, by the soft (0.75%)
agar overlay method on CT (1.5%) agar plates (28). The
virulent mutant phage, Mx8 vir1, was isolated by selecting
for a mutant in a stock of wild-type Mx8 that can form plaques on a
lawn of the immune defective lysogen, DZ1(pAY50). Mx8 vir1
plates with nearly equal efficiencies on hosts DZ1, DZ1(pAY50), DZ1(Mx8), and all other immune hosts described in this report. Mx8
del1, which forms plaques and stable lysogens, has a
1,533-bp deletion of nonessential DNA in the immunity region.
Preparation of high-titer stocks of wild-type and mutant phages and
isolation of phage DNA have been described elsewhere (27).
Plasmid constructions.
When plasmids capable of autonomous
replication in E. coli and carrying a kanamycin resistance
(Kmr) determinant are introduced into M. xanthus, they confer a Kmr phenotype if and only if
they can integrate into the M. xanthus genome. If a plasmid
carries a region of homology with the M. xanthus genome,
then general recombination can promote plasmid integration.
Alternatively, if a plasmid carries the phage Mx8 integrase gene,
int, and attachment site, attP, the plasmid can integrate at a preferred site on the M. xanthus genome,
attB.
Plasmid pAY50 (27) carries an 8,069-bp
Sau3AI-PvuII insert of Mx8 DNA with the
phage-encoded site-specific recombination functions, uoi,
int, and attP, as well as the primary repressor gene, imm, required for superinfection immunity. Plasmid
pPLH343 has an overlapping 5,789-bp XhoI fragment of Mx8 DNA
with uoi, int, and attP ligated to a
DraI site of pBGS18 (17, 42). Plasmids pAY30,
pAY34, pAY36, pAY39, pAY42, pAY45, and pAY48 were made by ligating each
of seven EcoRI fragments of Mx8 (A, C, D, E, F, G, and H,
respectively) to the EcoRI site of pPLH343. Plasmid pAY20 is
the EcoRI B fragment of Mx8 ligated to the EcoRI
site of pBGS18. Plasmid pAY31 carries the EcoRI A fragment
ligated to the EcoRI site of pPLH343, in the opposite
orientation as for pAY30. Plasmids pAY55 and pAY56 were made from
plasmids pAY30 and pAY31, respectively, by cleavage with
NheI and XbaI and ligation of the fragment with
the plasmid origin of replication. Plasmids pAY60 and pAY62 carry the
3,484-bp MfeI-PvuII fragment of Mx8 ligated to
the SmaI site of pBGS18, in opposite orientations.
Plasmid pAY54 is a deletion derivative of pAY50 made by cleavage of
pAY50 with
EcoRI and
MfeI and ligation of the
largest
fragment. To assign the
imm gene to a single open
reading frame
(ORF), three additional deletion derivatives of pAY50
were made.
Plasmids pAY258 and pAY259 were constructed by ligating the
partial
cleavage products of pAY50 with
EcoO109I. Plasmid
pAY456 is the
ligation product of the larger fragment of pAY50
generated by
BlpI digestion.
A smaller, integration-proficient derivative of plasmid pAY62, pAY721,
was made by amplifying template pAY62 DNA with primer
5'AGCGGATAACAATTTCACACAGGA and primer
5'CCCAAGCTTCCTAGGTAGCGGAAGGGCTCTC,
complementary to the 3'
end of
int. The 2.2-kb PCR product was
cleaved with
EcoRI and
HindIII and then ligated to the
EcoRI and
HindIII sites of pBGS18. To
determine which codons initiate
int translation, we
introduced two mutations within the
int coding
sequence of
plasmid pAY721. Plasmid pAY979 is a derivative of
pAY721 with the
intVA1 mutation, a substitution of CG for TA at
bp 5086. Primer pairs 5'ACGGGATAACAATTTCACACAGGA and
5'CGCGACCGCGATGCCCAGCCGTCAGGAGT
and
5'CTGGGCATCGCGGTCGCGTCAAGAAGTCG and 5'ACGCGCCCCTCCATCCACTTG
were used to amplify template pAY721 DNA, and products were
annealed
and amplified with primers 5'ACGGGATAACAATTTCACACAGGA
and 5'ACGCGCCCCTCCATCCACTTG.
The second-step product
was cleaved with
EcoRI and
StuI and ligated
to
pLITMUS29 to make pAY978. Plasmid pAY978 was cleaved with
BsiEI
to confirm the presence of the
intVA1
mutation. Plasmids pAY978
and pAY721 were cleaved with
EcoRI
and
StuI, and the 835-bp fragment
of pAY978 was ligated to
the larger fragment of pAY721 to make
plasmid pAY979. A derivative of
plasmid pAY721 with the
intVA42
mutation, a substitution of
CG for TA at bp 5209, was made by
using primers
5'GCAGCGGCC ATCCTGGCGCGGAAGGCAGGGCGGCGCCGCGGGTAACGTCTATCG
CAAGAA
and 5'CCCAAGCTTCCTAGGTAGCGGAAGGGCTCTC to amplify template
Mx8 DNA. The
product was cleaved with
BglI to generate a 1,363-bp
fragment, which was ligated to a mixture of three of the four
BglI fragments of pAY721 to make pAY754. Cleavage with
SacII was
used to confirm the presence of VA42 mutation.
Plasmid pAY990,
with both TA-to-CG substitutions, was made by ligating
the largest
BglI fragment of pAY979 to three smaller
fragments of pAY754.
