This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Curd, H.
Right arrow Articles by Reeves, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Curd, H.
Right arrow Articles by Reeves, P. R.

 Previous Article

J Bacteriol, February 1998, p. 1002-1007, Vol. 180, No. 4
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Relationships among the O-Antigen Gene Clusters of Salmonella enterica Groups B, D1, D2, and D3

Heather Curd, Dan Liu, and Peter R. Reeves*

Department of Microbiology, The University of Sydney, Sydney, New South Wales 2006, Australia

Received 21 July 1997/Accepted 6 December 1997

    ABSTRACT
Top
Abstract
Text
References

The O antigen is an important cell wall antigen of gram-negative bacteria, and the genes responsible for its biosynthesis are located in a gene cluster. We have cloned and sequenced the DNA segment unique to the O-antigen gene cluster of Salmonella enterica group D3. This segment includes a novel O-antigen polymerase gene (wzyD3). The polymerase gives alpha (1right-arrow6) linkages but has no detectable sequence similarity to that of group D2, which confers the same linkage. We find the remnant of a D3-like wzy gene in the O-antigen gene clusters of groups D1 and B and suggest that this is the original wzy gene of these O-antigen gene clusters.

    TEXT
Top
Abstract
Text
References

Lipopolysaccharide (LPS), an important component of the outer membrane of Gram-negative bacteria, usually consists of three distinct regions: lipid A, core oligosaccharide, and O-specific polysaccharide (O antigen). O antigens consist of repeats of an O unit of generally two to six sugars. In Salmonella enterica, there are 46 types of O antigens (32), which differ in sugar composition and in linkages between sugars and between O units. The O units of S. enterica groups B and D1 have the same backbone sugar residues, the only difference being the presence of different dideoxyhexose (DDH) branch sugars, with abequose in group B (12) and tyvelose in D1 (11) (Fig. 1). This difference determines distinctive epitopes for these two groups: O4 for group B and O9 for group D1.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Structures of the O antigens of S. enterica groups B, D1, D1 carrying phage P27, D2, D3, and E1. Abbreviations: Abe, abequose; Gal, galactose; Man, mannose; Rha, rhamnose; Tyv, tyvelose. O-antigen epitopes are also shown. (B) Proposed epitopes of O antigen of S. enterica serovar Zuerich group D3. The bold outline around the oligosaccharide unit symbolizes the importance of the sugars in the structure of the epitopes; the thicker the line, the greater the participation of the sugars in the combining site. Dotted lines indicate that the additional sugars may weakly participate in the expression of the epitopes (modified after Nghiem et al. [28]).

The O unit of S. enterica group D2 (O9,46) differs from that of group D1 (O9,12) in the anomeric configuration of the mannosyl residue (reviewed by Kauffmann [15]), with alpha -mannose in group D1 (11) and beta -mannose in group D2 (7, 10, 27), and in the galactosyl-mannose linkage formed on O-antigen polymerization, which is alpha (1right-arrow2) in group D1 and alpha (1right-arrow6) in group D2 (10, 11) (Fig. 1). The O unit of S. enterica group E1 (O3,10) has the same backbone as that of group D2, with the tyvelose side branch absent (34) (Fig. 1).

S. enterica group D3 (O9,12,27,46) has the alpha (1right-arrow6) galactosyl-mannose linkage of group D2 but two kinds of O unit with either alpha - or beta -mannosyl residues (28-30) (Fig. 1); these different O units can coexist on the same O-polysaccharide chain (28, 30).

The biosynthesis of the O antigen begins with synthesis of nucleotide sugars and is followed by assembly of O units by sequential transfer of sugars onto undecaprenyl phosphate by transferases. The polymerization of O units is catalyzed by O-antigen polymerase, Wzy (Rfc). Finally, the O polysaccharides are ligated to lipid A-core to form LPS. The genes coding for the enzymes responsible for synthesis of the nucleotide sugars and the transferases necessary for O-unit assembly are located in the O-antigen gene cluster. The O-antigen gene clusters of S. enterica groups B, D1, D2, and E1 have been sequenced, and most genes in these clusters have been identified (13, 19-21, 36-38, 40). The transferase which catalyzes the mannosyl alpha (1right-arrow4) linkage, named WbaU (RfbU), is found in the O-antigen gene clusters of groups B and D1 (19), while the transferase which catalyzes the mannosyl beta (1right-arrow4) linkage was named WbaO (RfbO) and is found in the O-antigen gene clusters of groups D2 and E1 (19) (Fig. 2). For most O antigens, the wzy gene is located in the O-antigen gene cluster (3, 17, 23, 25), and this is true for groups D2 and E1 (40). However, the wzy gene for the alpha (1right-arrow2) linkage in groups B and D1 is elsewhere on the chromosome (26). We have shown previously (40) that the group D2 O-antigen gene cluster comprises 5' and 3' components homologous to those of the D1 and E1 gene clusters, respectively, separated by an H-repeat (H-rpt)-like element (Fig. 2) which we suggested could have mediated a recombination event between D1 and E1 gene clusters to give the D2 cluster (40).


