Department of Microbiology, The University of
Sydney, Sydney, New South Wales 2006, Australia
The O antigen is an important cell wall antigen of gram-negative
bacteria, and the genes responsible for its biosynthesis are located in
a gene cluster. We have cloned and sequenced the DNA segment unique to
the O-antigen gene cluster of Salmonella enterica group D3.
This segment includes a novel O-antigen polymerase gene
(wzyD3). The polymerase gives 
(1
6)
linkages but has no detectable sequence similarity to that of group D2,
which confers the same linkage. We find the remnant of a D3-like
wzy gene in the O-antigen gene clusters of groups D1 and B
and suggest that this is the original wzy gene of these
O-antigen gene clusters.
 |
TEXT |
Lipopolysaccharide (LPS), an
important component of the outer membrane of Gram-negative bacteria,
usually consists of three distinct regions: lipid A, core
oligosaccharide, and O-specific polysaccharide (O antigen). O antigens
consist of repeats of an O unit of generally two to six sugars. In
Salmonella enterica, there are 46 types of O antigens
(32), which differ in sugar composition and in linkages
between sugars and between O units. The O units of S. enterica groups B and D1 have the same backbone sugar residues,
the only difference being the presence of different dideoxyhexose (DDH)
branch sugars, with abequose in group B (12) and tyvelose in
D1 (11) (Fig. 1). This
difference determines distinctive epitopes for these two groups: O4 for
group B and O9 for group D1.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Structures of the O antigens of S. enterica groups B, D1, D1 carrying phage P27, D2, D3, and E1.
Abbreviations: Abe, abequose; Gal, galactose; Man, mannose; Rha,
rhamnose; Tyv, tyvelose. O-antigen epitopes are also shown. (B)
Proposed epitopes of O antigen of S. enterica serovar
Zuerich group D3. The bold outline around the oligosaccharide unit
symbolizes the importance of the sugars in the structure of the
epitopes; the thicker the line, the greater the participation of the
sugars in the combining site. Dotted lines indicate that the additional
sugars may weakly participate in the expression of the epitopes
(modified after Nghiem et al. [28]).
|
|
The O unit of S. enterica group D2 (O9,46) differs from that
of group D1 (O9,12) in the anomeric configuration of the mannosyl residue (reviewed by Kauffmann [15]), with -mannose
in group D1 (11) and 
-mannose in group D2 (7, 10,
27), and in the galactosyl-mannose linkage formed on O-antigen
polymerization, which is (12) in group D1 and (16) in group
D2 (10, 11) (Fig. 1). The O unit of S. enterica
group E1 (O3,10) has the same backbone as that of group D2, with the
tyvelose side branch absent (34) (Fig. 1).
S. enterica group D3 (O9,12,27,46) has the (16)
galactosyl-mannose linkage of group D2 but two kinds of O unit with
either - or -mannosyl residues (28-30) (Fig. 1);
these different O units can coexist on the same O-polysaccharide chain
(28, 30).
The biosynthesis of the O antigen begins with synthesis of nucleotide
sugars and is followed by assembly of O units by sequential transfer of
sugars onto undecaprenyl phosphate by transferases. The polymerization
of O units is catalyzed by O-antigen polymerase, Wzy (Rfc). Finally,
the O polysaccharides are ligated to lipid A-core to form LPS. The
genes coding for the enzymes responsible for synthesis of the
nucleotide sugars and the transferases necessary for O-unit assembly
are located in the O-antigen gene cluster. The O-antigen gene clusters
of S. enterica groups B, D1, D2, and E1 have been sequenced,
and most genes in these clusters have been identified (13, 19-21,
36-38, 40). The transferase which catalyzes the mannosyl
(14) linkage, named WbaU (RfbU), is found in the O-antigen gene
clusters of groups B and D1 (19), while the transferase
which catalyzes the mannosyl (14) linkage was named WbaO (RfbO)
and is found in the O-antigen gene clusters of groups D2 and E1
(19) (Fig. 2). For most O
antigens, the wzy gene is located in the O-antigen gene
cluster (3, 17, 23, 25), and this is true for groups D2 and
E1 (40). However, the wzy gene for the (12)
linkage in groups B and D1 is elsewhere on the chromosome
(26). We have shown previously (40) that the
group D2 O-antigen gene cluster comprises 5' and 3' components homologous to those of the D1 and E1 gene clusters, respectively, separated by an H-repeat (H-rpt)-like element (Fig. 2) which we suggested could have mediated a recombination event between D1 and E1
gene clusters to give the D2 cluster (40).