Plasmid pAY990 DNA was amplified with primers
5'ACGCGCCCCTCCATCCACTTG
and 5'AGCGGATAACAATTTCACACAGGA
to yield a 865-bp product; cleavage
of this product with
SacII and
BsiEI confirms that plasmid pAY990
carries both substitutions.
Methods for plasmid constructions and DNA manipulations were adapted
from those of Sambrook et al. (
36). For electroporation
of
E. coli and
M. xanthus, we used the methods of
Taketo (
45)
and Kashefi and Hartzell (
21),
respectively. To measure the
efficiency of electroporation of plasmids
into
M. xanthus DZ1,
100 to 300 ng of plasmid DNA (1 µl)
was added to 5 × 10
8 cells (40 µl), electroporated
cells were grown for 16 h, and
CFU were scored on CT plates with
kanamycin sulfate after 7 days.
DNA sequence analysis.
Plasmid templates used for sequence
analysis by the dideoxy method (38) included pPLH343, pAY39,
and smaller derivatives of pAY50 and pAY20. Sequencing runs were
performed by Commonwealth Biotechnologies, Inc., Richland, Va., and
resolved on an ABI Prism model 377 automated sequencing apparatus. The
identity of each base in the assembled sequence was determined at least
twice for each strand. Tojo et al. (46) also have sequenced
the SmaI subfragment including the region upstream of the
uoi gene. Their sequence of this region (GenBank no. D86464)
differs from ours; it is missing 89 bp (4394 to 4482). We have
determined that this deletion is not present on the wild-type Mx8
genome. Both Mx8 DNA and our subclones of this region have an
MluI site absent from D86464, and primers flanking the site
of the putative deletion amplify these 89 bp from both our plasmid and
phage templates (data not shown).
Nucleotide sequence accession number.
The sequence of the
9.5-kb fragment of Mx8 DNA has been assigned GenBank accession no.
U64984.
 |
RESULTS |
Phages Mx8 and Mx82 are independent isolates of the same temperate
phage.
Three related temperate phages, Mx8, Mx81, and Mx82, are
known to infect M. xanthus. To begin to characterize the
genes of each phage involved in superinfection immunity, we constructed lysogens of host strain DZ1 carrying each phage as prophage and measured the EOP of each phage on each of these lysogens. As shown in
Table 1, both Mx8 and Mx82 form plaques
with the same high efficiency on hosts DZ1 and DZ1(Mx81) but with the
same low efficiency on hosts DZ1(Mx8) and DZ1(Mx82). In contrast, phage
Mx81 plates with high efficiency on hosts DZ1, DZ1(Mx8), and DZ1(Mx82)
but with no measurable efficiency on DZ1(Mx81). These results show that
phages Mx8 and Mx82 are homoimmune, whereas Mx81 is heteroimmune.
Lysogens carrying either Mx8 or Mx82 as prophage form lawns that
typically have 50 to 5,000 plaques, formed by virulent phages
released
spontaneously from these lysogens. This result shows
that Mx8 acquires
single-step mutations that confer virulence.
After isolation and
purification on host DZ1, the phages which
form these spontaneous
autoplaques form plaques with the same
high EOP on both DZ1 and
DZ1(Mx8). In contrast, even high-titer
stocks of phage Mx81 do not
include virulent mutants that form
plaques on host DZ1(Mx81). Either
mutation to virulence requires
multiple mutational steps for Mx81, or
the Mx81 prophage makes
a superinfection exclusion function.
DNA extracted from Mx8 and Mx82 phage particles yields identical size
distributions of products when cleaved with endonucleases
EcoRI,
Acc65I,
AvaII,
MluI,
RsaI,
SacI,
SmaI,
SphI, and
StuI,
suggesting that Mx8 and Mx82 are different isolates of
the same
phage. This result is somewhat surprising, because the natural
lysogenic sources of these two phages,
M. xanthus DK883 and
DK893,
were isolated from geographically distant places with different
climates (Phoenix, Ariz., and Ames, Iowa, respectively
[
28])
and have different developmental phenotypes
(data not shown).
Cleavage of Mx81 DNA yields different sets of
products, consistent
with the result that Mx81 is heteroimmune.
The Mx8 immunity region maps to an 8.1-kb fragment of the Mx8
genome.
Previously, Stellwag et al. (43) showed that
the 12-kb EcoRI B fragment of Mx8 DNA carries int
and attP (Fig. 1). Several smaller segments of EcoRI-B also are sufficient to allow
site-specific recombination. These include a 5,789-bp XhoI
fragment internal to EcoRI-B (17, 25) and the
8.1-kb Sau3AI-PvuII insert of Mx8 DNA in plasmid
pAY50 (27). These subfragments include an ORF, designated
int, predicted to encode a product resembling other
phage-encoded integrases (reference 46; see also
Fig. 4).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
The primary determinant of Mx8 superinfection immunity,
imm, lies at the right end of EcoRI-A. The
physical map of phage Mx8 DNA shows restriction sites for
EcoRI (R), NheI (N), and Sau3AI (S);
not all XhoI (X) sites are shown. EcoRI fragments
are labeled A through H, in order of decreasing size. The regions of
Mx8 DNA subcloned into plasmids are shown as rectangles below the
physical map. Vector pPLH343 carries the 5.8-kb XhoI
subfragment of Mx8 DNA from EcoRI fragment B with the
int-attP region. Mx8 forms clear plaques on DZ1(pAY45); on
all other hosts, Mx8 forms turbid plaques. On hosts DZ1(pAY30),
DZ1(pAY31), DZ1(pAY55), DZ1(pAY50), and DZ1(pAY54), virulent mutants in
the wild-type stock of Mx8 form clear plaques. Derivatives of the
permissive M. xanthus strain DZ1 were grown to exponenial
density, and the EOP of Mx8 was measured on each derivative relative to
that on nonlysogenic DZ1. Combinations of inserts in plasmids that
confer superinfection immunity are shown as open rectangles (EOP < 10 4); inserts that do not are shown as filled
rectangles (EOP = 0.3 ± 0.1). The sequenced 9.5-kb immunity
region is shown as a shaded bar.