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 2.   Central regions of the O-antigen gene clusters of S. enterica groups D1, D2, D3, and B. N, O, U, and V indicate genes wbaN, -O, -U and -V, respectively. Mannose, rhamnose (transferase only shown), DDH, and wzx genes are indicated by shading. Heavy bars above and below indicate transferase genes. Level of shading indicates degree of amino acid identity to homologous gene of group D1. Note that wbaO has barely detectable amino acid identity to wbaU. The wbaV-wbaU intergenic region of groups B and D1, shown to be remnant wzy genes, are indicated by a cross-out on the wzy gene. The similarities of the D3 cluster are indicated. The insert of plasmid pPR1739 is indicated, as are the binding sites for primers 365, 16, and 20, used for PCR of D3 DNA; primer 365 (TAGAATTCAAAGGGCTGGCTAGCTACA) is based on group D2 sequence (positions 314 to 332) (40), while primers 16 (GCGGTAGGCTTTAGAATA) and 20 (CTCTTGGAATCCAGAACG) are based on sequences of group B (positions 16160 to 16143 and 17238 to 17221, respectively) (13). The 5' end of all four clusters (not shown) comprises rhamnose genes (rmlABCD) and DDH genes (ddhABCD), and the 3' end comprises mannose genes (manBC) and the wbaP gene (not shown).

We have investigated the O-antigen gene cluster of S. enterica group D3 strain M840 (Table 1) which was used in a previous study (39). It had been proposed that group D3 strains may have two O-antigen gene clusters of the D1 and D2 types, which would provide a very simple explanation of the phenotype (24). However, Southern blotting with several probes for genes common to both provided no support for this possibility (39), and one would therefore expect to find an O-antigen gene cluster similar to that of D2, with the addition of a wbaU gene. Southern hybridization of chromosomal DNA of M840 with probes from the wbaOE1, wbaUB, and wzyE1 genes was positive only with the wbaUB probe (39) (subscripts indicate the groups from which the genes were derived). Further Southern hybridization (39) showed that the D3 cluster resembled that of group D1 upstream of wbaV and downstream of wbaU, with a region of difference in the center of the cluster. This finding suggests that strain M840 has novel beta -mannosyl transferase and wzy genes in the central region. In this study, we examined the central region of the O-antigen gene cluster of D3 to determine the basis of the specific characteristics of the D3 O antigen.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Bacterial strains and plasmids used

Sequencing the region between wbaV and wbaU of group D3. PCR was used to amplify the region between wbaV and wbaU of strain M840, using primers (365 and 16) indicated in Fig. 2; a 3.2-kb fragment was obtained. This fragment was then cloned into pGEM-T (Promega), and Escherichia coli DH10b (Table 1) was used as the host strain for the resulting plasmid, pPR1739. The region between the end of wbaV and the beginning of wbaU of M840 was completely sequenced in both directions, using dye-primer sequencing kits (ABI), a Perkin-Elmer Cetus DNA Thermal Cycler, and an ABI model 377 Sequencer. The sequencing of this region was done by using primer walking with each internal region amplified and cloned. A 2,497-bp segment between the end of wbaV and the start of wbaU was sequenced.

The sequence was analyzed by using ANGIS (Australian National Genomic Information Service) (33) and the following programs: BESTFIT (5) and SEQH (14) for identification, similarity of DNA, or deduced amino acid sequences; ALOM (programs developed by M. Kanehisa, National Institutes of Health) for predication of potential transmembrane segments by the method of Klein et al. (16); and BLAST (1, 8) for database similarity searches. The first 877 bp are very similar to the corresponding region of group D2, including the last 50 bp of wbaV, 376 bp of noncoding DNA, followed by 451 bp of the H-rpt (insertion sequence-like element) (40). The average level of DNA sequence identity in this region is 78.7%. After the H-rpt sequence, there is a 418-bp noncoding region which has no detectable homology with any sequence in the database (GenBank), and then an open reading frame (ORF) of 1,176 bp (Fig. 2), with its stop codon overlapped by the start codon of the wbaU gene (ATGA).

