Previous Article | Next Article 
J Bacteriol, February 1998, p. 753-758, Vol. 180, No. 3
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Analysis of Bacillus subtilis tagAB and
tagDEF Expression during Phosphate Starvation Identifies a
Repressor Role for PhoP~P
Wei
Liu,
Stephen
Eder, and
F. Marion
Hulett*
Laboratory for Molecular Biology, University
of Illinois at Chicago, Chicago, Illinois 60607
Received 18 August 1997/Accepted 4 December 1997
 |
ABSTRACT |
The tagAB and tagDEF operons, which are
adjacent and divergently transcribed, encode genes responsible for cell
wall teichoic acid synthesis in Bacillus subtilis. The
Bacillus data presented here suggest that PhoP and PhoR are
required for direct repression of transcription of the two operons
under phosphate starvation conditions but have no regulatory role
under phosphate-replete conditions. These data identify for the first
time that PhoP~P has a negative role in Pho regulon gene regulation.
| |
TEXT |
Teichoic acid, an essential anionic
polymer containing polyglycerol or polyribitol phosphate, is the
major cell wall component of Bacillus subtilis grown in
phosphate-replete media (2, 17). Approximately 15% of
cellular phosphorus is stored in the form of teichoic acid under these
conditions (1). During phosphate starvation, however, the
cell ceases to produce teichoic acid and replaces it with an anionic
phosphate-free polymer, teichuronic acid (5, 13). As a
result, the cell saves phosphorus for cellular metabolism and DNA
synthesis. When phosphate becomes available again, the cell will
restore synthesis of teichoic acid and stop production of teichuronic
acid (reference 5; for reviews, see references
1 and 29).
The genes responsible for synthesis of teichoic acid and teichuronic
acid have been cloned and analyzed (16, 27, 28). The genes
which are involved in teichuronic acid synthesis, the tuaABCDEFGH operon, are repressed when phosphate is in
excess and turned on under phosphate starvation conditions (14a,
28). Expression of this operon under phosphate-limiting
conditions is directly activated by PhoP and PhoR, a pair of bacterial
two-component regulatory proteins (24, 25). PhoP, the
response regulator, binds to the tuaA promoter at B. subtilis Pho boxes, as it does to other Pho regulon promoters
which are induced during phosphate starvation (14a).
Divergently transcribed operons tagAB and tagDEF encode products which are directly involved in teichoic acid synthesis. The gene products of tagAB are poorly characterized,
although assumptions about their functions have been made based on the similarity of the sequences of their products to those of other proteins (15, 16). The tagDEF operon, on the
other hand, encodes CDP-glycerol pyrophosphorylase (20),
polyglycerolphosphate glucosyltransferase (22), and
polyglycerolphosphate glycerol phosphate transferase (21).
Expression of the tagA and tagD operons is
reduced when the cell is grown in low-phosphate medium (18).
It has recently been suggested that not all proteins whose synthesis is
regulated in response to changing phosphate levels are members of the
Pho regulon (6, 19). To understand if the tagA
and tagD operons are repressed by PhoP and PhoR, we studied expression of the divergently transcribed operons in a phoP
mutant and a phoR mutant. We also used gel shift and DNase I
footprinting assays to determine if PhoP directly regulates expression
of these genes. We conclude that PhoP~P directly binds to and
is essential for transcriptional repression of the tagAB and
tagDEF operons but activates the tuaABCDEFGH
operon (14a) and therefore regulates the switch of the
two anionic polymers during phosphate starvation.
Cloning of the promoter region shared by tagAB and
tagDEF operons.
The divergently transcribed
operons tagAB and tagDEF from B. subtilis 168 have been cloned and sequenced (16). The
transcriptional start sites from tagA and tagD
have been identified by primer extension analysis (15). Two
primers, FMH304
(5'-354CCCCAATGCAGTAAATCAA372-3')
and FMH305
(5'-GGATCC845AGTTACTGTTAACATAAGGAA824-3'),
which are located within the tagA and tagD
genes, were used to amplify the promoter region shared by the two
operons with B. subtilis JH642 (a derivative of B. subtilis 168) chromosomal DNA as the template (Fig.
1). The supercript numbers in the primers are the nucleotide numbers assigned by Mauël et al.