|
|
To map the Mx8-encoded function(s) necessary for superinfection
immunity, we constructed a series of plasmid subclones of
phage Mx8
DNA. Each of these plasmids is a derivative of Km
r plasmid
vector pBGS18 (
42) and carries a functional Mx8
int-attP region. One plasmid, pAY20, is a subclone of the
12-kb Mx8
EcoRI
B fragment. Each of the other plasmids has
one of the other
EcoRI
fragments of the Mx8 genome inserted
into plasmid pPLH343, which
carries the 5.8-kb
XhoI fragment
internal to
EcoRI-B. Each plasmid
was electroporated into
M. xanthus DZ1, and Km
r recombinants were
selected. These recombinants carry integrated,
defective Mx8 prophages
with each of the eight
EcoRI fragments
of Mx8 DNA,
representing the entire phage genome. The EOP of wild-type
Mx8 on each
of these hosts relative to that on the nonlysogenic
host DZ1 was
measured.
Mx8 plates with an EOP of 0.3 on host DZ1(pAY20), with the Mx8
EcoRI B fragment, indicating that this fragment of Mx8 does
not confer immunity (Fig.
1). Phages isolated from single plaques
formed by wild-type Mx8 on this host form plaques with the same
relative EOP when replated on DZ1 and DZ1(pAY20). Similar results
are
observed with hosts carrying both the
XhoI subfragment of
EcoRI-B as well as each of six of the seven other
EcoRI fragments
of Mx8. In contrast, a host with the
integrated
EcoRI A fragment,
DZ1(pAY30), is immune to
infection and plates wild-type phage
with an EOP of about
10
5. Plaques arising on this host are made by virulent
mutant phages;
these mutants plate with similar, high EOPs (0.3 ± 0.1) on both
DZ1 and DZ1(pAY30), as does Mx8
vir1, a
spontaneous virulent mutant
isolated on immune host DZ1(pAY50).
DZ1(pAY31), with the
EcoRI
A fragment cloned into
pPLH343 in the opposite orientation as
in pAY30, also is immune to
superinfection. These results show
that the primary determinant(s) of
Mx8 superinfection immunity
maps within its largest
EcoRI
fragment and/or the 5.8-kb
XhoI
subfragment of
EcoRI-B present in pPLH343.
We iterated this mapping strategy. Two deletion derivatives of plasmids
pAY30 and pAY31, pAY55 and pAY56, were constructed.
Each of these
carries one of the two
EcoRI-
NheI subfragments of
EcoRI-A. Because DZ1(pAY55) retains immunity to
superinfection,
the primary determinant(s) of immunity must reside in
the rightmost
three-quarters of
EcoRI-A and/or in the Mx8
DNA present in pPLH343.
A derivative of host DZ1 with a much smaller
integrated plasmid,
pAY50, also is immune (Fig.
2). Plasmid pAY50 has the 8.1-kb
PvuII-
Sau3A
fragment of Mx8 inserted in the
ScaI-
BamHI backbone of Km
r plasmid
pACYC177 (
12). pAY50 carries the leftmost 1.9 kb of
EcoRI-A, suggesting that at least one gene necessary for
immunity
maps within this 1.9-kb region. Consistent with this
hypothesis,
we find that plasmid pAY54, a deletion derivative of pAY50
that
retains this 1.9-kb region, also confers immunity when integrated
into the host DZ1 genome. Conversely, plasmids pPLH343, pAY20,
pAY60,
and pAY62, which are missing this 1.9-kb region, do not
confer
superinfection immunity.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Genetic organization of the Mx8 immunity region. The 19 potential genes in the sequenced immunity region are transcribed from
the conventional top strand, from left to right. The four subsets of
genes, imm-2-3-4, 8-9-10, 13-14, and
15-16-17-18, are arranged so that 2 bp of the stop and start
codons of adjacent genes within each cluster are shared. Below the gene
map are shown the endpoints of plasmid inserts used to define the
determinants of superinfection immunity and site-specific
recombination. Restriction sites: Sau3AI (S; bp 1),
EcoRI (R; bp 1897 and 2761), XhoI (X; bp 628, 658, 3687, and 9476), MfeI (M; bp 4585), and
PvuII (V; bp 8069). The pairs of EcoO109 sites
used to generate the deletions in pAY258 and pAY259 are at bp 504 and
2922 and at bp 504 and 3805, respectively. The deletion between
BlpI sites in pAY456 extends from bp 278 to 4238. Bars are
as described in the legend for Fig. 1.
|
|
Three additional deletion derivatives of pAY50 were constructed to
assign the
imm function to the first of the four ORFs within
the 1.9-kb region. Derivatives of host DZ1 with integrated plasmids
pAY258 and pAY259, which retain only the first of these four ORFs,
are
immune to superinfection. In contrast, strain DZ1(pAY456),
with a
deletion extending into the 3' end of
imm, is sensitive.
The Mx8 immunity region is densely packed with potential
genes.