Identification of the wzyD3 gene. We were expecting an alpha (1right-arrow6) O-antigen polymerase gene and a beta (1right-arrow4) mannose transferase gene. Analysis of the deduced amino acid sequence of the protein product of the only ORF (392 amino acids) showed no detectable sequence similarity to any protein in GenBank; however it has a hydropathy profile very similar to those of Wzy proteins, with 10 potential transmembrane segments and a large periplasmic loop (data not shown), making it a candidate for the predicted alpha (1right-arrow6) O-antigen polymerase gene.

Plasmid pPR1739 was transferred into S. enterica serovar Typhimurium strain C5 wzy mutant LV386 (Table 1), and LPS of the resulting strain was analyzed by electrophoresis using a sodium dodecyl sulfate-12.5% polyacrylamide gel (22) (Fig. 3). The results showed that LV386/pPR1739 produced long-chain O antigen, indicating that the wzy mutation could be complemented by the only ORF in pPR1739, which is thereby shown to be an O-antigen polymerase gene and named wzy. It is identified as wzyD3 in this report. Strain LV386/pPR1739 agglutinated with O27 antiserum in addition to O4 antiserum (Table 2), indicating that this polymerase ligates O units with an alpha (1right-arrow6) linkage. However, our O27 antiserum, which agglutinated LV386/pPR1739, did not agglutinate strain M840, which should be O1,9,27,46 (see below for explanation).


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 3.   Identification of the wzyD3 gene by analysis of the LPS on a sodium dodecyl sulfate-12.5% polyacrylamide gel and silver staining. Lane 1, LV386 (S. enterica LT2 wzy mutant); lane 2, LV386/pPR1739; lane 3, SL1854 (LT2 wild type).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Identification of wzyD3 gene

Group D3 has O units with both mannosyl alpha (1right-arrow4) and mannosyl beta (1right-arrow4) linkages, and we investigated if both are polymerized by WzyD3 by combining the wzyD3 and beta (1right-arrow4) mannose transferase genes in a wzy mutant. We made plasmid pPR1820, which carries the wbaO gene from group E1 and the wzyD3 in low-copy-number vector pPR637 (13). We cloned the 2.1-kb HincII-PstI fragment from pPR966 (positions 10045 to 12217 of the group E1 O-antigen gene cluster [38]) into HindIII (end-filled) and PstI sites on the polylinker of pPR637, followed by cloning of the 2.1-kb insert as a BglII-SacI (vector) fragment from pPR1739 into the resulting plasmid, using BamHI and SacI sites. Our only wzy mutant, LV386, was unexpectedly found to be spectinomycin and streptomycin resistant and therefore not suitable for transfer of pPR1820; therefore, we made P9487, a wzy mutant of LT2 (Table 1). Strain P9487/pPR1820 has alpha (1right-arrow6) polymerase, alpha -mannosyl, and beta -mannosyl transferase genes and should produce two kinds of O antigen: -6-[(alpha Abe-1,3-)-alpha Man-1,4-alpha Rha-1,3-alpha Gal]-1-, and -6-[(alpha Abe-1,3-)-beta Man-1,4-alpha Rha-1,3-alpha Gal]-1- (see the legend to Fig. 1 for abbreviations). Strain P9487/pPR1820 was agglutinated with O27 antiserum but not O46 antiserum (Table 2). Factors 27 and 46 have been related to the oligosaccharide -6-[(alpha DDH-1,3-)-alpha (beta )Man-1,4-alpha Rha-1,3-alpha Gal]-1- with alpha -mannose for O27 and beta -mannose for O46. Agglutination with O27 serum indicates that the wzyD3 gene in this construct is active. The failure of the O46 serum to agglutinate suggested that the beta -mannosyl (1right-arrow4) linkage is absent in the polymer, but see below.

Plasmid pPR618, which carries prt (rfbS) and tyv (rfbE) genes of group D1, allowing synthesis of CDP-tyvelose in a group B strain (37), was transferred into P9487/pPR1820. Strain P9487/pPR1820/pPR618 could potentially produce two additional O antigens: -6-[(alpha Tyv-1,3-)-alpha Man-1,4-alpha Rha-1,3-alpha Gal]-1- and -6-[(alpha Tyv-1,3-)-beta Man-1,4-alpha Rha-1,3-alpha Gal]-1-; this strain was agglutinated with O4, O9, O27, and O46 antisera (Table 2), the latter indicating the presence of the mannosyl beta (1right-arrow4) linkage, showing that WzyD3 could polymerize O units containing beta -mannose in addition to those containing alpha -mannose. It is interesting that the polymerase making the galactosyl-mannose linkage is not specific for the anomeric state of the mannosyl residue, although the situation is not known for the E1/D2 and group B polymerases, which have not been tested with the alternate form of the O unit.