(16). The 493-bp promoter fragment was cloned into pCR2.1
(Invitrogen) to construct pSE90. The cloned promoter fragment contains
nucleotides (nt) 
371 to +121 for tagA and nt 325 to +167
for tagD, relative to the transcriptional start site for
each gene. The sequence of the insert was confirmed by DNA sequencing,
and it is the same as that for B. subtilis 168. Figure 1
shows the sequence of the insert in pSE90 containing the common
promoter region of the tagAB and tagDEF operons.
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence of the promoter region shared by
tagAB and tagDEF operons. The 493-bp fragment
containing promoters for both tagAB and tagDEF
operons were cloned into pCR2.1. The junction of pCR2.1 and the
promoter fragment is shown with the relevant restriction sites
indicated above the sequence. The primers FMH304 and FMH305 within the
coding region of tagD and tagA, respectively, are
also indicated by arrows. The 10 regions, ribosomal binding sites,
transcriptional start sites for  A, and translational
start sites for both tagA and tagD are labeled
and underlined (14). Thin lines above or below the
sequences, binding sites for PhoP~P only; thick lines above or below
the sequences, binding sites for both PhoP and PhoP~P; arrowheads,
hypersensitive sites. To number the nucleotides, the top strand (the
coding strand for tagA) and the bottom strand (the coding
strand for the tagD) are numbered separately, with
transcriptional start sites of each gene indicated by +1. To facilitate
the location of the protection area by PhoP (Fig. 4), the fragments A
to D and the MunI restriction site are indicated by bent
arrows and labeled. The four repeated TTAACA-like sequences
located on the tagA noncoding strand upstream of 10 are
also doubly underlined.
|
|
Expression of tagAB and tagDEF is repressed
by PhoP and PhoR during phosphate starvation.
Mauël et al.
(18) used a 399-bp intergenic region between tagA
and tagD to make lacZ fusions of the two gene
promoters and found that expression of B. subtilis 168 tagA and tagD is decreased in phosphate-limited
culture. To examine if the lowered expression of the two promoters is
dependent on the phoP and phoR genes, both
tagA and tagD promoter-lacZ fusions
were introduced into a phoP nonpolar deletion mutant (MH5600
[11]), a phoR deletion mutant (MH5124
[11]), and the parent strain (JH642) as follows. The promoter region shared by tagA and tagD was
subcloned from pSE90 into pDH32 (26) in two different
orientations to make tagA-lacZ (pSE91) and
tagD-lacZ (pSE92) fusions. Single-copy
promoter-lacZ fusion strains were obtained by integrating
the promoter-lacZ fusions into the amy locus of
each strain. The resultant strains containing the tagA-lacZ
fusion in the parent, phoP, or phoR background were named MH5630, MH5634, and MH5632, respectively. The strains containing tagD-lacZ fusion in the parent, phoP,
or phoR background were named MH5631, MH5635, and
MH5633, respectively.
All six strains described above were grown in both high-phosphate
defined medium (HPDM) containing 5 mM phosphate (
23) and
low-phosphate defined medium (LPDM) containing 0.42 mM phosphate
(
10). The promoter activities were detected under these
conditions
as described previously (
10), and alkaline
phosphatase (APase)
activity was measured as a reporter for Pho regulon
gene expression
(
10). Under high-phosphate conditions,
transcription from
tagA in the three strains was basically
the same (Fig.
2D), as was
that of the
tagD promoter (Fig.
3D). There
was no APase produced
under these conditions, indicating no induction
of the Pho response
during phosphate-replete growth (Fig.
2C and
3C).
These results
strongly argue that neither PhoP nor PhoR plays a role in
regulation
of either of the two
tag promoters under
high-phosphate conditions.
Phosphate is the limiting nutrient in LPDM,
and cultures enter
into stationary phase due to a phosphate deficiency.
APases were
induced in the parent strain but were not induced in either
the
phoP or the
phoR strain (Fig.
2A and
3A). In
LPDM, transcription
from both the
tagA and
tagD
promoters was dramatically decreased
in the parent strain (Fig.
2B and
Fig.
3B) at the same time that
APase was induced in the same culture.
In contrast, transcription
from the
tagA and
tagD
promoters continued during the whole growth
period in either the
phoP or the
phoR strain (Fig.
2B and
3B).
These
results strongly suggest that both PhoP and PhoR are required
for
repression of transcription of these two promoters under phosphate
starvation conditions. Transcription of
tagD was two- to
threefold
higher than that of
tagA, as reported by
Maüel et al. (
18).