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 2.
Central regions of the O-antigen gene clusters of
S. enterica groups D1, D2, D3, and B. N, O, U, and V
indicate genes wbaN, -O, -U and
-V, respectively. Mannose, rhamnose (transferase only
shown), DDH, and wzx genes are indicated by shading. Heavy
bars above and below indicate transferase genes. Level of shading
indicates degree of amino acid identity to homologous gene of group D1.
Note that wbaO has barely detectable amino acid identity to
wbaU. The wbaV-wbaU intergenic region of groups B
and D1, shown to be remnant wzy genes, are indicated by a
cross-out on the wzy gene. The similarities of the D3
cluster are indicated. The insert of plasmid pPR1739 is indicated, as
are the binding sites for primers 365, 16, and 20, used for PCR of D3
DNA; primer 365 (TAGAATTCAAAGGGCTGGCTAGCTACA) is based on
group D2 sequence (positions 314 to 332) (40), while primers
16 (GCGGTAGGCTTTAGAATA) and 20 (CTCTTGGAATCCAGAACG)
are based on sequences of group B (positions 16160 to 16143 and
17238 to 17221, respectively) (13). The 5' end of all four
clusters (not shown) comprises rhamnose genes (rmlABCD) and
DDH genes (ddhABCD), and the 3' end comprises mannose genes
(manBC) and the wbaP gene (not shown).
|
|
We have investigated the O-antigen gene cluster of S. enterica group D3 strain M840 (Table
1) which was used in a previous study
(39). It had been proposed that group D3 strains may have two O-antigen gene clusters of the D1 and D2 types, which would provide
a very simple explanation of the phenotype (24). However, Southern blotting with several probes for genes common to both provided
no support for this possibility (39), and one would therefore expect to find an O-antigen gene cluster similar to that of
D2, with the addition of a wbaU gene. Southern hybridization of chromosomal DNA of M840 with probes from the
wbaOE1, wbaUB, and
wzyE1 genes was positive only with the
wbaUB probe (39) (subscripts indicate
the groups from which the genes were derived). Further Southern
hybridization (39) showed that the D3 cluster resembled that
of group D1 upstream of wbaV and downstream of wbaU, with a region of difference in the center of the
cluster. This finding suggests that strain M840 has novel -mannosyl
transferase and wzy genes in the central region. In this
study, we examined the central region of the O-antigen gene cluster of
D3 to determine the basis of the specific characteristics of the D3 O
antigen.
Sequencing the region between wbaV and wbaU
of group D3.
PCR was used to amplify the region between
wbaV and wbaU of strain M840, using primers (365 and 16) indicated in Fig. 2; a 3.2-kb fragment was obtained. This
fragment was then cloned into pGEM-T (Promega), and Escherichia
coli DH10b (Table 1) was used as the host strain for the resulting
plasmid, pPR1739. The region between the end of wbaV and the
beginning of wbaU of M840 was completely sequenced in both
directions, using dye-primer sequencing kits (ABI), a Perkin-Elmer
Cetus DNA Thermal Cycler, and an ABI model 377 Sequencer. The
sequencing of this region was done by using primer walking with each
internal region amplified and cloned. A 2,497-bp segment between the
end of wbaV and the start of wbaU was sequenced.
The sequence was analyzed by using ANGIS (Australian National Genomic
Information Service) (33) and the following programs: BESTFIT (5) and SEQH (14) for identification,
similarity of DNA, or deduced amino acid sequences; ALOM (programs
developed by M. Kanehisa, National Institutes of Health) for
predication of potential transmembrane segments by the method of Klein
et al. (16); and BLAST (1, 8) for database
similarity searches. The first 877 bp are very similar to the
corresponding region of group D2, including the last 50 bp of
wbaV, 376 bp of noncoding DNA, followed by 451 bp of the
H-rpt (insertion sequence-like element) (40). The average
level of DNA sequence identity in this region is 78.7%. After the
H-rpt sequence, there is a 418-bp noncoding region which has no
detectable homology with any sequence in the database (GenBank), and
then an open reading frame (ORF) of 1,176 bp (Fig. 2), with its stop
codon overlapped by the start codon of the wbaU gene (ATGA).
Identification of the wzyD3 gene.