Specificity of O27 and O46 sera. In group B and D1 strains lysogenized by phage P27, a phage-encoded polymerase forms alpha (1right-arrow6) linkages between O units, conferring the new epitope, O27 (2, 18). The failure of the O27 serum to agglutinate the parental group D3 strain in our hands (see above) probably reflects the specificity of the O27 sera for the DDH. Distinct epitopes O27A, O27B, and O27D were distinguished in the early literature (35) as cross-reacting specificities for the O antigens of group A, B, and D1 strains, respectively, when lysogenized by phage P27. However, the current protocol for O27 serum (6) uses a lysogenized group B strain, and the Difco O27 antiserum used in this study had been raised by using S. enterica serovar Schleissheim (group B, phage 27-lysogenized strain [O1,4,12,27], absorbed with S. enterica serovars Paratyphi B [O1,4,5,12] and Essen [O4,12]) (4a). Given that three related but distinct specificities were recognized earlier, it probably has much lower specificity for tyvelose-containing O antigens than for those with abequose and hence at the dilution provided failed to agglutinate our group D3 strain.

We suggest that the current nomenclature, treating O27 as a single specificity, can be misleading as the standard O27 serum, made with a group B lysogen (6), does not appear to agglutinate all strains carrying the O27 specificity at the dilution present in commercial sera, the activity being dependent on the DDH present. This may well have led to underreporting of group D3 strains, which would appear as group D2 strains if the O27 serum was not effective at the dilution used. It is of interest that the O27 serum used in a specific study of group D3 (28) was made not by the standard protocol but by using a lysogenized group D1 strain, presumably to gain better reaction with the tyvelose-containing D3 O antigen.

The O46 epitope was identified in group D2 and is also present in group D3; agglutination by O46 serum requires the alpha (1right-arrow6) linkage between galactose and beta -mannose (not alpha -mannose). The O antigen of group E1, which has the structure described above (Fig. 1), does not react to O46 serum (32), showing that DDH is also required. We suggest that the beta -mannosyl linkage is present in both P9487/pPR1820/pPR618 and P9487/pPR1820, and the failure of the O46 serum to react with the O antigen of P9487/pPR1820 while reacting with P9487/pPR1820/pPR618 reflects a requirement for tyvelose (not abequose) as DDH. The O antigen of P9487/pPR1820 has a unique structure with alpha (1right-arrow6) linkage between galactose and beta -mannose and with abequose as DDH. It is possible that as for O27, there are three forms of O46 with preference for abequose, paratose, and tyvelose, but this has not been tested by titration of sera against the three O-antigen forms.

Lack of the beta -mannosyl transferase gene. We did not find the expected beta -mannosyl transferase gene in the O-antigen gene cluster of group D3. We therefore looked at regions between wbaV and wbaN of four additional group D3 strains (Table 1) together with M840 to determine whether M840 was typical. PCR using primers 365 and 20 (Fig. 2) showed that a 4.3-kb DNA fragment could be amplified from all five strains, indicating that the gene organization in this region is the same in all of them. The wbaO gene of group D3 has not been located but must have little or no sequence similarity to the known wbaO gene in group E1 and D2, and it might be present on a phage on elsewhere of the chromosome.

Ancestral form of group B and D1 O antigens. The 318-bp remnant wzy gene of group B between wbaV and wbaU (bp 15061 to 15,378 [13]) has a high level of identity to the wzyD3 gene at the nucleic acid level (Fig. 4). The corresponding region of group D1 is more complex: there are 577 bp (positions 2303 to 2879 [21]), of which the first 344 show low-level similarity to wzyD2/E1 at the amino acid level (40), while the following 233-bp sequence has a high level of identity to wzyD3 (Fig. 4).


View larger version (50K):
[in this window]
[in a new window]
 
FIG. 4.   DNA sequence alignment of the second half of the wzyD3 gene and the intergenic regions of groups D1 and B. Numbering of the group D3 gene starts from the beginning of the gene; numberings of group D1 and group B sequences are from references 21 and 13, respectively. Asterisks indicate the overlap of the stop codon of the wzy gene and the start codon of the wbaU gene. Strike-through and italic sections of the hypothetical wzyB gene are alternate alignments of one sequence displayed twice to indicate similarity to two segments of wzyD3 which may represent the basis for deletion by homologous recombination.