However, under our culture
conditions, the decrease in the level
of either
tagA or
tagD transcription in the parent strain during
phosphate
starvation was more dramatic (threefold) compared to
the results from
Maüel et al. (less than twofold) (
18).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
Promoter activity of tagA under phosphate
starvation and phosphate-replete conditions. Strains containing the
tagA-lacZ fusion in the parent strain or the phoP
or phoR mutant strain were grown in LPDM (0.42 mM) or HPDM
(5 mM) as described previously (10). A 12-h growth was
monitored with respect to optical density at 540 nm, (OD540), APase
activity, and  -galactosidase, which represents promoter activity. (A
and B) APase and -galactosidase activities, respectively, in LPDM;
(C and D) APase and -galactosidase activities, respectively, in
HPDM. Open symbols, growth; filled symbols, APase or -galactosidase
activity. Strains included MH5630 (squares [parent]), MH5632
(diamonds [phoR]), and MH5634 (circles
[phoP]).
|
|
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Promoter activity of tagD under phosphate
starvation and phosphate-replete conditions. Strains containing the
tagD-lacZ fusion in the parent strain or the phoP
or phoR mutant strain were grown in LPDM and HPDM as
described in the legend to Fig. 2. Strains included MH5631 (squares
[parent]), MH5633 (diamonds [phoR]), and MH5635 (circles
[phoP]). OD540, optical density at 540 nm.
|
|
The level of
tagA and
tagD transcription changed
little in either the
phoP or the
phoR mutant
during phosphate starvation,
corroborating the cell wall biochemical
quantitation data (
19).
Under the same conditions,
tuaA transcription is not turned on
(
14a), and no
teichuronic acid synthesis is induced in these
mutant strains
(
19). In order to survive, these mutants continue
to
synthesize teichoic acid for cell wall assembly, although the
limiting
phosphate reserve has to be used for this purpose. However,
in the
parent strain, the cell represses teichoic acid synthesis
and switches
to teichuronic acid synthesis during phosphate starvation
to conserve
the limited phosphorus sources (
5). The activation
of
tuaA transcription (
14a) and repression of
tagA and
tagD transcription
require
phoP and
phoR.
Since the
tagAB and
tagDEF operons were regulated
by PhoP and PhoR during phosphate starvation, these operons should be
considered
part of the Pho regulon. The definition of the Pho regulon
genes,
therefore, is broadened to include not only the genes which are
activated by PhoP~P, but genes which are repressed by PhoP~P as
well.
Both PhoP and PhoP~P bind to the promoter region shared by
tagA and tagD.
PhoP regulates the Pho
regulon genes by binding to the target promoters (13a, 14,
14a). To determine if regulation of the tagA and
tagD promoters by PhoP is through direct binding of PhoP to
these promoters, we performed gel shift assays (data not shown) and
DNase I footprinting assays using the promoter region shared by both
tagA and tagD in pSE90. PhoP bound to multiple regions within these two promoters (data not shown). To obtain clearer
footprinting data, the promoter region was dissected into two
subregions by DNA digestion at the unique MunI restriction site, which is located between the 35 regions of the two promoters (Fig. 1). Figure 4 shows that
PhoP~P bound to multiple regions whereas
unphosphorylated PhoP bound only to a region in which multiple
TTAACA-like sequences were found (Fig. 1). It has been found
that the DNA regions containing multiple TTAACA-like
sequences (separated by about five nonconserved nucleotides) were
bound by both unphosphosphorylated PhoP and PhoP~P in all of the
tested Pho promoters (13a, 14, 14a) and have been proposed
to compose the B. subtilis PhoP core binding region
(13a, 14a). Four TTAACA-like sequences in the
tagA and tagD promoters were located in the
region between 10 and 50 of the tagA promoter but on the
noncoding strand. In contrast, in other Pho promoters which are
activated by PhoP~P, the TTAACA-like sequences were
located at and upstream of the 22 region of the coding strand
(12, 14a). The appearance of the PhoP core binding region on
different strands may be important for the different role of PhoP~P
in the regulation of these promoters. PhoP~P binding sites within the
tagA and tagD promoters covered the 10 region,
partially covered the ribosomal binding sites, and extended to the 5'
coding regions for each of the two genes. However, binding of PhoP~P
on tuaA, which is activated by PhoP~P, is only located
upstream of 10 (14a). PhoP~P binding in the 5' coding
region may also be critical for the negative role of PhoP~P in
tagA and tagD regulation.
View larger version (130K):
[in this window]
[in a new window]
|
FIG. 4.