The sequence of the 9.5-kb region of Mx8 DNA represented by
the inserts in plasmids pAY50 and pPLH343 was determined. Like the
genome of its host, M. xanthus, this portion of the Mx8
genome is unusually rich in GC base pairs (6,375/9,481 bp = 67.2%
G+C). Organisms that have GC-rich genomes accommodate this extreme of base composition in two different ways. First, codons within protein coding sequences include the base G or C in their third, most degenerate positions with high frequencies. For example, M. xanthus and Streptomyces spp. genes typically have G or
C in >90% of third codon positions. Second, codons within coding
sequences are also enriched for G or C in their first two positions
(3). As a result, the primary sequences of both M. xanthus and Mx8 proteins include an overabundance of the four
amino acids (Gly, Ala, Pro, and Arg) with codons having G and C bases
in their first two positions (GGS, GCS, CCS, and CGS, respectively,
where S = G or C).
As shown in Table
2 and Fig.
2, the
sequence of the Mx8 immunity region includes many potential ORFs with G
or C in the third
positions of >75% of codons. Among these ORFs, 19 correspond to
potential transcripts made from the top strand as
template. The
predicted products of three of the ORFs from the top
strand share
striking similarities with other known proteins. These
ORFs, designated
mox,
uoi, and
int,
encode a nonessential DNA adenine methylase
of unknown physiological
function (
27), a potential Mx8 excisionase,
and Mx8
integrase, respectively (
46).
ATG or GTG start codons for all but four of the potential ORFs in the
top strand are preceded 4 to 6 bp by ribosome-binding
sites that share
at least four bases of homology with the 3' end
of the 16S rRNA of
M. xanthus (
41). Genes
imm,
mox, and
18 have
exceptional ribosome-binding
sites, with eight, six, and six bases
of uninterrupted homology,
respectively. Most identified
M. xanthus genes have less
striking ribosome-binding sites.
Four subsets of ORFs in the top strand are arranged in the same way as
the
nin genes of phage

(
23,
37). Within each
subset, the coding sequences of adjacent ORFs overlap; the first
2 bp
of the TGA stop codon of one ORF are the last 2 bp of the
start codon
(ATG or GTG) of its successor. These overlapping arrays
include genes
1(
imm)-2-3-4 (upstream of
mox),
8-9-10 (between
mox and
int),
13-14 (downstream of
int), and
15-16-17-18 (Fig.
2). Each gene at the start of the three
arrays has a notable ribosome-binding
site with five bases of homology
to the 3' end of the 16S rRNA
of
M. xanthus.
The predicted product of the Mx8 imm gene is highly
basic.
The majority of predicted products of the genes in the Mx8
immunity region have only weak similarities with the sequences of
proteins of known function; among these is the product of the imm gene. Because the primary immunity function for most
temperate phages is a repressor gene that encodes a specific
DNA-binding protein, we used the BLAST program (1) to search
for related DNA-binding proteins. As shown in Fig.
3, Imm is most similar to
Arabidopsis thaliana G-box-binding factor 1 (GBF1)
(40). The most striking similarities are in two regions, a
central domain, corresponding to the DNA-binding basic motif of GBF1,
and the C terminus. For GBF1, these regions are separated by an
extensive leucine zipper. The C terminus of Imm is also similar to the
C terminus of several eukaryotic histones H1 (reference
22 and data not shown).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 3.
Imm is most similar to A. thaliana GBF1.
Alignment of the C termini of the predicted Imm and GBF1 sequences
resulting from a BLAST search using the PAM250 weight matrix for
similarity is shown. Identical residues are in boldface; similar
residues are indicated by asterisks. The basic motif, essential for the
DNA-binding activity of GBF1, is underlined. Periodically repeated
leucine and isoleucine residues in the zipper motif of GBF1 are
indicated by arrows. The two proteins also show limited similarity in
their proline-rich N termini (not shown).
|
|
Immediately distal to the
imm array is the
mox
gene. None of the five genes (6 to 10) between
mox and
uoi-int is essential
for either the lytic or lysogenic
development of Mx8. A deletion
mutant missing these genes, Mx8
del1, forms plaques and stable
lysogens with host DZ1
(
27).
The Mx8 int gene has two alternate translation start
codons.
The longest ORF within the 8.1-kb Mx8 fragment,
int, encodes Mx8 integrase. The int gene has
several potential translation initiation codons. The first of these,
GTG-5085, initiates a predicted product with an N-terminal sequence
similar to that of temperate Staphylococcus aureus phage
42 integrase (Fig. 4 and reference 11). Both the first and second (GTG-5208) potential
starts lie within the uoi coding sequence (bp 4991 to 5215).
To determine which of these two GTG start codons is used, we made
site-directed changes of each GTG codon to GCG and tested whether these
mutations abolish integrase function.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Mx8 integrase has four domains of similarity with other
integrases. Regions of the predicted product of the Mx8 int
gene that are similar to other phage and plasmid integrases are shown.
Identical amino acids are indicated in boldface and underlined; similar
residues are underlined. Numbers refer to the positions of residues
within each Int protein from phages 42 (11), D29/FRAT1
(44, 16), 11 (48), and (19) and
plasmid pSE211 (6). These include an N-terminal basic motif
(A), a central domain (B), and two C-terminal domains (C and D) that
are conserved among the family of lambdoid integrases and aligned as
described elsewhere (2). A tyrosine residue within domain D
(arrow) is strictly conserved among the lambdoid integrases; it is the
active-site residue that forms an ester linkage with substrate DNAs
(33).
|
|
Results in Table
3 show that plasmid
pAY721, which carries a 2.2-kb fragment of Mx8 DNA with the wild-type
uoi and
int genes,
gives rise to Km
r
recombinants after electroporation of sensitive host DZ1 with
a high
efficiency. Otherwise isogenic plasmids pAY979 and pAY754,
with changes
of GTG-5085 and GTG-5208 codons to GCG, respectively,
also give rise to
Km
r electroporants. In contrast, plasmid pAY990, with
changes of
both GTG codons to GCG, does not give rise to
Km
r electroporants. These results show that at least one of
these
first two GTG codons is necessary, and either one of these first
two GTG codons is sufficient, to initiate the translation of a
functional
int gene product.