Alignment of the functional wzyD3 gene with the remnants of such a gene in the wbaV-wbaU intergenic spaces of groups B and D1 (Fig. 4) gives a strong indication that groups B and D1 once shared a common wzy gene for an alpha (1right-arrow6) linkage in addition to their many other similarities: they now have an alpha (1right-arrow2) linkage wzy gene of unknown origin elsewhere on the chromosome (the original rfc gene of strain LT2). Presumably the ancestral alpha (1right-arrow6) wzy gene suffered inactivation and substantial deletion after the introduction of the new alpha (1right-arrow2) polymerase gene. There are possible parallels with E2 strains which have the E1 antigen gene cluster but in addition a bacteriophage (varepsilon 15) which encodes a beta (1right-arrow6) linkage polymerase which functionally replaces the alpha (1right-arrow6) linkage polymerase of the E1 O-antigen cluster (24).

It is interesting that the presumed ancestral alpha (1right-arrow6) linkage was regained later in many group B strains by lysogenization with the P27 bacteriophage which carries an alpha (1right-arrow6) linkage polymerase (24), but in this case nothing is known of the wzy gene. O27 strains thought to be of this type comprise 74 of 144 group B serovars (32). The alpha (1right-arrow6) linkage is also present in group D2; in this case the gene involved is derived from group E1 (40).

Origins of the D3 O-antigen gene cluster. The location of the H-rpt suggests that it was involved in transfer of the wzy gene to create the D3 gene cluster, just as we proposed for wzyE1 of D2. In the case of D2, both wzy and wbaO are almost identical to genes of group E1 whereas the rest of the gene cluster is from group D1, making an origin by recombination very convincing. However, in the case of D3, the one additional gene not present in group D1, wzyD3, is the wzy gene that we now also believe to have been in the ancestral O-antigen D1 and B gene clusters. It is not yet clear how the D3 gene cluster arose, as there are alternative possibilities. In some ways, the simplest hypothesis is that it derives from the ancestral D1 cluster by addition of an H-rpt, which subsequently suffered deletion of its downstream end. However, in that case we have no explanation for the presence of the H-rpt in the D3 cluster.

The alternative hypothesis is that the D3 cluster arose by transfer of the wzy gene mediated by the H-rpt. The insertion site of the H-rpt is the same in D2 and D3 (only the left-hand end survives in D3), suggesting that the same H-rpt insertion was involved in the formation of both D2 and D3. However, the sequence of events is not clear, as two different wzy genes are involved. The recipient would have been a D1 strain or B strain which had lost its alpha (1right-arrow6)-linkage wzy gene and regained it by this recombination. It is too early to speculate in detail, but the alignments are shown in Fig. 2.

Nucleotide sequence accession number. The GenBank accession number of the sequence shown in Fig. 2 is AF017148.

    ACKNOWLEDGMENTS

This work was supported by a grant from the Australian Research Council.

We thank M. Hobbs for his useful discussion, and we thank C. Murray and staff at the Institute of Medical and Veterinary Science, Adelaide, Australia, and M. Y. Popoff at the Pasteur Institute, Paris, France, for helpful discussion on serology.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology (G08), The University of Sydney, NSW 2006, Australia. Phone: 61-2-9351 2536. Fax: 61-2-9351 4571. E-mail: reeves{at}angis.usyd.edu.au.