DNase I footprinting assays of the tagA and
tagD promoters by PhoP and PhoP~P. Plasmid pSE90 was
digested with MunI (Fig. 1), end labeled with Klenow
fragment, and digested with HindIII to obtain the
fragment A showing nt 371 to 79 of the tagD noncoding
strand. To get fragment B showing nt +168 to 124 of the
tagD coding strand, pSE90 was digested with
HindIII, end labeled with Klenow fragment, and digested
with MunI. Fragment C showing nt 82 to +121 of the
tagA coding strand was made by digesting pSE90 with
XbaI, end labeling with Klenow fragment, and further
digesting with MunI. Fragment D showing nt 121 to 323 of
the tagA noncoding strand was made by digesting pSE90 with
MunI, end labeling with Klenow fragment, and further
digesting with XbaI. The ends were labeled in the presence
of [ -32P]dCTP. The footprinting experiments were done
as described previously (14). The amounts of PhoP added to
each reaction mixture were 40 ng (55 nM), 200 ng (275 nM), 1 µg (1.4 µM), and 5 µg (6.9 µM) from left to right. To each reaction
mixture, 0.7 µg of *PhoR, the cytoplasmic domain of PhoR
(14), was added. +ATP, reaction mixtures containing ATP
which were used for producing PhoP~P; ATP, reaction mixtures for
unphosphorylated PhoP; F, lanes without PhoP; G, the G sequencing lane;
thick lines, binding sites for both PhoP and PhoP~P; thin lines,
binding sites for PhoP~P alone; arrowheads, hypersensitive sites. The
numbers of the arrowheads do not reflect the numbers of hypersensitive
sites shown in Fig. 1 because of space constraints due to clustering.
To correlate the locations of the footprinting results with the
sequences, the 5' and 3' ends of each sequence are labeled along with
the sequencing gels.
|
|
Maüel et al. (
16) found a sequence in the
tagA and
tagD promoter region which shows
similarity with the
Escherichia coli Pho box. A similar
sequence has also been found in the
phoA and
phoB
promoters. However, these sequences, at least for transcription
of the
phoA and
phoB promoters, are not necessary
(
3,
13a).
A model for PhoP~P regulation of cell wall synthesis.
We
have shown that PhoP is the substrate for PhoR, its cognate kinase,
with respect to phosphorylation and dephosphorylation (14).
It has been proposed that PhoP~P is the active form for stimulation
of Pho regulon gene transcription during phosphate starvation
(7-9, 14a). In control of B. subtilis cell wall
synthesis, we have shown that under phosphate starvation conditions
PhoP is required for activation of the tuaABCDEFGH operon
(14a) and simultaneous repression of the tagAB
and tagDEF operons. Therefore, teichuronic acid is
synthesized and teichoic acid synthesis is inhibited under these
conditions (5, 13). In this switch process, we propose that
PhoP~P plays a key role in activation of tuaA and
repression of tagA and tagD by binding to
different regions of these promoters (14a). In the
phoP or phoR mutant, transcription of genes for
teichuronic acid synthesis is not initiated due to the lack of the
activator, PhoP~P, during phosphate starvation; However, the cell
continues to transcribe the genes for teichoic acid synthesis to
compensate for cell wall anionic polymers because repression from
PhoP~P does not exist. Continued synthesis of teichoic acid has also
been observed in the mutants unable to synthesize teichuronic acid
(gtaB) during phosphate limitation (19). The
proposed explanation for this phenomenon was that a component of
teichuronic acid synthesis is involved in repression of teichoic acid
synthesis (Fig. 5). Any repression by a
metabolite dependent on teichuronic synthesis must require PhoP and
PhoR (14a), and this idea is supported by the observation
that no repression of teichoic acid was detected in a phoP
or phoR mutant under phosphate-limited conditions.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
A model for teichoic acid and teichuronic acid synthesis
regulated by PhoP~P. Under phosphate starvation conditions, PhoP~P
phosphorylated by PhoR binds to both the tag operon
promoters and the tua operon promoter. As a result, PhoP~P
binds to the 10 region and/or the ribosomal binding site and to the
5' end of the coding region to repress transcription from the
tag operons and simultaneously binds upstream of the 10
region of the tua operon to activate transcription. A
component involved in teichuronic acid synthesis has also been
suggested to repress teichoic acid synthesis during phosphate
limitation (19), as indicated by the arrows with dashed
lines. The number of the PhoP dimers in this model is not meant to
reflect the physiological state. The number of PhoP dimers binding to
any promoter is unknown.
|
|
When excess phosphate is provided, PhoP~P is dephosphorylated
by PhoR. In the absence of PhoP~P, teichuronic acid synthesis
is not
induced and teichoic acid synthesis is relieved from repression.