We
were expecting an (16) O-antigen polymerase gene and a (14)
mannose transferase gene. Analysis of the deduced amino acid sequence
of the protein product of the only ORF (392 amino acids) showed no
detectable sequence similarity to any protein in GenBank; however it
has a hydropathy profile very similar to those of Wzy proteins, with 10 potential transmembrane segments and a large periplasmic loop (data not
shown), making it a candidate for the predicted (16) O-antigen
polymerase gene.
Plasmid pPR1739 was transferred into S. enterica serovar
Typhimurium strain C5 wzy mutant LV386 (Table 1), and LPS of
the resulting strain was analyzed by electrophoresis using a sodium dodecyl sulfate-12.5% polyacrylamide gel (22) (Fig.
3). The results showed that LV386/pPR1739
produced long-chain O antigen, indicating that the wzy
mutation could be complemented by the only ORF in pPR1739, which is
thereby shown to be an O-antigen polymerase gene and named
wzy. It is identified as wzyD3 in
this report. Strain LV386/pPR1739 agglutinated with O27 antiserum in addition to O4 antiserum (Table 2),
indicating that this polymerase ligates O units with an (16)
linkage. However, our O27 antiserum, which agglutinated LV386/pPR1739,
did not agglutinate strain M840, which should be O1,9,27,46 (see below
for explanation).
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of the wzyD3 gene
by analysis of the LPS on a sodium dodecyl sulfate-12.5%
polyacrylamide gel and silver staining. Lane 1, LV386 (S. enterica LT2 wzy mutant); lane 2, LV386/pPR1739; lane
3, SL1854 (LT2 wild type).
|
|
Group D3 has O units with both mannosyl (14) and mannosyl
(14) linkages, and we investigated if both are polymerized by WzyD3 by combining the wzyD3 and
(14) mannose transferase genes in a wzy mutant. We
made plasmid pPR1820, which carries the wbaO gene from group
E1 and the wzyD3 in low-copy-number vector
pPR637 (13). We cloned the 2.1-kb
HincII-PstI fragment from pPR966 (positions 10045 to 12217 of the group E1 O-antigen gene cluster [38])
into HindIII (end-filled) and PstI sites on
the polylinker of pPR637, followed by cloning of the 2.1-kb insert as a
BglII-SacI (vector) fragment from pPR1739 into
the resulting plasmid, using BamHI and SacI
sites. Our only wzy mutant, LV386, was unexpectedly found to
be spectinomycin and streptomycin resistant and therefore not suitable
for transfer of pPR1820; therefore, we made P9487, a wzy
mutant of LT2 (Table 1). Strain P9487/pPR1820 has (16) polymerase, -mannosyl, and -mannosyl transferase genes and should produce two kinds of O antigen:
-6-[(Abe-1,3-)-Man-1,4-Rha-1,3-Gal]-1-, and
-6-[(Abe-1,3-)-Man-1,4-Rha-1,3-Gal]-1- (see the legend to
Fig. 1 for abbreviations). Strain P9487/pPR1820 was agglutinated with
O27 antiserum but not O46 antiserum (Table 2). Factors 27 and 46 have
been related to the oligosaccharide
-6-[(DDH-1,3-)-()Man-1,4-Rha-1,3-Gal]-1- with
-mannose for O27 and -mannose for O46. Agglutination with O27
serum indicates that the wzyD3 gene in this
construct is active. The failure of the O46 serum to agglutinate
suggested that the -mannosyl (14) linkage is absent in the
polymer, but see below.
Plasmid pPR618, which carries prt (rfbS) and
tyv (rfbE) genes of group D1, allowing synthesis
of CDP-tyvelose in a group B strain (37), was transferred
into P9487/pPR1820. Strain P9487/pPR1820/pPR618 could potentially
produce two additional O antigens:
-6-[(Tyv-1,3-)-Man-1,4-Rha-1,3-Gal]-1- and
-6-[(Tyv-1,3-)-Man-1,4-Rha-1,3-Gal]-1-; this strain was agglutinated with O4, O9, O27, and O46 antisera (Table 2), the latter
indicating the presence of the mannosyl (14) linkage, showing
that WzyD3 could polymerize O units containing -mannose in addition to those containing -mannose. It is interesting that the
polymerase making the galactosyl-mannose linkage is not specific for
the anomeric state of the mannosyl residue, although the situation is
not known for the E1/D2 and group B polymerases, which have not been
tested with the alternate form of the O unit.
Specificity of O27 and O46 sera.