As shown in Fig.
4, Mx8 Int protein can be divided into four domains,
each with similarity to other proteins. The first (domain
A) is its
highly basic N terminus. Between this N terminus and
two conserved
domains C and D that Mx8 Int shares with other integrases
(
2) is domain B, which includes stretches similar to
Staphylococcus phage

42 (
11),
Mycobacterium phage FRAT1/D29 (
16,
44),
and
Streptomyces plasmid pSE211 (
6) integrases.
The Mx8 uoi gene encodes a helix-turn-helix (HTH)
protein.
Overlapping the beginning of int is the
second-longest potential ORF in the Mx8 immunity region,
uoi. This ORF has 12 potential start codons, only 2 of which
are preceded by recognizable ribosome-binding sites. One, a GTG codon
at bp 4490, would initiate a product of 241 amino acids, encoded by a
gene with relatively poor codon usage (66% G+C in the third position),
whereas the other, a GTG codon at bp 4991, would initiate a product of
74 amino acids with more typical codon usage (75.3% G+C in the third
position). The N terminus of the latter product, Uoi, shares
significant sequence similarity with P22 Xis protein (26)
and Methylobacterium DcmR repressor (24). Uoi has
two additional domains, (i) a central domain that also shares
similarity with DcmR repressor and (ii) a basic C terminus (Fig.
5).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Excisionases are likely HTH proteins. Alignment of the
potential Mx8 excisionase, Uoi, with other phage, plasmid, and
transposon excisionases is shown. The alignment of P22 Xis with Uoi was
found by using the BLAST program (1); additional alignments
were made by using iterations of the BLAST program with published Xis
sequences. Residues identical to those of Uoi are in boldface; similar
residues are underlined. The N terminus of Mx8 Uoi (domain A) scores
extremely well as an HTH protein, as does its closest relative,
Methylobacterium DcmR repressor (24), using the
weight matrix of Dodd and Egan (13). The SD (standard
deviation) scores for these proteins, as well as for P22
(26), pSE101 (5), pSE211 (6), pSAM2
(4), and Tn1545 (34) excisionases, are
given; a score of 2.5 or better signifies that a protein has an HTH
motif with near certainty (13). After the HTH motif in Mx8
Uoi is a second region of similarity with DcmR (domain B). Uoi
terminates with a basic motif. We note that only one other phage
excisionase, Xis (19), has a highly basic C terminus;
this region of Xis is thought to be involved in specific
interactions with Int (30).
|
|
Uoi begins with an HTH sequence motif that scores dramatically well by
the metric of Dodd and Egan (
13) for recognizing
these
motifs. As shown in Fig.
5, alignment of the N terminus
of Uoi with P22
Xis and integrative plasmid and transposon excisionases
from
Streptomyces spp. allows us to identify several highly
conserved
residues which span the HTH motif of Uoi. These residues are
conserved,
not only among this family of proteins, but also among many
HTH
proteins. This comparison suggests that temperate phage
excisionases
use variations of the HTH motif to bind DNA.
 |
DISCUSSION |
A 9.5-kb region of the 49-kb Mx8 genome with a base composition of
67.2% GC is densely packed with 19 potential ORFs. These genes are
transcribed in one direction from the conventional top strand of the
sequence and, with the exception of uoi and int, do not overlap extensively. More than half (13 of 19) of these potential genes are arranged in overlapping arrays, such that the first
2 bp of the termination codon of one gene are the last 2 bp of the
start codon of its successor within each array.
With one exception, when genes are not arranged in overlapping arrays,
they are separated from one another by short intervals, which tend to
be AT rich and may contain promoters. The exception is the large
(707-bp) gap between the second array (8-9-10) and uoi, which includes no long ORFs on either strand. Although
uoi has no fewer than 12 potential start codons, only start
codons after GTG-4829 define ORFs with >75% G or C in the third codon position. Only one of these, GTG-4991, has a good ribosome-binding site.
The Mx8 uoi and int genes overlap extensively.
Although Tojo et al. (46) have assigned the GTG codon at bp
5208 as the start codon for int, we find that the
int gene has two potential starts, either one of which gives
rise to a functional product. Furthermore, we find the similarity
between the sequences of the predicted product of uoi and
other phage excisionases particularly instructive. A subset of this
family of proteins may use an N-terminal HTH motif to bind specific DNA
sites.
We have chosen genes in the Mx8 immunity region as those with codons
having >75% G+C in the third codon position. Initially, we thought
that this measure would be conservative, because M. xanthus
genes typically have >90% G or C in this position. Surprisingly, only
2 of 19 Mx8 genes, 14 and 18, meet this stringent
requirement. Because genomes with high GC base compositions are
enriched for G+C in all three codon positions (3), the Mx8
genome accommodates this slack in the third position by enrichment for
G+C in the first two codon positions, resulting in enrichment for the
amino acids Gly, Pro, Ala, and Arg in the primary sequences of
potential Mx8 proteins.
Sequences of the predicted products of most genes in the Mx8 immunity
region, with the exceptions of mox, uoi, and
int, have little similarity with those of other known
proteins. One notable exception is the product of gene 14,
which has a conserved domain shared by gram-positive
endo-
-1,4-glucanases (20, 39). Quillet et al.