Thus,
PhoP and PhoR do not play a role during phosphate-replete
growth.
This is the first time that the negative role of PhoP~P has been
observed for Pho regulation. That the PhoP-PhoR two-component
regulatory system participates in the regulation of
B. subtilis cell wall anionic polymer synthesis distinguishes the
B. subtilis Pho regulon from the well-studied
E. coli Pho regulon. These data
together with
tuaA
activation establish the importance of the
Pho regulon in
B. subtilis cell wall synthesis and perhaps in
other gram-positive
bacteria whose cell walls contain teichoic
acid and teichuronic acid
anionic polymers.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory for
Molecular Biology, University of Illinois at Chicago, Chicago, IL
60607. Phone: (312) 996-5460. Fax: (312) 413-2691. E-mail:
U09495{at}uicvm.uic.edu.
| |
REFERENCES |
| 1.
|
Archibald, A. R.,
I. C. Hancock, and C. R. Harwood.
1993.
Cell wall structure, synthesis and turn over, p. 381-410. In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular biology.
American Society for Microbiology, Washington, D.C.
|
| 2.
|
Baddiley, J.
1970.
Structure, biosynthesis and function of teichoic acids.
Accounts Chem. Res.
3:98-105.
|
| 3.
|
Chesnut, R. S.,
C. Bookstein, and F. M. Hulett.
1991.
Separate promoters direct expression of phoAIII, a member of the Bacillus subtilis alkaline phosphatase multigene family, during phosphate starvation and sporulation.
Mol. Microbiol.
5:2181-2190[Medline].
|
| 4.
|
Eder, S.,
L. Shi,
K. Jensen,
K. Yamane, and F. M. Hulett.
1996.
A Bacillus subtilis secreted phosphodiesterase/alkaline phosphatase is the product of a Pho regulon gene, phoD.
Microbiology
142:2041-2047[Abstract/Free Full Text].
|
| 5.
|
Ellwood, D. C., and D. W. Tempest.
1969.
Control of teichoic acid and teichuronic acid biosyntheses in chemostat cultures of Bacillus subtilis var. niger.
Biochem. J.
111:1-5[Medline].
|
| 6.
|
Eymann, C.,
H. Mach,
C. R. Harwood, and M. Hecker.
1996.
Phosphate-starvation-inducible proteins in Bacillus subtilis: a two-dimensional gel electrophoresis study.
Microbiology
142:3163-3170[Abstract/Free Full Text].
|
| 7.
|
Hulett, F. M.
1996.
The signal transduction network for Pho regulation.
Mol. Microbiol.
19:933-939[Medline].
|
| 8.
|
Hulett, F. M.
1995.
Complex phosphate regulation by sequential switches in Bacillus subtilis, p. 289-302. In
J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction.
American Society for Microbiology, Washington, D.C.
|
| 9.
|
Hulett, F. M.
1993.
Regulation of phosphorus metabolism, p. 229-235. In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics.
American Society for Microbiology, Washington, D.C.
|
| 10.
|
Hulett, F. M.,
C. Bookstein, and K. Jensen.
1990.
Evidence for two structural genes for alkaline phosphatase in Bacillus subtilis.
J. Bacteriol.
172:735-740[Abstract/Free Full Text].
|
| 11.
|
Hulett, F. M.,
J. Lee,
L. Shi,
G. Sun,
R. Chesnut,
E. Sharkova,
M. F. Duggan, and N. Kapp.
1994.
Sequential action of two-component genetic switches regulates the PHO regulon in Bacillus subtilis.
J. Bacteriol.
176:1348-1358[Abstract/Free Full Text].
|
| 12.
|
Hulett, F. M.,
G. Sun, and W. Liu.
1994.
The Pho regulon of Bacillus subtilis is regulated by sequential action of two genetic switches, p. 50-54. In
A. Torriani-Gorini, E. Yogil, and S. Silver (ed.), Phosphate in microorganisms: cellular and molecular biology.
American Society for Microbiology, Washington, D.C.
|
| 13.
|
Lang, W. K.,
K. Glassey, and A. R. Archibald.
1982.
Influence of phosphate supply on teichoic acid and teichuronic acid content of Bacillus subtilis cell walls.