    REFERENCES
Top
Abstract
Text
References

1. Altschul, A. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
2. Bagdian, G., O. Luderitz, and A. M. Staub. 1966. Immunochemical studies on Salmonella. XI. Chemical modification correlated with conversion of group B by bacteriophage 27. Ann. N. Y. Acad. Sci. 133:405-424[Medline].
3. Brown, P. K., L. K. Romana, and P. R. Reeves. 1992. Molecular analysis of the rfb gene cluster of Salmonella serovar Muenchen (strain M67): genetic basis of the polymorphism between groups C2 and B. Mol. Microbiol. 6:1385-1394[Medline].
4. Collins, L. V., S. Attridge, and J. Hackett. 1991. Mutations at rfc or pmi attenuate Salmonella typhimurium virulence for mice. Infect. Immun. 59:1079-1085[Abstract/Free Full Text].
4a. Crossingham, C. (Difco Laboratories). Personal communication.
5. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.
6. Ewing, W. H. 1986. . Edwards and Ewing's identification of the Enterobacteriaceae. Elsevier Science Publishers, Amsterdam, The Netherlands.
7. Fukuda, M., and F. Egami. 1971. A reinvestigation of the anomeric configuration of mannose in the antigens of Salmonella groups B, D and E. Eur. J. Biochem. 20:438-441[Medline].
8. Gish, W., and D. J. States. 1993. Identification of protein coding regions by database similarity search. Nat. Genet. 3:266-272[Medline].
9. Grant, S. G., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc. Natl. Acad. Sci. USA 87:4645-4649[Abstract/Free Full Text].
10. Hellerqvist, C. G., B. Lindberg, A. Pilotti, and A. A. Lindberg. 1970. Structural studies on the O-specific side-chains of the cell-wall lipopolysaccharide from Salmonella strasbourg. Acta Chem. Scand. 24:1168-1174[Medline].
11. Hellerqvist, C. G., B. Lindberg, S. Svensson, T. Holme, and A. A. Lindberg. 1969. Structural studies on the O-specific side chain of the cell wall lipopolysaccharide from Salmonella typhi and Salmonella enteritidis. Acta Chem. Scand. 23:1588-1596[Medline].
12. Hellerqvist, C. G., B. Lindberg, S. Svensson, T. Holme, and A. A. Lindberg. 1969. Structural studies on the O-specific side-chains of the cell-wall lipopolysaccharide from Salmonella typhimurium LT2. Carbohydr. Res. 9:237-241.
13. Jiang, X. M., B. Neal, F. Santiago, S. J. Lee, L. K. Romana, and P. R. Reeves. 1991. Structure and sequence of the rfb (O antigen) gene cluster of Salmonella serovar typhimurium (strain LT2). Mol. Microbiol. 5:695-713[Medline].
14. Kanehisha, M. J. 1982. Los alamos sequence analysis package for nucleic acids and proteins. Nucleic Acids Res. 10:183-196[Abstract/Free Full Text].
15. Kauffmann, F. 1975. . Classification of bacteria. Munksgaard, Copenhagen, Denmark.
16. Klein, P., M. Kanehisa, and C. Delisi. 1985. The detection and classification of membrane spanning proteins. Biochim. Biophys. Acta 815:468-476[Medline].
17. Klena, J. D., and C. A. Schnaitman. 1993. Function of the rfb gene cluster and the rfe gene in the synthesis of O antigen by Shigella dysenteriae 1. Mol. Microbiol. 9:393-402[Medline].
18. Lindberg, A. A., C. G. Helleqvist, G. Bagdian-Motta, and P. H. Mäkelä. 1978. Lipopolysaccharide modification accompanying antigenic conversion by phage P27. J. Gen. Microbiol. 107:279-287.
19. Liu, D., A. M. Haase, L. Lindqvist, A. A. Lindberg, and P. R. Reeves. 1993. Glycosyl transferases of O-antigen biosynthesis in Salmonella enterica: identification and characterization of transferase genes of groups B, C2, and E1. J. Bacteriol. 175:3408-3413[Abstract/Free Full Text].
20. Liu, D., L. Lindquist, and P. R. Reeves. 1995. Transferases of O-antigen biosynthesis in Salmonella enterica: dideoxhexosyl transferases of groups B and C2 and acetyltransferase of group C2. J. Bacteriol. 177:4084-4088[Abstract/Free Full Text].
21. Liu, D., N. K. Verma, L. K. Romana, and P. R. Reeves. 1991. Relationships among the rfb regions of Salmonella serovars A, B, and D. J. Bacteriol. 173:4814-4819[Abstract/Free Full Text].