(35) have shown that the M. xanthus celA gene
encodes an endo-
-1,4-glucanase closely related to the licheninases
from Actinomyces spp., suggesting that the coding sequences
for these enzymes have been transferred horizontally from actinomycetes to myxobacteria. Phages such as Mx8 are possible vehicles for this
transfer. Like many phages, the host range of Mx8 extends across
different species of Myxococcus, including M. virescens and M. fulvus in addition to M. xanthus (data not shown), and may extend to different genera with
genomes having a range of base compositions.
Prokaryotic viruses are among the most deeply rooted organisms in
evolutionary history. At least one archaeal virus, SSV1, makes an
integrase closely related to phage integrases (29, 32).
Whether this and other similarities argue that viruses existed prior to
the archaea-eubacteria split, or that viruses mediate extensive lateral
transfer between domains, remains open to debate. Independent of these
evolutionary questions, we may ask whether phages represent the finite
permutations of a relatively limited repertoire of genes. If so, then
the study of phages of diverse prokaryotes may hold few new surprises.
Are the phages simply variations on a small number of baroque genetic
themes, or do they offer new, classical paradigms for our understanding of genes and their regulation?
The lesson that we have learned from studying the genomes of diverse
phages is that the repertoire of their genes is far from limited. Thus,
the sequence of mycophage L5 yields only about a dozen of 88 genes with
functions resembling lambdoid or other phage homologues
(18). The sequence of one-fifth of the myxophage Mx8 genome
tells much the same story. Few Mx8 gene products are similar to
other phage proteins or, for that matter, other known proteins.
Clearly, if phages have only finite permutations of a limited number of
genes, then only a small subset of phages have been characterized, and
many surprises are yet to come from the study of phage genetics.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Molecular Biology and Biochemistry, University of Idaho, Moscow, ID 83844-3052. Phone: (208) 885-0571. Fax: (208) 885-6518. E-mail: pay{at}uidaho.edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Argos, P.,
A. Landy,
K. Abremski,
J. B. Egan,
E. Haggard-Ljungquist,
R. H. Hoess,
M. L. Kahn,
B. Kalionis,
S. V. Narayana,
L. S. Pierson III,
N. Sternberg, and J. M. Leong.
1986.
The integrase family of site-specific recombinases: regional similarities and global diversity.
EMBO J.
5:433-440[Medline].
|
| 3.
|
Bibb, M. J.,
P. R. Findlay, and M. W. Johnson.
1984.
The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences.
Gene
30:157-166[Medline].
|
| 4.
|
Boccard, F.,
T. Smokvina,
J. L. Pernodet,
A. Friedmann, and M. Guerineau.
1989.
The integrated conjugative plasmid pSAM2 of Streptomyces ambofaciens is related to temperate bacteriophages.
EMBO J.
8:973-980[Medline].
|
| 5.
|
Brown, D. P.,
K. B. Idler,
D. M. Backer,
S. Donadio, and L. Katz.
1994.
Characterization of the genes and attachment sites for site-specific integration of plasmid pSE101 in Saccharopolyspora erythraea and Streptomyces lividans.
Mol. Gen. Genet.
242:185-193[Medline].
|
| 6.
|
Brown, D. P.,
K. B. Idler, and L. Katz.
1990.
Characterization of the genetic elements required for site-specific integration of plasmid pSE211 in Saccharopolyspora erythraea.
J. Bacteriol.
172:1877-1888[Abstract/Free Full Text].
|
| 7.
|
Brown, N. L.,
D. W. Morris, and J. H. Parrish.
1976.
DNA of Myxococcus bacteriophage Mx1: macromolecular properties and restriction fragments.
Arch. Microbiol.
108:221-226[Medline].
|
| 8.
|
Burchard, R. P., and M. Dworkin.
1966.
A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis.
J. Bacteriol.
91:1305-1313[Abstract/Free Full Text].
|
| 9.
|
Burchard, R. P., and H. Voelz.
1972.
Bacteriophage infection of Myxococcus xanthus during cellular differentiation and vegetative growth.
Virology
48:555-566[Medline].
|
| 10.
|
Campos, J. M.,
J. Geisselsoder, and D. R. Zusman.
1978.
Isolation of bacteriophage Mx4, a generalized transducing phage of Myxococcus xanthus.
J. Mol. Biol.
119:167-178[Medline].
|
| 11.
|
Carroll, D.,
M. A. Kehoe,
D. Cavanagh, and D. C. Coleman.
1995.
Novel organization of the site-specific integration and excision recombination functions of the Staphylococcus aureus serotype F virulence-converting phages phi 13 and phi 42.
Mol. Microbiol.
16:877-893[Medline].
|
| 12.
|
Chang, A. C. Y., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156[Abstract/Free Full Text].
|
| 13.
|
Dodd, I. B., and J. B. Egan.
1990.
Improved detection of helix-turn-helix DNA-binding motifs in protein sequences.
Nucleic Acids Res.
18:5019-5026[Abstract/Free Full Text].
|
| 14.
|
Dworkin, M.
1962.
Nutritional requirements for vegetative growth of Myxococcus xanthus.
J. Bacteriol.
84:250-257[Abstract/Free Full Text].
|
| 15.
|
Geisselsoder, J.,
J. M. Campos, and D. R. Zusman.
1978.
Physical characterization of bacteriophage MX4, a generalized transducing phage for Myxococcus xanthus.
J. Mol. Biol.
119:179-189[Medline].
|
| 16.
|
Haeseleer, F.,
J. F. Pollet,
A. Bollen, and P. Jacobs.
1992.
Molecular cloning and sequencing of the attachment site and integrase gene of the temperate mycobacteriophage FRAT1.