J. Bacteriol.
151:367-375[Abstract/Free Full Text].
|
| 13a.
| Liu, W., et al. Submitted for publication.
|
| 14.
|
Liu, W., and F. M. Hulett.
1997.
Bacillus subtilis PhoP binds to the phoB tandem promoter exclusively within the phosphate starvation-inducible promoter.
J. Bacteriol.
179:6302-6310[Abstract/Free Full Text].
|
| 14a.
| Liu, W., and F. M. Hulett. Submitted for
publication.
|
| 15.
|
Mauël, C.,
A. Bauduret,
C. Chervet,
S. Beggah, and D. Karamata.
1995.
In Bacillus subtilis 168, teichoic acid of the cross-wall may be different from that of the cylinder: a hypothesis based on transcription analysis of tag genes.
Microbiology
141:2379-2389[Abstract/Free Full Text].
|
| 16.
|
Mauël, C.,
M. Young, and D. Karamata.
1991.
Genes concerned with synthesis of poly(glycerol phosphate), the essential teichoic acid in Bacillus subtilis strain 168, are organized in two divergent transcription units.
J. Gen. Microbiol.
137:929-941[Medline].
|
| 17.
|
Mauël, C.,
M. Young,
P. Margot, and D. Karamata.
1989.
The essential nature of teichoic acids in Bacillus subtilis as revealed by insertional mutagenesis.
Mol. Gen. Genet.
215:388-394[Medline].
|
| 18.
|
Mauël, C.,
M. Young,
A. Monsutti-Grecescu,
S. A. Marriott, and D. Karamata.
1994.
Analysis of Bacillus subtilis tag gene expression using transcription fusions.
Microbiology
140:2279-2288[Abstract/Free Full Text].
|
| 19.
|
Müller, J. P.,
Z. An,
T. Merad,
I. C. Hancock, and C. Harwood.
1997.
Influence of Bacillus subtilis phoR on cell wall anionic polymers.
Microbiology
143:947-956[Abstract/Free Full Text].
|
| 20.
|
Pooley, H. M.,
F.-X. Abellan, and D. Karamata.
1991.
A conditional-lethal mutant of Bacillus subtilis 168 with a thermosensitive glycerol-3-phosphate cytidylyltransferase, an enzyme specific for the synthesis of the major teichoic acid.
J. Gen. Microbiol.
137:921-928[Abstract/Free Full Text].
|
| 21.
|
Pooley, H. M.,
F.-X. Abellan, and D. Karamata.
1992.
CDP-glycerol:poly(glycerophosphate) glycerophosphotransferase, which is involved in the synthesis of the major wall teichoic acid in Bacillus subtilis 168, is encoded by tagF (rodC).
J. Bacteriol.
174:646-649[Abstract/Free Full Text].
|
| 22.
|
Pooley, H. M.,
D. Paschoud, and D. Karamata.
1987.
The gtaB marker in Bacillus subtilis 168 is associated with a deficiency in UDP glucose pyrophosphorylase.
J. Gen. Microbiol.
133:3481-3493[Abstract/Free Full Text].
|
| 23.
|
Qi, Y.,
Y. Kobayashi, and F. M. Hulett.
1996.
The pst operon of Bacillus subtilis has a phosphate-regulated promoter and is involved in phosphate transport but not in regulation of the Pho regulon.
J. Bacteriol.
179:2534-2539[Abstract/Free Full Text].
|
| 24.
|
Seki, T.,
H. Yoshikawa,
H. Takahashi, and H. Saito.
1987.
Cloning and nucleotide sequence of phoP, the regulatory gene for alkaline phosphatase and phosphodiesterase in Bacillus subtilis.
J. Bacteriol.
169:2913-2916[Abstract/Free Full Text].
|
| 25.
|
Seki, T.,
H. Yoshikawa,
H. Takahashi, and H. Saito.
1988.
Nucleotide sequence of the Bacillus subtilis phoR gene.
J. Bacteriol.
170:5935-5938[Abstract/Free Full Text].
|
| 26.
|
Shimotsu, H., and D. Henner.
1986.
Construction of a single copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis.
Gene
43:85-94[Medline].
|
| 27.
|
Soldo, B.,
V. Lavarevic,
P. Margot, and D. Karamata.
1993.
Sequencing and analysis of the divergon comprising gtaB, the structural gene of UDP-glucose pyrophosphorylase of Bacillus subtilis 168.