22. Lugtenberg, B., J. Meijers, R. Peters, P. van der Hoek, and L. van Alphen. 1975. Electrophoretic resolution of the major outer membrane proteins of Escherichia coli K12 into four bands. FEBS Lett. 58:254-258[Medline].
23. Lukomski, S., R. A. Hull, and A. I. Hull. 1996. Identification of the O antigen polymerase (rfc) gene in Escherichia coli O4 by insertional mutagenesis using a nonpolar chloramphenicol resistance cassette. J. Bacteriol. 178:240-247[Abstract/Free Full Text].
24. Mäkelä, P. H., and B. A. D. Stocker. 1984. Genetics of lipopolysaccharide, p. 59-137. In E. T. Rietschel (ed.), Handbook of endotoxin, vol. I. Elsevier Science Publishers, Amsterdam, The Netherlands.
25. Morona, R., M. Mavris, A. Fallarino, and P. A. Manning. 1994. Characterization of the rfc region of Shigella flexneri. J. Bacteriol. 176:733-747[Abstract/Free Full Text].
26. Naide, Y., H. Nikaido, P. H. Mäkelä, R. G. Wilkinson, and B. A. D. Stocker. 1965. Semirough strains of Salmonella. Proc. Natl. Acad. Sci. USA 53:147-153[Free Full Text].
27. Nghiem, H. O., G. Bagdian, and A. M. Staub. 1967. Études immunochimiques sur les Salmonella. 13. Détermination de la structure du polyoside spécifique d'une Salmonella du group D2 (S. strasbourg). Eur. J. Biochem. 2:392-398[Medline].
28. Nghiem, H. O., K. Himmelspach, and H. Mayer. 1992. Immunochemical and structural analysis of the O polysaccharides of Salmonella zuerich [1,9,27,(46)]. J. Bacteriol. 174:1904-1910[Abstract/Free Full Text].
29. Nghiem, H. O., and A. M. Staub. 1974. Molecular immunological heterogeneity of the Salmonella zuerich [1, 9, 12, (46), 27] cell-wall polysaccharides. Carbohydr. Res. 40:153-169.
30. Nghiem, H. O., A. M. Staub, C. Galanos, and O. Luderitz. 1982. Distribution and antigen properties of the O-determinants of Salmonella zeurich (1, 9, 27, 46). Eur. J. Biochem. 125:431-436[Medline].
31. Ornellas, E. P., and B. A. D. Stocker. 1974. Relation of lipopolysaccharide character to P1 sensitivity in Salmonella typhimurium. Virology 60:491-502[Medline].
32. Popoff, M. Y., and L. L. Minor. 1997. . Antigenic formulas of the Salmonella serovars, 7th revision. WHO Collaborating Centre for Reference and Research on Salmonella. Institut Pasteur, Paris, France.
33. Reisner, A. H., C. A. Bucholtz, J. Smelt, and S. McNeil. 1993. Australia's National Genomic Information Service, p. 595-602. Proceedings of the Twenty-Sixth Annual Hawaii International Conference on Systems Science, vol. 1. .
34. Robbins, P. W., and T. Uchida. 1965. Chemical and macromolecular structure of O-antigens from Salmonella anatum strains carrying mutants of bacteriophage varepsilon 15. J. Biol. Chem. 240:375-383[Free Full Text].
35. Staub, A. M., and G. Bagdian. 1966. Etudes immunochimique sur les Salmonella. XII. Analyse immunologique des facteures 27A, 27B en 27D. Ann. Inst. Pasteur (Paris) 110:849-852[Medline].
36. Verma, N. K., N. B. Quigley, and P. R. Reeves. 1988. O-antigen variation in Salmonella spp.: rfb gene clusters of three strains. J. Bacteriol. 170:103-107[Abstract/Free Full Text].
37. Verma, V., and P. R. Reeves. 1989. Identification and sequence of rfbS and rfbE, which determine antigenic specificity of group A and group D Salmonella. J. Bacteriol. 171:5694-5701[Abstract/Free Full Text].
38. Wang, L., L. K. Romana, and P. R. Reeves. 1992. Molecular analysis of a Salmonella enterica group E1 rfb gene cluster: O antigen and the genetic basis of the major polymorphism. Genetics 130:429-443[Abstract].
39. Xiang, S.-H. 1995. . Variation in rfb gene clusters of Salmonella enterica and origin of group D2. Ph.D. thesis. University of Sydney, Sydney, New South Wales, Australia.
40. Xiang, S. H., M. Hobbs, and P. R. Reeves. 1994. Molecular analysis of the rfb gene cluster of a group D2 Salmonella enterica strain: evidence for its origin from an insertion sequence-mediated recombination event between group E and D1 strains. J. Bacteriol. 176:4357-4365[Abstract/Free Full Text].