Nucleic Acids Res.
20:1420[Free Full Text].
|
| 17.
|
Hartzell, P., and D. Kaiser.
1991.
Upstream gene of the mgl operon controls the level of MglA protein in Myxococcus xanthus.
J. Bacteriol.
173:7625-7635[Abstract/Free Full Text].
|
| 18.
|
Hatfull, G. F., and G. J. Sarkis.
1993.
DNA sequence, structure and gene expression of mycobacteriophage L5: a phage system for mycobacterial genetics.
Mol. Microbiol.
7:395-405[Medline].
|
| 19.
|
Hoess, R. H.,
C. Foeller,
K. Bidwell, and A. Landy.
1980.
Site-specific recombination functions of bacteriophage lambda: DNA sequence of regulatory regions and overlapping structural genes for Int and Xis.
Proc. Natl. Acad. Sci. USA
77:2482-2486[Abstract/Free Full Text].
|
| 20.
|
Hofemeister, J.,
A. Kurtz,
R. Borriss, and J. Knowles.
1986.
The beta-glucanase gene from Bacillus amyloliquefaciens shows extensive homology with that of Bacillus subtilis.
Gene
49:177-187[Medline].
|
| 21.
|
Kashefi, K., and P. L. Hartzell.
1995.
Genetic suppression and phenotypic masking of Myxococcus xanthus frzF defect.
Mol. Microbiol.
15:483-494[Medline].
|
| 22.
|
Knowles, J. A., and G. J. Childs.
1986.
Comparison of the late H1 histone genes of the sea urchins Lytechinus pictus and Strongelocentrotus purpuratus.
Nucleic Acids Res.
14:8121-8133[Abstract/Free Full Text].
|
| 23.
|
Kroger, M., and G. Hobom.
1982.
A chain of interlinked genes in the ninR region of bacteriophage lambda.
Gene
20:25-38[Medline].
|
| 24.
|
La Roche, S. D., and T. Leisinger.
1990.
Sequence analysis and expression of the bacterial dichloromethane dehalogenase structural gene, a member of the glutathione S-transferase supergene family.
J. Bacteriol.
172:164-171[Abstract/Free Full Text].
|
| 25.
|
Li, S. F., and L. J. Shimkets.
1988.
Site-specific integration and expression of a developmental promoter in Myxococcus xanthus.
J. Bacteriol.
170:5552-5556[Abstract/Free Full Text].
|
| 26.
|
Leong, J. M.,
S. E. Nunes-Duby,
A. B. Oser,
C. F. Lesser,
P. Youderian,
M. M. Susskind, and A. Landy.
1986.
Structural and regulatory divergence among site-specific recombination genes of lambdoid phage.
J. Mol. Biol.
189:603-616[Medline].
|
| 27.
|
Magrini, V.,
D. Salmi,
D. Thomas,
S. K. Herbert,
P. L. Hartzell, and P. Youderian.
1997.
Temperate Myxococcus xanthus phage Mx8 encodes a DNA adenine methylase, Mox.
J. Bacteriol.
179:4254-4263[Abstract/Free Full Text].
|
| 28.
|
Martin, S.,
E. Sodergren,
T. Masuda, and D. Kaiser.
1978.
Systematic isolation of transducing phages of Myxococcus xanthus.
Virology
88:44-53[Medline].
|
| 29.
|
Muskhelishvili, G.,
P. Palm, and W. Zillig.
1993.
SSV1-encoded site-specific recombination system in Sulfolobus shibatae.
Mol. Gen. Genet.
237:334-342[Medline].
|
| 30.
|
Numrych, T. E.,
R. I. Gumport, and J. F. Gardner.
1992.
Characterization of the bacteriophage lambda excisionase (Xis) protein: the C-terminus is required for Xis-integrase cooperativity but not for DNA binding.
EMBO J.
11:3797-3806[Medline].
|
| 31.
|
Orndorff, P.,
E. Stellwag,
T. Starich,
M. Dworkin, and J. Zissler.
1983.
Genetic and physical characterization of lysogeny by bacteriophage Mx8 in Myxococcus xanthus.
J. Bacteriol.
154:772-779[Abstract/Free Full Text].
|
| 32.
|
Palm, P.,
C. Schleper,
B. Grampp,
S. Yeats,
P. McWilliam,
W. D. Reiter, and W. Zillig.
1991.
Complete nucleotide sequence of the virus SSV1 of the archaebacterium Sulfolobus shibatae.
Virology
185:242-250[Medline].
|
| 33.
|
Pargellis, C. A.,
S. E. Nunes-Duby,
L. M. de Vargas, and A. Landy.
1988.
Suicide recombination substrates yield covalent lambda integrase-DNA complexes and lead to identification of the active site tyrosine.
J. Biol. Chem.
263:7678-7685[Abstract/Free Full Text].
|
| 34.
|
Poyart-Salmeron, C.,
P. Trieu-Cuot,
C. Carlier, and P. Courvalin.
1989.
Molecular characterization of two proteins involved in the excision of the conjugative transposon Tn1545: homologies with other site-specific recombinases.
EMBO J.
8:2425-2433[Medline].
|
| 35.
|
Quillet, L.,
S. Barray,
B. Labedan,
F. Petit, and J. Guespin-Michel.
1995.
The gene encoding the beta-1,4-endoglucanase (CelA) from Myxococcus xanthus: evidence for independent acquisition by horizontal transfer of binding and catalytic domains from actinomycetes.
Gene
158:23-29[Medline].
|
| 36.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatas.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Sanger, F.,
A. R. Coulson,
G. F. Hong,
D. F. Hill, and G. B. Petersen.
1982.