J. Gen. Microbiol.
139:3185-3195[Abstract/Free Full Text].
|
| 28.
|
Soldo, B.,
V. Lazarevic,
M. Pagni,
C. Mauël, and D. Karamata.
1995.
Transcriptional regulation of teichuronic acid gene expression, p. 77.
Abstracts for the 8th International Conference on Bacilli
Stanford, Calif.
|
| 29.
|
Ward, J. B.
1981.
Teichoic acid and teichuronic acids: biosynthesis, assembly, and location.
Microbiol. Rev.
45:211-243[Free Full Text].
|
J Bacteriol, February 1998, p. 753-758, Vol. 180, No. 3
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fiedler, T., Mix, M., Meyer, U., Mikkat, S., Glocker, M. O., Bahl, H., Fischer, R.-J.
(2008). The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation. J. Bacteriol.
190: 6559-6567
[Abstract]
[Full Text]
-
Eldakak, A., Hulett, F. M.
(2007). Cys303 in the Histidine Kinase PhoR Is Crucial for the Phosphotransfer Reaction in the PhoPR Two-Component System in Bacillus subtilis. J. Bacteriol.
189: 410-421
[Abstract]
[Full Text]
-
Makarewicz, O., Dubrac, S., Msadek, T., Borriss, R.
(2006). Dual Role of the PhoP~P Response Regulator: Bacillus amyloliquefaciens FZB45 Phytase Gene Transcription Is Directed by Positive and Negative Interactions with the phyC Promoter.. J. Bacteriol.
188: 6953-6965
[Abstract]
[Full Text]
-
Kocan, M., Schaffer, S., Ishige, T., Sorger-Herrmann, U., Wendisch, V. F., Bott, M.
(2006). Two-Component Systems of Corynebacterium glutamicum: Deletion Analysis and Involvement of the PhoS-PhoR System in the Phosphate Starvation Response. J. Bacteriol.
188: 724-732
[Abstract]
[Full Text]
-
Allenby, N. E. E., O'Connor, N., Pragai, Z., Ward, A. C., Wipat, A., Harwood, C. R.
(2005). Genome-Wide Transcriptional Analysis of the Phosphate Starvation Stimulon of Bacillus subtilis. J. Bacteriol.
187: 8063-8080
[Abstract]
[Full Text]
-
Schertzer, J. W., Bhavsar, A. P., Brown, E. D.
(2005). Two Conserved Histidine Residues Are Critical to the Function of the TagF-like Family of Enzymes. J. Biol. Chem.
280: 36683-36690
[Abstract]
[Full Text]
-
Minnig, K., Lazarevic, V., Soldo, B., Mauel, C.
(2005). Analysis of teichoic acid biosynthesis regulation reveals that the extracytoplasmic function sigma factor {sigma}M is induced by phosphate depletion in Bacillus subtilis W23. Microbiology
151: 3041-3049
[Abstract]
[Full Text]
-
Abdel-Fattah, W. R., Chen, Y., Eldakak, A., Hulett, F. M.
(2005). Bacillus subtilis Phosphorylated PhoP: Direct Activation of the E{sigma}A- and Repression of the E{sigma}E-Responsive phoB-PS+V Promoters during Pho Response. J. Bacteriol.
187: 5166-5178
[Abstract]
[Full Text]
-
Schau, M., Eldakak, A., Hulett, F. M.
(2004). Terminal Oxidases Are Essential To Bypass the Requirement for ResD for Full Pho Induction in Bacillus subtilis. J. Bacteriol.
186: 8424-8432
[Abstract]
[Full Text]
-
Bhavsar, A. P., Erdman, L. K., Schertzer, J. W., Brown, E. D.
(2004). Teichoic Acid Is an Essential Polymer in Bacillus subtilis That Is Functionally Distinct from Teichuronic Acid. J. Bacteriol.
186: 7865-7873
[Abstract]
[Full Text]
-
Paul, S., Birkey, S., Liu, W., Hulett, F. M.
(2004). Autoinduction of Bacillus subtilis phoPR Operon Transcription Results from Enhanced Transcription from E{sigma}A- and E{sigma}E-Responsive Promoters by Phosphorylated PhoP. J. Bacteriol.
186: 4262-4275
[Abstract]
[Full Text]
-
Chen, Y., Abdel-Fattah, W. R., Hulett, F. M.
(2004). Residues Required for Bacillus subtilis PhoP DNA Binding or RNA Polymerase Interaction: Alanine Scanning of PhoP Effector Domain Transactivation Loop and {alpha} Helix 3. J. Bacteriol.