In group B and D1 strains
lysogenized by phage P27, a phage-encoded polymerase forms (16)
linkages between O units, conferring the new epitope, O27 (2,
18). The failure of the O27 serum to agglutinate the parental
group D3 strain in our hands (see above) probably reflects the
specificity of the O27 sera for the DDH. Distinct epitopes O27A, O27B,
and O27D were distinguished in the early literature (35) as
cross-reacting specificities for the O antigens of group A, B, and D1
strains, respectively, when lysogenized by phage P27. However, the
current protocol for O27 serum (6) uses a lysogenized group
B strain, and the Difco O27 antiserum used in this study had been
raised by using S. enterica serovar Schleissheim (group B,
phage 27-lysogenized strain [O1,4,12,27], absorbed with S. enterica serovars Paratyphi B [O1,4,5,12] and Essen [O4,12])
(4a). Given that three related but distinct specificities were recognized earlier, it probably has much lower specificity for
tyvelose-containing O antigens than for those with abequose and hence
at the dilution provided failed to agglutinate our group D3 strain.
We suggest that the current nomenclature, treating O27 as a single
specificity, can be misleading as the standard O27 serum, made with a
group B lysogen (6), does not appear to agglutinate all
strains carrying the O27 specificity at the dilution present in
commercial sera, the activity being dependent on the DDH present. This
may well have led to underreporting of group D3 strains, which would
appear as group D2 strains if the O27 serum was not effective at the
dilution used. It is of interest that the O27 serum used in a specific
study of group D3 (28) was made not by the standard protocol
but by using a lysogenized group D1 strain, presumably to gain better
reaction with the tyvelose-containing D3 O antigen.
The O46 epitope was identified in group D2 and is also present in group
D3; agglutination by O46 serum requires the (16) linkage between
galactose and -mannose (not -mannose). The O antigen of group E1,
which has the structure described above (Fig. 1), does not react to O46
serum (32), showing that DDH is also required. We suggest
that the -mannosyl linkage is present in both P9487/pPR1820/pPR618
and P9487/pPR1820, and the failure of the O46 serum to react with the O
antigen of P9487/pPR1820 while reacting with P9487/pPR1820/pPR618
reflects a requirement for tyvelose (not abequose) as DDH. The O
antigen of P9487/pPR1820 has a unique structure with (16) linkage
between galactose and -mannose and with abequose as DDH. It is
possible that as for O27, there are three forms of O46 with preference
for abequose, paratose, and tyvelose, but this has not been tested by
titration of sera against the three O-antigen forms.
Lack of the -mannosyl transferase gene.
We did not find the
expected -mannosyl transferase gene in the O-antigen gene cluster of
group D3. We therefore looked at regions between wbaV and
wbaN of four additional group D3 strains (Table 1) together
with M840 to determine whether M840 was typical. PCR using primers 365 and 20 (Fig. 2) showed that a 4.3-kb DNA fragment could be amplified
from all five strains, indicating that the gene organization in this
region is the same in all of them. The wbaO gene of group D3
has not been located but must have little or no sequence similarity to
the known wbaO gene in group E1 and D2, and it might be
present on a phage on elsewhere of the chromosome.
Ancestral form of group B and D1 O antigens.
The 318-bp
remnant wzy gene of group B between wbaV and
wbaU (bp 15061 to 15,378 [13]) has a high
level of identity to the wzyD3 gene at the
nucleic acid level (Fig. 4). The
corresponding region of group D1 is more complex: there are 577 bp
(positions 2303 to 2879 [21]), of which the first 344 show low-level similarity to wzyD2/E1 at the
amino acid level (40), while the following 233-bp sequence
has a high level of identity to wzyD3 (Fig. 4).
View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
DNA sequence alignment of the second half of the
wzyD3 gene and the intergenic regions of groups
D1 and B. Numbering of the group D3 gene starts from the beginning of
the gene; numberings of group D1 and group B sequences are from
references 21 and 13, respectively. Asterisks indicate the overlap of
the stop codon of the wzy gene and the start codon of the
wbaU gene. Strike-through and italic sections of the
hypothetical wzyB gene are alternate alignments
of one sequence displayed twice to indicate similarity to two segments
of wzyD3 which may represent the basis for
deletion by homologous recombination.
|
|
Alignment of the functional wzyD3 gene with the
remnants of such a gene in the wbaV-wbaU intergenic spaces
of groups B and D1 (Fig. 4) gives a strong indication that groups B and
D1 once shared a common wzy gene for an (16) linkage
in addition to their many other similarities: they now have an
(12) linkage wzy gene of unknown origin elsewhere on
the chromosome (the original rfc gene of strain LT2).