Nucleotide sequence of bacteriophage lambda DNA.
J. Mol. Biol.
162:729-773[Medline].
|
| 38.
|
Sanger, F. S.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 39.
|
Schimming, S.,
W. H. Schwarz, and W. L. Staudenbauer.
1992.
Structure of the Clostridium thermocellum gene licB and the encoded beta-1,3-1,4-glucanase. A catalytic region homologous to Bacillus lichenases joined to the reiterated domain of clostridial cellulases.
Eur. J. Biochem.
204:13-19[Medline].
|
| 40.
|
Schindler, U.,
A. E. Menkens,
H. Beckmann,
J. R. Ecker, and A. R. Cashmore.
1992.
Heterodimerization between light-regulated and ubiquitously expressed Arabidopsis GBF bZIP proteins.
EMBO J.
11:1261-1273[Medline].
|
| 41.
|
Shimkets, L. J., and C. R. Woese.
1992.
A phylogenetic analysis of the myxobacteria: basis for their classification.
Proc. Natl. Acad. Sci. USA
89:9459-9463[Abstract/Free Full Text].
|
| 42.
|
Spratt, B. G.,
P. J. Hedge,
S. te Heesen,
A. Edelman, and J. K. Broome-Smith.
1986.
Kanamycin-resistant vectors that are analogues of plasmids pUC8, pUC9, pEMBL8, and pEMBL9.
Gene
41:337-342[Medline].
|
| 43.
|
Stellwag, E.,
J. M. Fink, and J. Zissler.
1985.
Physical characterization of the genome of the Myxococcus xanthus bacteriophage Mx8.
Mol. Gen. Genet.
199:123-132[Medline].
|
| 44.
| Suissa, M., J. Wyse, T. Bar-On, and J. Kuhn. 1994. DNA sequence and analysis of the mycobacteriophage D29 origin and its
integrase-like protein. GenBank no. X70352.
|
| 45.
|
Taketo, A.
1988.
DNA transfection of Escherichia coli by electroporation.
Biochim. Biophys. Acta
949:318-324[Medline].
|
| 46.
|
Tojo, N.,
K. Sanmiya,
H. Sugawara,
S. Inouye, and T. Komano.
1996.
Integration of bacteriophage Mx8 into the Myxococcus xanthus chromosome causes a structural alteration at the C-terminal region of the IntP protein.
J. Bacteriol.
178:4004-4011[Abstract/Free Full Text].
|
| 47.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
| 48.
|
Ye, Z.-H.,
S. L. Buranen, and C. Y. Lee.
1990.
Sequence analysis and comparison of int and xis genes from Staphylococcal bacteriophages L54a and phi-11.
J. Bacteriol.
172:2568-2575[Abstract/Free Full Text].
|
J Bacteriol, February 1998, p. 614-621, Vol. 180, No. 3
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Muller, S., Shen, H., Hofmann, D., Schairer, H. U., Kirby, J. R.
(2006). Integration into the Phage Attachment Site, attB, Impairs Multicellular Differentiation in Stigmatella aurantiaca.. J. Bacteriol.
188: 1701-1709
[Abstract]
[Full Text]
-
Tojo, N., Komano, T.
(2003). The IntP C-Terminal Segment Is Not Required for Excision of Bacteriophage Mx8 from the Myxococcus xanthus Chromosome. J. Bacteriol.
185: 2187-2193
[Abstract]
[Full Text]
-
Lewis, J. A., Hatfull, G. F.
(2001). Control of directionality in integrase-mediated recombination: examination of recombination directionality factors (RDFs) including Xis and Cox proteins. Nucleic Acids Res
29: 2205-2216
[Abstract]
[Full Text]
-
Sherburne, C. K., Lawley, T. D., Gilmour, M. W., Blattner, F. R., Burland, V., Grotbeck, E., Rose, D. J., Taylor, D. E.
(2000). The complete DNA sequence and analysis of R27, a large IncHI plasmid from Salmonella typhi that is temperature sensitive for transfer. Nucleic Acids Res
28: 2177-2186
[Abstract]
[Full Text]
-
Magrini, V., Creighton, C., Youderian, P.
(1999). Site-Specific Recombination of Temperate Myxococcus xanthus Phage Mx8: Genetic Elements Required for Integration. J. Bacteriol.
181: 4050-4061
[Abstract]
[Full Text]
-
Magrini, V., Storms, M. L., Youderian, P.
(1999). Site-Specific Recombination of Temperate Myxococcus xanthus Phage Mx8: Regulation of Integrase Activity by Reversible, Covalent Modification. J. Bacteriol.
181: 4062-4070
[Abstract]
[Full Text]
-
Youderian, P., Lawes, M. C., Creighton, C., Cook, J. C., Saier, M. H. Jr.
(1999). Mutations That Confer Resistance to 2-Deoxyglucose Reduce the Specific Activity of Hexokinase from Myxococcus xanthus. J. Bacteriol.
181: 2225-2235
[Abstract]
[Full Text]
-
Magrini, V., Creighton, C., White, D., Hartzell, P. L., Youderian, P.
(1998). The aadA Gene of Plasmid R100 Confers Resistance to Spectinomycin and Streptomycin in Myxococcus xanthus. J. Bacteriol.
180: 6757-6760
[Abstract]
[Full Text]
-
Weimer, R. M., Creighton, C., Stassinopoulos, A., Youderian, P., Hartzell, P. L.
(1998). A Chaperone in the HSP70 Family Controls Production of Extracellular Fibrils in Myxococcus xanthus. J. Bacteriol.
180: 5357-5368
[Abstract]
[Full Text]