186: 1493-1502
[Abstract]
[Full Text]
-
Pragai, Z., Allenby, N. E. E., O'Connor, N., Dubrac, S., Rapoport, G., Msadek, T., Harwood, C. R.
(2004). Transcriptional Regulation of the phoPR Operon in Bacillus subtilis. J. Bacteriol.
186: 1182-1190
[Abstract]
[Full Text]
-
Moraleda-Munoz, A., Carrero-Lerida, J., Perez, J., Munoz-Dorado, J.
(2003). Role of Two Novel Two-Component Regulatory Systems in Development and Phosphatase Expression in Myxococcus xanthus. J. Bacteriol.
185: 1376-1383
[Abstract]
[Full Text]
-
Birck, C., Chen, Y., Hulett, F. M., Samama, J.-P.
(2003). The Crystal Structure of the Phosphorylation Domain in PhoP Reveals a Functional Tandem Association Mediated by an Asymmetric Interface. J. Bacteriol.
185: 254-261
[Abstract]
[Full Text]
-
Chen, Y., Birck, C., Samama, J.-P., Hulett, F. M.
(2003). Residue R113 Is Essential for PhoP Dimerization and Function: a Residue Buried in the Asymmetric PhoP Dimer Interface Determined in the PhoPN Three-Dimensional Crystal Structure. J. Bacteriol.
185: 262-273
[Abstract]
[Full Text]
-
Soldo, B., Lazarevic, V., Pooley, H. M., Karamata, D.
(2002). Characterization of a Bacillus subtilis Thermosensitive Teichoic Acid-Deficient Mutant: Gene mnaA (yvyH) Encodes the UDP-N-Acetylglucosamine 2-Epimerase. J. Bacteriol.
184: 4316-4320
[Abstract]
[Full Text]
-
Soldo, B., Lazarevic, V., Karamata, D.
(2002). tagO is involved in the synthesis of all anionic cell-wall polymers in Bacillus subtilis 168. Microbiology
148: 2079-2087
[Abstract]
[Full Text]
-
Pragai, Z., Harwood, C. R.
(2002). Regulatory interactions between the Pho and {sigma}B-dependent general stress regulons of Bacillus subtilis. Microbiology
148: 1593-1602
[Abstract]
[Full Text]
-
Lazarevic, V., Abellan, F.-X., Moller, S. B., Karamata, D., Mauel, C.
(2002). Comparison of ribitol and glycerol teichoic acid genes in Bacillus subtilis W23 and 168: identical function, similar divergent organization, but different regulation. Microbiology
148: 815-824
[Abstract]
[Full Text]
-
Ogura, M., Yamaguchi, H., Yoshida, K.-i., Fujita, Y., Tanaka, T.
(2001). DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an approach to comprehensive analysis of B.subtilis two-component regulatory systems. Nucleic Acids Res
29: 3804-3813
[Abstract]
[Full Text]
-
Prágai, Z., Eschevins, C., Bron, S., Harwood, C. R.
(2001). Bacillus subtilis NhaC, an Na+/H+ Antiporter, Influences Expression of the phoPR Operon and Production of Alkaline Phosphatases. J. Bacteriol.
183: 2505-2515
[Abstract]
[Full Text]
-
Antelmann, H., Scharf, C., Hecker, M.
(2000). Phosphate Starvation-Inducible Proteins of Bacillus subtilis: Proteomics and Transcriptional Analysis. J. Bacteriol.
182: 4478-4490
[Abstract]
[Full Text]
-
Gonin, M., Quardokus, E. M., O'Donnol, D., Maddock, J., Brun, Y. V.
(2000). Regulation of Stalk Elongation by Phosphate in Caulobacter crescentus. J. Bacteriol.
182: 337-347
[Abstract]
[Full Text]
-
Eder, S., Liu, W., Hulett, F. M.
(1999). Mutational Analysis of the phoD Promoter in Bacillus subtilis: Implications for PhoP Binding and Promoter Activation of Pho Regulon Promoters. J. Bacteriol.
181: 2017-2025
[Abstract]
[Full Text]
-
Qi, Y., Hulett, F. M.
(1998). Role of PhoP~P in Transcriptional Regulation of Genes Involved in Cell Wall Anionic Polymer Biosynthesis in Bacillus subtilis. J. Bacteriol.
180: 4007-4010
[Abstract]
[Full Text]
Top
Abstract
Text