Presumably the ancestral (16) wzy gene suffered
inactivation and substantial deletion after the introduction of the new
(12) polymerase gene. There are possible parallels with E2
strains which have the E1 antigen gene cluster but in addition a
bacteriophage (
15) which encodes a (16) linkage polymerase
which functionally replaces the (16) linkage polymerase of the E1
O-antigen cluster (24).
It is interesting that the presumed ancestral (16) linkage was
regained later in many group B strains by lysogenization with the P27
bacteriophage which carries an (16) linkage polymerase (24), but in this case nothing is known of the
wzy gene. O27 strains thought to be of this type comprise 74 of 144 group B serovars (32). The (16) linkage is also
present in group D2; in this case the gene involved is derived from
group E1 (40).
Origins of the D3 O-antigen gene cluster.
The location of the
H-rpt suggests that it was involved in transfer of the wzy
gene to create the D3 gene cluster, just as we proposed for
wzyE1 of D2. In the case of D2, both
wzy and wbaO are almost identical to genes of
group E1 whereas the rest of the gene cluster is from group D1, making
an origin by recombination very convincing. However, in the case of D3,
the one additional gene not present in group D1,
wzyD3, is the wzy gene that we now also believe to have been in the ancestral O-antigen D1 and B gene
clusters. It is not yet clear how the D3 gene cluster arose, as there
are alternative possibilities. In some ways, the simplest hypothesis is
that it derives from the ancestral D1 cluster by addition of an H-rpt,
which subsequently suffered deletion of its downstream end. However, in
that case we have no explanation for the presence of the H-rpt in the
D3 cluster.
The alternative hypothesis is that the D3 cluster arose by transfer of
the wzy gene mediated by the H-rpt. The insertion site of
the H-rpt is the same in D2 and D3 (only the left-hand end survives in
D3), suggesting that the same H-rpt insertion was involved in the
formation of both D2 and D3. However, the sequence of events is not
clear, as two different wzy genes are involved. The
recipient would have been a D1 strain or B strain which had lost its
(16)-linkage wzy gene and regained it by this
recombination. It is too early to speculate in detail, but the
alignments are shown in Fig. 2.
Nucleotide sequence accession number.
The GenBank accession
number of the sequence shown in Fig. 2 is AF017148.
We thank M. Hobbs for his useful discussion, and we thank C. Murray and
staff at the Institute of Medical and Veterinary Science, Adelaide,
Australia, and M. Y. Popoff at the Pasteur Institute, Paris,
France, for helpful discussion on serology.
| 1.
|
Altschul, A. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Bagdian, G.,
O. Luderitz, and A. M. Staub.
1966.
Immunochemical studies on Salmonella. XI. Chemical modification correlated with conversion of group B by bacteriophage 27.
Ann. N. Y. Acad. Sci.
133:405-424[Medline].
|
| 3.
|
Brown, P. K.,
L. K. Romana, and P. R. Reeves.
1992.
Molecular analysis of the rfb gene cluster of Salmonella serovar Muenchen (strain M67): genetic basis of the polymorphism between groups C2 and B.
Mol. Microbiol.
6:1385-1394[Medline].
|
| 4.
|
Collins, L. V.,
S. Attridge, and J. Hackett.
1991.
Mutations at rfc or pmi attenuate Salmonella typhimurium virulence for mice.
Infect. Immun.
59:1079-1085[Abstract/Free Full Text].
|
| 4a.
| Crossingham, C. (Difco Laboratories). Personal
communication.
|
| 5.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 6.
|
Ewing, W. H.
1986.
.
Edwards and Ewing's identification of the Enterobacteriaceae.
Elsevier Science Publishers, Amsterdam, The Netherlands.
|
| 7.
|
Fukuda, M., and F. Egami.
1971.
A reinvestigation of the anomeric configuration of mannose in the antigens of Salmonella groups B, D and E.
Eur. J. Biochem.
20:438-441[Medline].
|
| 8.
|
Gish, W., and D. J. States.
1993.
Identification of protein coding regions by database similarity search.
Nat. Genet.
3:266-272[Medline].
|
| 9.
|
Grant, S. G.,
J. Jessee,
F. R. Bloom, and D. Hanahan.
1990.
Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants.
Proc. Natl. Acad. Sci. USA
87:4645-4649[Abstract/Free Full Text].
|
| 10.
|
Hellerqvist, C. G.,
B. Lindberg,
A. Pilotti, and A. A. Lindberg.
1970.
Structural studies on the O-specific side-chains of the cell-wall lipopolysaccharide from Salmonella strasbourg.
Acta Chem. Scand.
24:1168-1174[Medline].
|
| 11.
|
Hellerqvist, C. G.,
B. Lindberg,
S. Svensson,
T. Holme, and A. A. Lindberg.
1969.
Structural studies on the O-specific side chain of the cell wall lipopolysaccharide from Salmonella typhi and Salmonella enteritidis.
Acta Chem. Scand.
23:1588-1596[Medline].
|
| 12.
|
Hellerqvist, C. G.,
B. Lindberg,
S. Svensson,
T. Holme, and A. A. Lindberg.
1969.
Structural studies on the O-specific side-chains of the cell-wall lipopolysaccharide from Salmonella typhimurium LT2.
Carbohydr. Res.
9:237-241.
|
| 13.
|
Jiang, X. M.,
B. Neal,
F. Santiago,
S. J. Lee,
L. K. Romana, and P. R. Reeves.
1991.
Structure and sequence of the rfb (O antigen) gene cluster of Salmonella serovar typhimurium (strain LT2).
Mol. Microbiol.
5:695-713[Medline].
|
| 14.
|
Kanehisha, M. J.
1982.
Los alamos sequence analysis package for nucleic acids and proteins.
Nucleic Acids Res.
10:183-196[Abstract/Free Full Text].
|
| 15.
|
Kauffmann, F.
1975.
.
Classification of bacteria.
Munksgaard, Copenhagen, Denmark.
|
| 16.
|
Klein, P.,
M. Kanehisa, and C. Delisi.
1985.
The detection and classification of membrane spanning proteins.
Biochim. Biophys. Acta
815:468-476[Medline].
|
| 17.
|
Klena, J. D., and C. A. Schnaitman.
1993.
Function of the rfb gene cluster and the rfe gene in the synthesis of O antigen by Shigella dysenteriae 1.
Mol. Microbiol.
9:393-402[Medline].
|
| 18.
|
Lindberg, A. A.,
C. G. Helleqvist,
G. Bagdian-Motta, and P. H. Mäkelä.
1978.
Lipopolysaccharide modification accompanying antigenic conversion by phage P27.
J. Gen. Microbiol.
107:279-287.
|
| 19.
|
Liu, D.,
A. M. Haase,
L. Lindqvist,
A. A. Lindberg, and P. R. Reeves.
1993.
Glycosyl transferases of O-antigen biosynthesis in Salmonella enterica: identification and characterization of transferase genes of groups B, C2, and E1.
J. Bacteriol.
175:3408-3413[Abstract/Free Full Text].
|
| 20.
|
Liu, D.,
L. Lindquist, and P. R. Reeves.
1995.
Transferases of O-antigen biosynthesis in Salmonella enterica: dideoxhexosyl transferases of groups B and C2 and acetyltransferase of group C2.
J. Bacteriol.
177:4084-4088[Abstract/Free Full Text].
|
| 21.
|
Liu, D.,
N. K. Verma,
L. K. Romana, and P. R. Reeves.
1991.
Relationships among the rfb regions of Salmonella serovars A, B, and D.
J. Bacteriol.
173:4814-4819[Abstract/Free Full Text].
|
| 22.
|
Lugtenberg, B.,
J. Meijers,
R. Peters,
P. van der Hoek, and L. van Alphen.
1975.
Electrophoretic resolution of the major outer membrane proteins of Escherichia coli K12 into four bands.
FEBS Lett.
58:254-258[Medline].
|
| 23.
|
Lukomski, S.,
R. A. Hull, and A. I. Hull.
1996.
Identification of the O antigen polymerase (rfc) gene in Escherichia coli O4 by insertional mutagenesis using a nonpolar chloramphenicol resistance cassette.
J. Bacteriol.
178:240-247[Abstract/Free Full Text].
|
| 24.
|
Mäkelä, P. H., and B. A. D. Stocker.
1984.