J Bacteriol, February 1998, p. 1002-1007, Vol. 180, No. 4
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Iguchi, A., Ooka, T., Ogura, Y., Asadulghani, , Nakayama, K., Frankel, G., Hayashi, T. (2008). Genomic comparison of the O-antigen biosynthesis gene clusters of Escherichia coli O55 strains belonging to three distinct lineages. Microbiology 154: 559-570 [Abstract] [Full Text]  
  • Fitzgerald, C., Collins, M., van Duyne, S., Mikoleit, M., Brown, T., Fields, P. (2007). Multiplex, Bead-Based Suspension Array for Molecular Determination of Common Salmonella Serogroups. J. Clin. Microbiol. 45: 3323-3334 [Abstract] [Full Text]  
  • Samuel, G., Hogbin, J.-P., Wang, L., Reeves, P. R. (2004). Relationships of the Escherichia coli O157, O111, and O55 O-Antigen Gene Clusters with Those of Salmonella enterica and Citrobacter freundii, Which Express Identical O Antigens. J. Bacteriol. 186: 6536-6543 [Abstract] [Full Text]  
  • Fitzgerald, C., Sherwood, R., Gheesling, L. L., Brenner, F. W., Fields, P. I. (2003). Molecular Analysis of the rfb O Antigen Gene Cluster of Salmonella enterica Serogroup O:6,14 and Development of a Serogroup-Specific PCR Assay. Appl. Environ. Microbiol. 69: 6099-6105 [Abstract] [Full Text]  
  • Pacinelli, E., Wang, L., Reeves, P. R. (2002). Relationship of Yersinia pseudotuberculosis O Antigens IA, IIA, and IVB: the IIA Gene Cluster Was Derived from That of IVB. Infect. Immun. 70: 3271-3276 [Abstract] [Full Text]  
  • Wang, L., Huskic, S., Cisterne, A., Rothemund, D., Reeves, P. R. (2002). The O-Antigen Gene Cluster of Escherichia coli O55:H7 and Identification of a New UDP-GlcNAc C4 Epimerase Gene. J. Bacteriol. 184: 2620-2625 [Abstract] [Full Text]  
  • Wang, L., Andrianopoulos, K., Liu, D., Popoff, M. Y., Reeves, P. R. (2002). Extensive Variation in the O-Antigen Gene Cluster within One Salmonella enterica Serogroup Reveals an Unexpected Complex History. J. Bacteriol. 184: 1669-1677 [Abstract] [Full Text]  
  • Wang, L., Qu, W., Reeves, P. R. (2001). Sequence Analysis of Four Shigella boydii O-Antigen Loci: Implication for Escherichia coli and Shigella Relationships. Infect. Immun. 69: 6923-6930 [Abstract] [Full Text]  
  • Jensen, S. O., Reeves, P. R. (2001). Molecular evolution of the GDP-mannose pathway genes (manB and manC) in Salmonella enterica. Microbiology 147: 599-610 [Abstract] [Full Text]  
  • Shepherd, J. G., Wang, L., Reeves, P. R. (2000). Comparison of O-Antigen Gene Clusters of Escherichia coli (Shigella) Sonnei and Plesiomonas shigelloides O17: Sonnei Gained Its Current Plasmid-Borne O-Antigen Genes from P. shigelloides in a Recent Event. Infect. Immun. 68: 6056-6061 [Abstract] [Full Text]  
  • Wang, L., Reeves, P. R. (2000). The Escherichia coli O111 and Salmonella enterica O35 Gene Clusters: Gene Clusters Encoding the Same Colitose-Containing O Antigen Are Highly Conserved. J. Bacteriol. 182: 5256-5261 [Abstract] [Full Text]  
  • Kido, N., Kobayashi, H. (2000). A Single Amino Acid Substitution in a Mannosyltransferase, WbdA, Converts the Escherichia coli O9 Polysaccharide into O9a: Generation of a New O-Serotype Group. J. Bacteriol. 182: 2567-2573 [Abstract] [Full Text]  
  • Belanger, M., Burrows, L. L., Lam, J. S. (1999). Functional analysis of genes responsible for the synthesis of the B-band O antigen of Pseudomonas aeruginosa serotype O6 lipopolysaccharide. Microbiology 145: 3505-3521 [Abstract] [Full Text]  
  • Rocchetta, H. L., Burrows, L. L., Lam, J. S. (1999). Genetics of O-Antigen Biosynthesis in Pseudomonas aeruginosa. Microbiol. Mol. Biol. Rev. 63: 523-553 [Abstract] [Full Text]  
  • Wong, D. K.-H., Morris, C., Lam, T. L., Wong, W. K. R., Hackett, J. (1999). Identification of O-antigen polymerase transcription and translation start signals and visualization of the protein in Salmonella enterica serovar Typhimurium. Microbiology 145: 2443-2451 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Curd, H.
Right arrow Articles by Reeves, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Curd, H.
Right arrow Articles by Reeves, P. R.