Genetics of lipopolysaccharide, p. 59-137. In
E. T. Rietschel (ed.), Handbook of endotoxin, vol. I.
Elsevier Science Publishers, Amsterdam, The Netherlands.
|
| 25.
|
Morona, R.,
M. Mavris,
A. Fallarino, and P. A. Manning.
1994.
Characterization of the rfc region of Shigella flexneri.
J. Bacteriol.
176:733-747[Abstract/Free Full Text].
|
| 26.
|
Naide, Y.,
H. Nikaido,
P. H. Mäkelä,
R. G. Wilkinson, and B. A. D. Stocker.
1965.
Semirough strains of Salmonella.
Proc. Natl. Acad. Sci. USA
53:147-153[Free Full Text].
|
| 27.
|
Nghiem, H. O.,
G. Bagdian, and A. M. Staub.
1967.
Études immunochimiques sur les Salmonella. 13. Détermination de la structure du polyoside spécifique d'une Salmonella du group D2 (S. strasbourg).
Eur. J. Biochem.
2:392-398[Medline].
|
| 28.
|
Nghiem, H. O.,
K. Himmelspach, and H. Mayer.
1992.
Immunochemical and structural analysis of the O polysaccharides of Salmonella zuerich [1,9,27,(46)].
J. Bacteriol.
174:1904-1910[Abstract/Free Full Text].
|
| 29.
|
Nghiem, H. O., and A. M. Staub.
1974.
Molecular immunological heterogeneity of the Salmonella zuerich [1, 9, 12, (46), 27] cell-wall polysaccharides.
Carbohydr. Res.
40:153-169.
|
| 30.
|
Nghiem, H. O.,
A. M. Staub,
C. Galanos, and O. Luderitz.
1982.
Distribution and antigen properties of the O-determinants of Salmonella zeurich (1, 9, 27, 46).
Eur. J. Biochem.
125:431-436[Medline].
|
| 31.
|
Ornellas, E. P., and B. A. D. Stocker.
1974.
Relation of lipopolysaccharide character to P1 sensitivity in Salmonella typhimurium.
Virology
60:491-502[Medline].
|
| 32.
|
Popoff, M. Y., and L. L. Minor.
1997.
.
Antigenic formulas of the Salmonella serovars, 7th revision. WHO Collaborating Centre for Reference and Research on Salmonella.
Institut Pasteur, Paris, France.
|
| 33.
|
Reisner, A. H.,
C. A. Bucholtz,
J. Smelt, and S. McNeil.
1993.
Australia's National Genomic Information Service, p. 595-602.
Proceedings of the Twenty-Sixth Annual Hawaii International Conference on Systems Science, vol. 1.
.
|
| 34.
|
Robbins, P. W., and T. Uchida.
1965.
Chemical and macromolecular structure of O-antigens from Salmonella anatum strains carrying mutants of bacteriophage 15.
J. Biol. Chem.
240:375-383[Free Full Text].
|
| 35.
|
Staub, A. M., and G. Bagdian.
1966.
Etudes immunochimique sur les Salmonella. XII. Analyse immunologique des facteures 27A, 27B en 27D.
Ann. Inst. Pasteur (Paris)
110:849-852[Medline].
|
| 36.
|
Verma, N. K.,
N. B. Quigley, and P. R. Reeves.
1988.
O-antigen variation in Salmonella spp.: rfb gene clusters of three strains.
J. Bacteriol.
170:103-107[Abstract/Free Full Text].
|
| 37.
|
Verma, V., and P. R. Reeves.
1989.
Identification and sequence of rfbS and rfbE, which determine antigenic specificity of group A and group D Salmonella.
J. Bacteriol.
171:5694-5701[Abstract/Free Full Text].
|
| 38.
|
Wang, L.,
L. K. Romana, and P. R. Reeves.
1992.
Molecular analysis of a Salmonella enterica group E1 rfb gene cluster: O antigen and the genetic basis of the major polymorphism.
Genetics
130:429-443[Abstract].
|
| 39.
|
Xiang, S.-H.
1995.
.
Variation in rfb gene clusters of Salmonella enterica and origin of group D2. Ph.D. thesis.
University of Sydney, Sydney, New South Wales, Australia.
|
| 40.
|
Xiang, S. H.,
M. Hobbs, and P. R. Reeves.
1994.
Molecular analysis of the rfb gene cluster of a group D2 Salmonella enterica strain: evidence for its origin from an insertion sequence-mediated recombination event between group E and D1 strains.
J. Bacteriol.
176:4357-4365[Abstract/Free Full Text].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Text
